Good Morning,

I have had request from one of our members of staff to extract information from the database about who uploaded documents into courses and when.  I've managed to get 75% of the way there but I can't seem to figure out which field / value it is that tells me which member of staff uploaded the document as opposed to just viewing it.  Does anyone have any idea which table(s) / field(s) hold this information?

Thank you in advance for any help

Justine Allen
NESCOT



********************************************************************************
This message and any files transmitted with it are confidential and are intended solely for the use of the individual to whom
they are addressed.
This communication represents the originator's personal views and opinions, which do not necessarily reflect those of Nescot
College.
If you have received this message in error you are requested to preserve this confidentiality and to advise the sender of any
errors of transmission.

http://www.nescot.ac.uk/
******************************************************************************** ------_=_NextPart_001_01C6257F.2CDE49BC-- ========================================================================Date: Mon, 30 Jan 2006 09:39:55 +0000 Reply-To: Blackboard/Courseinfo userslist Sender: Blackboard/Courseinfo userslist From: Peter Rayment Subject: UK Blackboard CMS User Group Meeting 15/02/06 Mime-Version: 1.0 Content-Type: text/plain; charset=US-ASCII Content-Transfer-Encoding: 7bit Content-Disposition: inline Hello We have now finalised details of the Agenda for the UK Blackboard CMS User Group meeting in Cardiff on the 15th February 2006 For details of the meeting Agenda plus travel arrangements please use this link http://www.cardiff.ac.uk/schoolsanddivisions/divisions/insrv/elearning/bb_cms_user_mtg.html We have also created a questionaire http://www.cardiff.ac.uk/schoolsanddivisions/divisions/insrv/elearning/bb_cms_user_mtg.html to try and establish usage of CMS system by UK users. Please could I ask anyone who has purchased the CMS to help us by filling out a few brief questions for us. Even if you are not attending the meeting, if you could answer the questionare that would be really helpful thank you. If anyone would like further details of the UK CMS User group meeting or help with travel arrangements please feel free to contact me. Peter Rayment Senior Learning Technology Support Officer Cardiff University ========================================================================Date: Mon, 30 Jan 2006 13:05:13 -0000 Reply-To: Blackboard/Courseinfo userslist Sender: Blackboard/Courseinfo userslist From: "Roberts, Gillian" Subject: large scale simultaneous multiple choice assessments in Blackboard MIME-Version: 1.0 Content-Type: multipart/alternative; boundary="----_=_NextPart_001_01C6259D.CEE79FD5" This is a multi-part message in MIME format. ------_=_NextPart_001_01C6259D.CEE79FD5 Content-Type: text/plain; charset="us-ascii" Content-Transfer-Encoding: quoted-printable Hi, I'm trying to determine if anyone has undertaken large scale, simultaneous, MCQ assessments in Blackboard? We managed to assess 258 concurrent users answering text based questions and saving responses on a save-as-you-go basis. Has anyone managed to assess a higher number of concurrent users? Cheers Gillian Dr Gillian Roberts CBS Fellow in CIT in Learning & Teaching Glasgow Caledonian Business School 70 Cowcaddens Road GLASGOW G4 0BA Email: g.m.roberts@gcal.ac.uk Telephone: 0141 331 8243 or Mobile 07769 743514 ------_=_NextPart_001_01C6259D.CEE79FD5 Content-Type: text/html; charset="us-ascii" Content-Transfer-Encoding: quoted-printable

Hi,

 

I’m trying to determine if anyone has undertaken large scale, simultaneous, MCQ assessments in Blackboard?

 

We managed to assess 258 concurrent users answering text based questions and saving responses on a save-as-you-go basis.

 

Has anyone managed to assess a higher number of concurrent users?

 

Cheers

Gillian

 

Dr Gillian Roberts

CBS Fellow in CIT in Learning & Teaching

Glasgow Caledonian Business School

70 Cowcaddens Road

GLASGOW

G4 0BA

Email: g.m.roberts@gcal.ac.uk

Telephone: 0141 331 8243 or Mobile 07769 743514

 

------_=_NextPart_001_01C6259D.CEE79FD5-- ========================================================================Date: Mon, 30 Jan 2006 13:16:27 -0000 Reply-To: Blackboard/Courseinfo userslist Sender: Blackboard/Courseinfo userslist From: Jonathan Blatchford Organization: Bexley College Subject: Re: large scale simultaneous multiple choice assessments in Blackboard In-Reply-To: <09FFF345110913458F1C9D8850F41D6003F70B59@EXCHANGE.enterprise.gcal.ac.uk> MIME-Version: 1.0 Content-type: Multipart/Alternative; boundary="Alt-Boundary-10323.16104171" --Alt-Boundary-10323.16104171 Content-type: text/plain; charset=ISO-8859-1 Content-transfer-encoding: Quoted-printable Content-description: Mail message body We have tried something similar, although we seem to have stopped at 220... I will be looking in to this as soon as i get a free moment! regards Jonathan Jonathan Blatchford Bexley College Blackboard Technical Co-ordinator Learning Facilitator LRC - Staff Room x - 4089 www.bexley.ac.uk On 30 Jan 2006 at 13:05, Roberts, Gillian wrote: > > Hi, > > Im trying to determine if anyone has undertaken large scale, simultaneous, MCQ assessments in > Blackboard? > > We managed to assess 258 concurrent users answering text based questions and saving > responses on a save-as-you-go basis. > > Has anyone managed to assess a higher number of concurrent users? > > Cheers > Gillian > > Dr Gillian Roberts > CBS Fellow in CIT in Learning & Teaching > Glasgow Caledonian Business School > 70 Cowcaddens Road > GLASGOW > G4 0BA > Email: g.m.roberts@gcal.ac.uk > Telephone: 0141 331 8243 or Mobile 07769 743514 > > > > ___________________________________________________________________ ___ > This email has been scanned for viruses by the Email Protection Agency > For more information please visit http://www.epagency.net > ___________________________________________________________________ ___ > --Alt-Boundary-10323.16104171 Content-type: text/html; charset=ISO-8859-1 Content-transfer-encoding: Quoted-printable Content-description: Mail message body
We have tried something similar, although we seem to have stopped at 220...

I will be looking in to this as soon as i get a free moment!

regards

Jonathan

 
Jonathan Blatchford
Bexley College
Blackboard Technical Co-ordinator
Learning Facilitator
LRC - Staff Room
x - 4089
www.bexley.ac.uk


On 30 Jan 2006 at 13:05, Roberts, Gillian wrote:

>
> Hi,
>
> I’m trying to determine if anyone has undertaken large scale, simultaneous, MCQ assessments in
> Blackboard?
>
> We managed to assess 258 concurrent users answering text based questions and saving
> responses on a save-as-you-go basis.
>
> Has anyone managed to assess a higher number of concurrent users?
>
> Cheers
> Gillian
>
> Dr Gillian Roberts
> CBS Fellow in CIT in Learning & Teaching
> Glasgow Caledonian Business School
> 70 Cowcaddens Road
> GLASGOW
> G4 0BA
> Email: g.m.roberts@gcal.ac.uk
> Telephone: 0141 331 8243 or Mobile 07769 743514
>
>
>
> ______________________________________________________________________
> This email has been scanned for viruses by the Email Protection Agency
> For more information please visit http://www.epagency.net
> ______________________________________________________________________
>



--Alt-Boundary-10323.16104171-- ========================================================================Date: Mon, 30 Jan 2006 14:28:57 -0000 Reply-To: Blackboard/Courseinfo userslist Sender: Blackboard/Courseinfo userslist From: Scott Miller Subject: Learning Technologist vacancy Comments: To: VLE@JISCMAIL.AC.UK MIME-Version: 1.0 Content-Type: text/plain; charset="iso-8859-1" Content-Transfer-Encoding: quoted-printable Durham University has a vacancy for a Learning Technologist, based in the Information Technology Service. The postholder will encourage and support academic colleagues in their use of e-learning and will promote the strategic deployment of e-learning throughout the University, particularly in use of the Blackboard VLE. You should have a first degree or equivalent and preferably a relevant postgraduate qualification with proven applications training skills and experience of developing and evaluating on-line learning materials. Salary Between 23182 and 30002 per annum Closing date for applications: 10 Feb 2006 Details can be found at https://jobs.dur.ac.uk/home.asp It is vacancy reference 1216 Regards, Scott ------------------------------------- Scott Miller University of Durham Head of e-Learning and Web Services Information Technology Service Science Laboratories South Road Durham DH1 3LE Tel. 0191 334 2785 (Internal 42785) Fax. 0191 334 2701 ========================================================================Date: Mon, 30 Jan 2006 15:32:14 +0000 Reply-To: Blackboard/Courseinfo userslist Sender: Blackboard/Courseinfo userslist From: Dr Arthur Loughran Subject: Essay and Short Essay Questions Hi, Is there a limit to the length of an Essay question? Was 255 characters at one time but that is probably old hat now. In Short Essay questions the number of rows can be set but is there limit on the number of characters that can be entered into any one line? thanks, Arthur Loughran ========================================================================Date: Mon, 30 Jan 2006 16:36:10 +0000 Reply-To: Blackboard/Courseinfo userslist Sender: Blackboard/Courseinfo userslist From: Robin Shaw Subject: Online conference MIME-Version: 1.0 Content-Type: text/plain; charset="UTF-8" Content-Transfer-Encoding: quoted-printable Dear all, I am delighted to invite you to take part in the inaugural Designs on eLearning Online conference which will take place from 27 to 31 March 2006. The conference will be international in scope and will focus on the use of technology in learning and teaching in art, design and communication. Please accept my apologies if you get this more than once! You can see full details of the conference at http://www.designsonelearning.net/index.php?section=1&item=2 In the “speakers” link you’ll find the biographies of the invited speakers and the abstracts of their contributions. The aim of the conference is to: · provide a forum for the dissemination of innovative and successful uses of technology in learning and teaching in art, design and communication · encourage debate about effective practice in relation to e-learning · discuss the models that inform the design and implementation of e-learning activities in art, design and communication · explore innovative formats in online conferencing · provide networking opportunities. The conference themes are: · reflective practice in eLearning · the role of Virtual Learning Environments in Art, Design and Communication · elearning models · innovative uses of technology. In addition to participating in discussions in response to the invited papers, an area of the conference site will be available for delegates to upload papers and lengthier contributions. The Proceedings of the Conference will be published with an ISBN number and distributed to delegates. Robin Shaw Conference and Workshop Organiser ITRDU University of the Arts 65 Davies Street London W1K 5DA r.shaw@arts.ac.uk 0207 514 8052 Conference website: http://www.arts.ac.uk/itrdu/conference ========================================================================Date: Mon, 30 Jan 2006 16:43:40 -0000 Reply-To: Blackboard/Courseinfo userslist Sender: Blackboard/Courseinfo userslist From: Ellen Lessner Subject: Online conference JISC - Innovating e-Learning 2006 MIME-Version: 1.0 Content-Type: text/plain; charset="US-ASCII" Content-Transfer-Encoding: quoted-printable Did you know that there is a similar on-line conference 'Innovating e-Learning 2006: Transforming Learning Experiences' run by JISC (http://www.jisc.ac.uk/index.cfm?name=elp_conference06) from Monday March 27th, 2006, to Friday March 31st, 2006. From the website: Keynote speakers: Diana Laurillard, Professor of Learning with Digital Technologies at the London Knowledge Lab, University of London. John Stone, Principal of Ealing, Hammersmith and West London College (and future Chief Executive, Learning and Skills Network). Professor Stephen Heppell, Learn3K Research Centre, National College of Ireland. with the plenary presentation being given by Chris Yapp, Head of Public Sector Innovation, Microsoft, Reading. The conference is based around the three themes of: Designing for learning Learner experiences with e-learning Innovating e-Learning Practice Each theme will have a keynote presentation, plus up to five associated sessions and presentations. Presentations will take the form of one or more of a paper, PowerPoint presentation with notes and audio, video, etc. Discussions for each session will take place in the asynchronous conferencing environment successfully trialled with the e-Learning and Pedagogy Experts Group meetings. Spoilt for choice! Ellen Lessner ILT Development Coordinator Abingdon and Witney College 01235-216276 -----Original Message----- From: Blackboard/Courseinfo userslist [mailto:BLACKBOARD-USERGROUP@JISCMAIL.AC.UK] On Behalf Of Robin Shaw Sent: 30 January 2006 16:36 To: BLACKBOARD-USERGROUP@JISCMAIL.AC.UK Subject: Online conference Dear all, I am delighted to invite you to take part in the inaugural Designs on eLearning Online conference which will take place from 27 to 31 March 2006. The conference will be international in scope and will focus on the use of technology in learning and teaching in art, design and communication. Please accept my apologies if you get this more than once! You can see full details of the conference at http://www.designsonelearning.net/index.php?section=1&item=2 In the "speakers" link you'll find the biographies of the invited speakers and the abstracts of their contributions. The aim of the conference is to: * provide a forum for the dissemination of innovative and successful uses of technology in learning and teaching in art, design and communication * encourage debate about effective practice in relation to e-learning * discuss the models that inform the design and implementation of e-learning activities in art, design and communication * explore innovative formats in online conferencing * provide networking opportunities. The conference themes are: * reflective practice in eLearning * the role of Virtual Learning Environments in Art, Design and Communication * elearning models * innovative uses of technology. In addition to participating in discussions in response to the invited papers, an area of the conference site will be available for delegates to upload papers and lengthier contributions. The Proceedings of the Conference will be published with an ISBN number and distributed to delegates. Robin Shaw Conference and Workshop Organiser ITRDU University of the Arts 65 Davies Street London W1K 5DA r.shaw@arts.ac.uk 0207 514 8052 Conference website: http://www.arts.ac.uk/itrdu/conference ========================================================================Date: Mon, 30 Jan 2006 16:57:59 -0000 Reply-To: Blackboard/Courseinfo userslist Sender: Blackboard/Courseinfo userslist From: Polly Christie Organization: AHDS Visual Arts Subject: Re: Online conference JISC - Innovating e-Learning 2006 In-Reply-To: <470E38A02B154D4E85FA52BC952D9319BA465E@mail1.COLLEGE.NET> MIME-Version: 1.0 Content-Type: text/plain; charset="us-ascii" Content-Transfer-Encoding: 7bit I believe the Designs on eLearning Online conference is particularly relevant to those in the field of art, design and communication. -----Original Message----- From: Blackboard/Courseinfo userslist [mailto:BLACKBOARD-USERGROUP@JISCMAIL.AC.UK] On Behalf Of Ellen Lessner Sent: 30 January 2006 16:44 To: BLACKBOARD-USERGROUP@JISCMAIL.AC.UK Subject: Online conference JISC - Innovating e-Learning 2006 Did you know that there is a similar on-line conference 'Innovating e-Learning 2006: Transforming Learning Experiences' run by JISC (http://www.jisc.ac.uk/index.cfm?name=elp_conference06) from Monday March 27th, 2006, to Friday March 31st, 2006. From the website: Keynote speakers: Diana Laurillard, Professor of Learning with Digital Technologies at the London Knowledge Lab, University of London. John Stone, Principal of Ealing, Hammersmith and West London College (and future Chief Executive, Learning and Skills Network). Professor Stephen Heppell, Learn3K Research Centre, National College of Ireland. with the plenary presentation being given by Chris Yapp, Head of Public Sector Innovation, Microsoft, Reading. The conference is based around the three themes of: Designing for learning Learner experiences with e-learning Innovating e-Learning Practice Each theme will have a keynote presentation, plus up to five associated sessions and presentations. Presentations will take the form of one or more of a paper, PowerPoint presentation with notes and audio, video, etc. Discussions for each session will take place in the asynchronous conferencing environment successfully trialled with the e-Learning and Pedagogy Experts Group meetings. Spoilt for choice! Ellen Lessner ILT Development Coordinator Abingdon and Witney College 01235-216276 -----Original Message----- From: Blackboard/Courseinfo userslist [mailto:BLACKBOARD-USERGROUP@JISCMAIL.AC.UK] On Behalf Of Robin Shaw Sent: 30 January 2006 16:36 To: BLACKBOARD-USERGROUP@JISCMAIL.AC.UK Subject: Online conference Dear all, I am delighted to invite you to take part in the inaugural Designs on eLearning Online conference which will take place from 27 to 31 March 2006. The conference will be international in scope and will focus on the use of technology in learning and teaching in art, design and communication. Please accept my apologies if you get this more than once! You can see full details of the conference at http://www.designsonelearning.net/index.php?section=1&item=2 In the "speakers" link you'll find the biographies of the invited speakers and the abstracts of their contributions. The aim of the conference is to: * provide a forum for the dissemination of innovative and successful uses of technology in learning and teaching in art, design and communication * encourage debate about effective practice in relation to e-learning * discuss the models that inform the design and implementation of e-learning activities in art, design and communication * explore innovative formats in online conferencing * provide networking opportunities. The conference themes are: * reflective practice in eLearning * the role of Virtual Learning Environments in Art, Design and Communication * elearning models * innovative uses of technology. In addition to participating in discussions in response to the invited papers, an area of the conference site will be available for delegates to upload papers and lengthier contributions. The Proceedings of the Conference will be published with an ISBN number and distributed to delegates. Robin Shaw Conference and Workshop Organiser ITRDU University of the Arts 65 Davies Street London W1K 5DA r.shaw@arts.ac.uk 0207 514 8052 Conference website: http://www.arts.ac.uk/itrdu/conference ========================================================================Date: Tue, 31 Jan 2006 11:00:43 -0000 Reply-To: Blackboard/Courseinfo userslist Sender: Blackboard/Courseinfo userslist From: Najib Maan Subject: Re: VIRTUAL CLASSROOM MIME-Version: 1.0 Content-Type: text/plain; charset="us-ascii" Content-Transfer-Encoding: quoted-printable Hi, I can display the PP presentation in the virtual classroom as suggested but what I really wanted was for other users to see the presentation in real time so that when I present the slide they see the slide show as and when I click from slide to slide (if you know what I mean) BUT this doe not seem to be happening. The other users cannot see me opening the PP slides at all, only I see that. Any suggestions? -----Original Message----- From: Blackboard/Courseinfo userslist [mailto:BLACKBOARD-USERGROUP@JISCMAIL.AC.UK] On Behalf Of Arthur Loughran Sent: 26 January 2006 16:12 To: BLACKBOARD-USERGROUP@JISCMAIL.AC.UK Subject: Re: VIRTUAL CLASSROOM Gerard, I can display PPs directly to the whiteboard from the Course Map without having to execute any of the workrounds suggested. Possibly that is as a result of the version we now have: Blackboard Academic Suite Release 6.3.1.424 cheers, Arthur >>> gerard.elder@CITYSUN.AC.UK 25/01/2006 4:21:20 pm >>> Najib, By choosing Course Map in the classroom window we used to be able to navigate to, and then show, ppt's within the classroom window frame by default. Now, however (we're on 6.2.3.19) when we do this, all ppt's open within a new window. To solve that problem, I open the Virtual Classroom. Choose Course map. Point to the ppt I want to show there. Close down Virtual Classroom and open it again. This forces the presentation to show in the frame. Not very elegant I know, but it works for us! Does that help at all? Regards ....................................................... Gerard Elder VLE Systems Development Officer Blackboard Administrator City of Sunderland College gerard.elder@citysun.ac.uk tel: 0191 5116005 fax: 0191 5116163 ....................................................... -----Original Message----- From: Blackboard/Courseinfo userslist [mailto:BLACKBOARD-USERGROUP@JISCMAIL..AC.UK]On Behalf Of Najib Maan Sent: 25 January 2006 15:36 To: BLACKBOARD-USERGROUP@JISCMAIL.AC.UK Subject: VIRTUAL CLASSROOM Hi, Is there any way to upload a PP presentation into virtual classroom so that the whole class can see it but the virtual session leader has control of the PP slide show. OR is there a plugin we can use? Any assistance welcome Najib Maan Blackboard Administrator e-learning@TVU ext 7832 DISCLAIMER ************************************************************************ ************************************** The information contained in this message may be CONFIDENTIAL and is intended for the addressee only. Any unauthorised use, dissemination of the information, or copying of this message is prohibited. If you are not the addressee, please notify the sender immediately by return e-mail and delete this message. Although this e-mail and any attachments are believed to be free of any virus, or other defect which might affect any computer or system into which they are received and opened, it is the responsibility of the recipient to ensure that they are virus free and no responsibility is accepted by Information Services department of Thames Valley University (or any of its associated subsidiaries) for any loss or damage from receipt or use thereof. Please note that the opinion(s) expressed in this email are that of the sender, and does not necessarily represent that of Thames Valley University (or any of its associated subsidiaries). ************************************************************************ ************************************* Legal disclaimer -------------------------- The information transmitted is the property of the University of Paisley and is intended only for the person or entity to which it is addressed and may contain confidential and/or privileged material. Statements and opinions expressed in this e-mail may not represent those of the company. Any review, retransmission, dissemination and other use of, or taking of any action in reliance upon, this information by persons or entities other than the intended recipient is prohibited. If you received this in error, please contact the sender immediately and delete the material from any computer. -------------------------- ========================================================================Date: Tue, 31 Jan 2006 11:07:18 -0000 Reply-To: Blackboard/Courseinfo userslist Sender: Blackboard/Courseinfo userslist From: Jonathan Blatchford Organization: Bexley College Subject: Re: VIRTUAL CLASSROOM In-Reply-To: <4E9E9056B353854C8AB90B2B664718300C986FB0@exchange1.exchange.tvu.ac.uk> MIME-Version: 1.0 Content-type: text/plain; charset=US-ASCII Content-transfer-encoding: 7BIT Hi Najib, You could create a timed SWF file of the images... or... export the slides as images, upload to a folder on Bb and use the course map to point to the next image each time you want to move slides.... It's the best i have been able to come up with so far! regards Jonathan On 31 Jan 2006 at 11:00, Najib Maan wrote: > Hi, > > I can display the PP presentation in the virtual classroom as suggested > but what I really wanted was for other users to see the presentation in > real time so that when I present the slide they see the slide show as > and when I click from slide to slide (if you know what I mean) BUT this > doe not seem to be happening. The other users cannot see me opening the > PP slides at all, only I see that. > > Any suggestions? > > -----Original Message----- > From: Blackboard/Courseinfo userslist > [mailto:BLACKBOARD-USERGROUP@JISCMAIL.AC.UK] On Behalf Of Arthur > Loughran > Sent: 26 January 2006 16:12 > To: BLACKBOARD-USERGROUP@JISCMAIL.AC.UK > Subject: Re: VIRTUAL CLASSROOM > > Gerard, > I can display PPs directly to the whiteboard from the Course Map without > having to execute any of the workrounds suggested. > > Possibly that is as a result of the version we now have: Blackboard > Academic Suite Release 6.3.1.424 > > cheers, > Arthur > > > >>> gerard.elder@CITYSUN.AC.UK 25/01/2006 4:21:20 pm >>> > Najib, > > By choosing Course Map in the classroom window we used to be able to > navigate to, and then show, ppt's within the classroom window frame by > default. Now, however (we're on 6.2.3.19) when we do this, all ppt's > open within a new window. To solve that problem, I open the Virtual > Classroom. Choose Course map. Point to the ppt I want to show there. > Close down Virtual Classroom and open it again. This forces the > presentation to show in the frame. > > Not very elegant I know, but it works for us! > > Does that help at all? > > Regards > > ....................................................... > Gerard Elder > > VLE Systems Development Officer > Blackboard Administrator > City of Sunderland College > > gerard.elder@citysun.ac.uk > tel: 0191 5116005 > fax: 0191 5116163 > ....................................................... > > -----Original Message----- > From: Blackboard/Courseinfo userslist > [mailto:BLACKBOARD-USERGROUP@JISCMAIL..AC.UK]On Behalf Of Najib Maan > Sent: 25 January 2006 15:36 > To: BLACKBOARD-USERGROUP@JISCMAIL.AC.UK > Subject: VIRTUAL CLASSROOM > > > > Hi, > > Is there any way to upload a PP presentation into virtual classroom so > that the whole class can see it but the virtual session leader has > control of the PP slide show. OR is there a plugin we can use? > > Any assistance welcome > > Najib Maan > > Blackboard Administrator > > e-learning@TVU > > ext 7832 > > DISCLAIMER > ************************************************************************ > ************************************** > > The information contained in this message may be CONFIDENTIAL and is > intended for the addressee only. Any unauthorised use, dissemination of > the information, or copying of this message is prohibited. If you are > not the addressee, please notify the sender immediately by return e-mail > and delete this message. Although this e-mail and any attachments are > believed to be free of any virus, or other defect which might affect any > computer or system into which they are received and opened, it is the > responsibility of the recipient to ensure that they are virus free and > no responsibility is accepted by Information Services department of > Thames Valley University (or any of its associated subsidiaries) for any > loss or damage from receipt or use thereof. Please note that the > opinion(s) expressed in this email are that of the sender, and does not > necessarily represent that of Thames Valley University (or any of its > associated subsidiaries). > > ************************************************************************ > ************************************* > > > > > > > > Legal disclaimer > -------------------------- > > The information transmitted is the property of the University of Paisley > and is intended only for the person or entity > to which it is addressed and may contain confidential and/or privileged > material. Statements and opinions expressed in this > e-mail may not represent those of the company. Any review, > retransmission, dissemination and other use of, or taking > of any action in reliance upon, this information by persons or entities > other than the intended recipient is prohibited. > If you received this in error, please contact the sender immediately and > delete the material from any computer. > > -------------------------- > > ________________________________________________________________ ______ > This email has been scanned for viruses by the Email Protection Agency > For more information please visit http://www.epagency.net > ________________________________________________________________ ______ Jonathan Blatchford Bexley College Blackboard Technical Co-ordinator Learning Facilitator LRC - Staff Room x - 4089 www.bexley.ac.uk ========================================================================Date: Tue, 31 Jan 2006 12:18:57 -0000 Reply-To: Blackboard/Courseinfo userslist Sender: Blackboard/Courseinfo userslist From: Natasha Harden Subject: Content Management System Search Tool MIME-Version: 1.0 Content-Type: text/plain; charset="iso-8859-1" Content-Transfer-Encoding: quoted-printable Hi all I wondered whether you could help me iron out a particular niggle that we are experiencing as part of our deployment of the CMS as a Staff Intranet. One of the requirements for the Intranet was that it was searchable - this is fine as the CMS has a search tool attached which has been utilised. However, one major complaint is that is pulls information from other parts of the CMS (Course content etc) as well as the Institution content, which is understandable, but it would be handy to restrict a search to one particular area (in our case, Institution content) to be used as default. Does anyone know if this is possible? I look forward to receiving you replies. Kind regards Tasha Natasha Harden Acting Web & MLE Manager Peninsula Medical School (01752) 238016 natasha.harden@pms.ac.uk ========================================================================Date: Tue, 31 Jan 2006 16:49:27 -0000 Reply-To: Blackboard/Courseinfo userslist Sender: Blackboard/Courseinfo userslist From: Najib Maan Subject: Re: VIRTUAL CLASSROOM MIME-Version: 1.0 Content-Type: text/plain; charset="us-ascii" Content-Transfer-Encoding: quoted-printable Many thanks for the replies, its just not the same thing though, I was looking at Macromedia Breeze which is truly interactive, audio visual and can open any software within its environment see http://www.macromedia.com/software/breeze/trial/ which is what I am trying to achieve. Any suggestions? We could put a link in Blackboard to Breeze I guess. Najib. -----Original Message----- From: Blackboard/Courseinfo userslist [mailto:BLACKBOARD-USERGROUP@JISCMAIL.AC.UK] On Behalf Of Jonathan Blatchford Sent: 31 January 2006 11:07 To: BLACKBOARD-USERGROUP@JISCMAIL.AC.UK Subject: Re: VIRTUAL CLASSROOM Hi Najib, You could create a timed SWF file of the images... or... export the slides as images, upload to a folder on Bb and use the course map to point to the next image each time you want to move slides.... It's the best i have been able to come up with so far! regards Jonathan On 31 Jan 2006 at 11:00, Najib Maan wrote: > Hi, > > I can display the PP presentation in the virtual classroom as suggested > but what I really wanted was for other users to see the presentation in > real time so that when I present the slide they see the slide show as > and when I click from slide to slide (if you know what I mean) BUT this > doe not seem to be happening. The other users cannot see me opening the > PP slides at all, only I see that. > > Any suggestions? > > -----Original Message----- > From: Blackboard/Courseinfo userslist > [mailto:BLACKBOARD-USERGROUP@JISCMAIL.AC.UK] On Behalf Of Arthur > Loughran > Sent: 26 January 2006 16:12 > To: BLACKBOARD-USERGROUP@JISCMAIL.AC.UK > Subject: Re: VIRTUAL CLASSROOM > > Gerard, > I can display PPs directly to the whiteboard from the Course Map without > having to execute any of the workrounds suggested. > > Possibly that is as a result of the version we now have: Blackboard > Academic Suite Release 6.3.1.424 > > cheers, > Arthur > > > >>> gerard.elder@CITYSUN.AC.UK 25/01/2006 4:21:20 pm >>> > Najib, > > By choosing Course Map in the classroom window we used to be able to > navigate to, and then show, ppt's within the classroom window frame by > default. Now, however (we're on 6.2.3.19) when we do this, all ppt's > open within a new window. To solve that problem, I open the Virtual > Classroom. Choose Course map. Point to the ppt I want to show there. > Close down Virtual Classroom and open it again. This forces the > presentation to show in the frame. > > Not very elegant I know, but it works for us! > > Does that help at all? > > Regards > > ....................................................... > Gerard Elder > > VLE Systems Development Officer > Blackboard Administrator > City of Sunderland College > > gerard.elder@citysun.ac.uk > tel: 0191 5116005 > fax: 0191 5116163 > ....................................................... > > -----Original Message----- > From: Blackboard/Courseinfo userslist > [mailto:BLACKBOARD-USERGROUP@JISCMAIL..AC.UK]On Behalf Of Najib Maan > Sent: 25 January 2006 15:36 > To: BLACKBOARD-USERGROUP@JISCMAIL.AC.UK > Subject: VIRTUAL CLASSROOM > > > > Hi, > > Is there any way to upload a PP presentation into virtual classroom so > that the whole class can see it but the virtual session leader has > control of the PP slide show. OR is there a plugin we can use? > > Any assistance welcome > > Najib Maan > > Blackboard Administrator > > e-learning@TVU > > ext 7832 > > DISCLAIMER > ************************************************************************ > ************************************** > > The information contained in this message may be CONFIDENTIAL and is > intended for the addressee only. Any unauthorised use, dissemination of > the information, or copying of this message is prohibited. If you are > not the addressee, please notify the sender immediately by return e-mail > and delete this message. Although this e-mail and any attachments are > believed to be free of any virus, or other defect which might affect any > computer or system into which they are received and opened, it is the > responsibility of the recipient to ensure that they are virus free and > no responsibility is accepted by Information Services department of > Thames Valley University (or any of its associated subsidiaries) for any > loss or damage from receipt or use thereof. Please note that the > opinion(s) expressed in this email are that of the sender, and does not > necessarily represent that of Thames Valley University (or any of its > associated subsidiaries). > > ************************************************************************ > ************************************* > > > > > > > > Legal disclaimer > -------------------------- > > The information transmitted is the property of the University of Paisley > and is intended only for the person or entity > to which it is addressed and may contain confidential and/or privileged > material. Statements and opinions expressed in this > e-mail may not represent those of the company. Any review, > retransmission, dissemination and other use of, or taking > of any action in reliance upon, this information by persons or entities > other than the intended recipient is prohibited. > If you received this in error, please contact the sender immediately and > delete the material from any computer. > > -------------------------- > > ________________________________________________________________ ______ > This email has been scanned for viruses by the Email Protection Agency > For more information please visit http://www.epagency.net > ________________________________________________________________ ______ Jonathan Blatchford Bexley College Blackboard Technical Co-ordinator Learning Facilitator LRC - Staff Room x - 4089 www.bexley.ac.uk ========================================================================Date: Wed, 1 Feb 2006 18:11:26 -0000 Reply-To: Blackboard/Courseinfo userslist Sender: Blackboard/Courseinfo userslist From: "Harrison, Peter" Subject: CMS - Course Content anyone? MIME-Version: 1.0 Content-Type: multipart/alternative; boundary="----_=_NextPart_001_01C6275A.EE62E8C8" This is a multi-part message in MIME format. ------_=_NextPart_001_01C6275A.EE62E8C8 Content-Type: text/plain; charset="US-ASCII" Content-Transfer-Encoding: quoted-printable Hi All, Firstly is there a more appropriate place to discuss the blackboard CMS or as there have been a few threads on it lately is here as good as anywhere? When we had our CMS installed and the training it was advised to turn off course content mainly because of the orphaning problems. This seemed a bit cart driving the horse but is what we did as we could not see a requirement then. I was wondering what others felt, do you use course content section and if so how? I get a lot of feedback from our students who use groups extensively and because they are often working offsite love the file exchange but are frustrated by it's flat, chronological structure. I thought that "course content" folders with course and group level permissions would be a good way to manage that rather than deeply nested institutional content and lots of specific permissions. Before going too far down that road can I ask have others done this and was it successful? Peter -- Peter Harrison Teaching and Learning Systems - Bldg 62 School of Industrial and Manufacturing Science Cranfield University - Bedford - MK43 0AL Tel: 01234 75 4097 This communication is sent in confidence to the named recipient only. If you are not the named recipient, any use, disclosure or copying of this communication is prohibited. If you have received this communication in error, please notify the sender immediately by telephone or email. The opinions expressed do not necessarily represent the corporate views of Cranfield University. Cranfield University accepts no liability for the content of this email or the consequences of any actions taken on the basis of the information provided. ------_=_NextPart_001_01C6275A.EE62E8C8 Content-Type: text/html; charset="US-ASCII" Content-Transfer-Encoding: quoted-printable
Hi All,
 
Firstly is there a more appropriate place to discuss the blackboard CMS or as there have been a few threads on it lately is here as good as anywhere?
 
When we had our CMS installed and the training it was advised to turn off course content mainly because of the orphaning problems. This seemed a bit cart driving the horse but is what we did as we could not see a requirement then. I was wondering what others felt, do you use course content section and if so how?
 
I get a lot of feedback from our students who use groups extensively and because they are often working offsite love the file exchange but are frustrated by it's flat, chronological structure. I thought that "course content" folders with course and group level permissions would be a good way to manage that rather than deeply nested institutional content and lots of specific permissions. Before going too far down that road can I ask have others done this and was it successful?
 
Peter

--
Peter Harrison
Teaching and Learning Systems - Bldg 62
School of Industrial and Manufacturing Science
Cranfield University - Bedford - MK43 0AL
Tel: 01234 75 4097

This communication is sent in confidence to the named recipient only.  If you are not the named recipient, any use, disclosure or copying of this communication is prohibited.  If you have received this communication in error, please notify the sender immediately by telephone or email.  The opinions expressed do not necessarily represent the corporate views of Cranfield University.  Cranfield University accepts no liability for the content of this email or the consequences of any actions taken on the basis of the information provided.

 
------_=_NextPart_001_01C6275A.EE62E8C8-- ========================================================================Date: Wed, 1 Feb 2006 18:11:45 +0000 Reply-To: Blackboard/Courseinfo userslist Sender: Blackboard/Courseinfo userslist From: Cathy Ellis Subject: Autoreply: CMS - Course Content anyone? Thank you for your email. I am out of college until Monday 6th February and will not be able to respond to emails until then. If your message is urgent, please contact me on 07884071344. Cathy ========================================================================Date: Wed, 1 Feb 2006 19:31:23 +0100 Reply-To: Blackboard/Courseinfo userslist Sender: Blackboard/Courseinfo userslist From: Henk van Rijssen Subject: Re: CMS - Course Content anyone? In-Reply-To: <51D8DD363F91404B8DE8C73D7601869D03822019@ccexchange-2.cns. cranfield.ac.uk> Mime-Version: 1.0 Content-Type: multipart/alternative; boundary="=====================_90924046==.ALT" --=====================_90924046==.ALT Content-Type: text/plain; charset="us-ascii"; format=flowed Hi Peter, there's a CS mailing list hosted at Princeton university. More information you can find here: http://kb.princeton.edu/9277 We've disabled the course content feature in CS as well, indeed because of the poor integration between CS and LS. Once a course has been removed from LS the according folder in CS isn't visible anymore, but all content is still on the server. We have noticed that the same is valid for user content as well: when a user has been removed from the system, the folder isn't visible anymore, but it still remains on the server. Be careful for this when you recycle usernames. Henk van Rijssen ROC Midden Nederland >Hi All, > >Firstly is there a more appropriate place to discuss the blackboard >CMS or as there have been a few threads on it lately is here as good >as anywhere? > >When we had our CMS installed and the training it was advised to >turn off course content mainly because of the orphaning problems. >This seemed a bit cart driving the horse but is what we did as we >could not see a requirement then. I was wondering what others felt, >do you use course content section and if so how? > >I get a lot of feedback from our students who use groups extensively >and because they are often working offsite love the file exchange >but are frustrated by it's flat, chronological structure. I thought >that "course content" folders with course and group level >permissions would be a good way to manage that rather than deeply >nested institutional content and lots of specific permissions. >Before going too far down that road can I ask have others done this >and was it successful? > >Peter > >-- >Peter Harrison >Teaching and Learning Systems - Bldg 62 >School of Industrial and Manufacturing Science >Cranfield University - Bedford - MK43 0AL >Tel: 01234 75 4097 > >This communication is sent in confidence to the named recipient >only. If you are not the named recipient, any use, disclosure or >copying of this communication is prohibited. If you have received >this communication in error, please notify the sender immediately by >telephone or email. The opinions expressed do not necessarily >represent the corporate views of />"urn:schemas-microsoft-com:office:smarttags" />Cranfield >University. Cranfield University accepts no liability for the >content of this email or the consequences of any actions taken on >the basis of the information provided.= "urn:schemas-microsoft-com:office:office" /> > --=====================_90924046==.ALT Content-Type: text/html; charset="us-ascii" Hi Peter,

there's a CS mailing list hosted at Princeton university.
More information you can find here: http://kb.princeton.edu/9277

We've disabled the course content feature in CS as well, indeed because of the poor integration between CS and LS. Once a course has been removed from LS the according folder in CS isn't visible anymore, but all content is still on the server.
We have noticed that the same is valid for user content as well: when a user has been removed from the system, the folder isn't visible anymore, but it still remains on the server. Be careful for this when you recycle usernames.

Henk van Rijssen
ROC Midden Nederland


Hi All,
 
Firstly is there a more appropriate place to discuss the blackboard CMS or as there have been a few threads on it lately is here as good as anywhere?
 
When we had our CMS installed and the training it was advised to turn off course content mainly because of the orphaning problems. This seemed a bit cart driving the horse but is what we did as we could not see a requirement then. I was wondering what others felt, do you use course content section and if so how?
 
I get a lot of feedback from our students who use groups extensively and because they are often working offsite love the file exchange but are frustrated by it's flat, chronological structure. I thought that "course content" folders with course and group level permissions would be a good way to manage that rather than deeply nested institutional content and lots of specific permissions. Before going too far down that road can I ask have others done this and was it successful?
 
Peter

--
Peter Harrison
Teaching and Learning Systems - Bldg 62
School of Industrial and Manufacturing Science
Cranfield University - Bedford - MK43 0AL
Tel: 01234 75 4097

This communication is sent in confidence to the named recipient only.  If you are not the named recipient, any use, disclosure or copying of this communication is prohibited.  If you have received this communication in error, please notify the sender immediately by telephone or email.  The opinions expressed do not necessarily represent the corporate views of <?XML:NAMESPACE PREFIX = U1 /><?xml:namespace prefix = st1 ns = "urn:schemas-microsoft-com:office:smarttags" />Cranfield University.  Cranfield University accepts no liability for the content of this email or the consequences of any actions taken on the basis of the information provided. <?xml:namespace prefix = o ns "urn:schemas-microsoft-com:office:office" />
 
--=====================_90924046==.ALT-- ========================================================================Date: Wed, 1 Feb 2006 18:39:46 -0000 Reply-To: Blackboard/Courseinfo userslist Sender: Blackboard/Courseinfo userslist From: "Harrison, Peter" Subject: Re: CMS - Course Content anyone? MIME-Version: 1.0 Content-Type: multipart/alternative; boundary="----_=_NextPart_001_01C6275E.E0518190" This is a multi-part message in MIME format. ------_=_NextPart_001_01C6275E.E0518190 Content-Type: text/plain; charset="US-ASCII" Content-Transfer-Encoding: quoted-printable Hi Henk Yes the breaking of links was the reason we were -pragmatically- advised to keep it off. I am getting a large institutional content structure and dread to think what would happen in a traditional uni with hundreds of courses and thousands of users! Wondering if I was missing something. Peter ________________________________ From: Blackboard/Courseinfo userslist [mailto:BLACKBOARD-USERGROUP@JISCMAIL.AC.UK] On Behalf Of Henk van Rijssen Sent: Wednesday, February 01, 2006 6:31 PM To: BLACKBOARD-USERGROUP@JISCMAIL.AC.UK Subject: Re: CMS - Course Content anyone? Hi Peter, there's a CS mailing list hosted at Princeton university. More information you can find here: http://kb.princeton.edu/9277 We've disabled the course content feature in CS as well, indeed because of the poor integration between CS and LS. Once a course has been removed from LS the according folder in CS isn't visible anymore, but all content is still on the server. We have noticed that the same is valid for user content as well: when a user has been removed from the system, the folder isn't visible anymore, but it still remains on the server. Be careful for this when you recycle usernames. Henk van Rijssen ROC Midden Nederland Hi All, Firstly is there a more appropriate place to discuss the blackboard CMS or as there have been a few threads on it lately is here as good as anywhere? When we had our CMS installed and the training it was advised to turn off course content mainly because of the orphaning problems. This seemed a bit cart driving the horse but is what we did as we could not see a requirement then. I was wondering what others felt, do you use course content section and if so how? I get a lot of feedback from our students who use groups extensively and because they are often working offsite love the file exchange but are frustrated by it's flat, chronological structure. I thought that "course content" folders with course and group level permissions would be a good way to manage that rather than deeply nested institutional content and lots of specific permissions. Before going too far down that road can I ask have others done this and was it successful? Peter -- Peter Harrison Teaching and Learning Systems - Bldg 62 School of Industrial and Manufacturing Science Cranfield University - Bedford - MK43 0AL Tel: 01234 75 4097 This communication is sent in confidence to the named recipient only. If you are not the named recipient, any use, disclosure or copying of this communication is prohibited. If you have received this communication in error, please notify the sender immediately by telephone or email. The opinions expressed do not necessarily represent the corporate views of Cranfield University. Cranfield University accepts no liability for the content of this email or the consequences of any actions taken on the basis of the information provided. ------_=_NextPart_001_01C6275E.E0518190 Content-Type: text/html; charset="US-ASCII" Content-Transfer-Encoding: quoted-printable
Hi Henk
 
Yes the breaking of links was the reason we were -pragmatically- advised to keep it off. I am getting a large institutional content structure and dread to think what would happen in a traditional uni with hundreds of courses and thousands of users! Wondering if I was missing something.
 
Peter


From: Blackboard/Courseinfo userslist [mailto:BLACKBOARD-USERGROUP@JISCMAIL.AC.UK] On Behalf Of Henk van Rijssen
Sent: Wednesday, February 01, 2006 6:31 PM
To: BLACKBOARD-USERGROUP@JISCMAIL.AC.UK
Subject: Re: CMS - Course Content anyone?

Hi Peter,

there's a CS mailing list hosted at Princeton university.
More information you can find here: http://kb.princeton.edu/9277

We've disabled the course content feature in CS as well, indeed because of the poor integration between CS and LS. Once a course has been removed from LS the according folder in CS isn't visible anymore, but all content is still on the server.
We have noticed that the same is valid for user content as well: when a user has been removed from the system, the folder isn't visible anymore, but it still remains on the server. Be careful for this when you recycle usernames.

Henk van Rijssen
ROC Midden Nederland


Hi All,
 
Firstly is there a more appropriate place to discuss the blackboard CMS or as there have been a few threads on it lately is here as good as anywhere?
 
When we had our CMS installed and the training it was advised to turn off course content mainly because of the orphaning problems. This seemed a bit cart driving the horse but is what we did as we could not see a requirement then. I was wondering what others felt, do you use course content section and if so how?
 
I get a lot of feedback from our students who use groups extensively and because they are often working offsite love the file exchange but are frustrated by it's flat, chronological structure. I thought that "course content" folders with course and group level permissions would be a good way to manage that rather than deeply nested institutional content and lots of specific permissions. Before going too far down that road can I ask have others done this and was it successful?
 
Peter

--
Peter Harrison
Teaching and Learning Systems - Bldg 62
School of Industrial and Manufacturing Science
Cranfield University - Bedford - MK43 0AL
Tel: 01234 75 4097

This communication is sent in confidence to the named recipient only.  If you are not the named recipient, any use, disclosure or copying of this communication is prohibited.  If you have received this communication in error, please notify the sender immediately by telephone or email.  The opinions expressed do not necessarily represent the corporate views of <?XML:NAMESPACE PREFIX = U1 /><?xml:namespace prefix = st1 ns = "urn:schemas-microsoft-com:office:smarttags" />Cranfield University.  Cranfield University accepts no liability for the content of this email or the consequences of any actions taken on the basis of the information provided. <?xml:namespace prefix = o ns = "urn:schemas-microsoft-com:office:office" />
 
------_=_NextPart_001_01C6275E.E0518190-- ========================================================================Date: Wed, 1 Feb 2006 20:04:08 +0100 Reply-To: Blackboard/Courseinfo userslist Sender: Blackboard/Courseinfo userslist From: Henk van Rijssen Subject: Re: CMS - Course Content anyone? In-Reply-To: <51D8DD363F91404B8DE8C73D7601869D03822024@ccexchange-2.cns. cranfield.ac.uk> Mime-Version: 1.0 Content-Type: multipart/alternative; boundary="=====================_92889546==.ALT" --=====================_92889546==.ALT Content-Type: text/plain; charset="us-ascii"; format=flowed Hi Peter, be aware that creating much folders and subfolders in the institution content folder will make the whole tree appear very slowly. It might take almost a minute before the whole instution content folder tree will be visisble. Working with institution roles in order to show/hide specific folders might improve that. At this moment we have almost 1500 users using CS, but mainly for Portfolio. Also the webfolder is very popular. Some departments use their own (department)institution content folder to store and share all kind of files. They manage the right on these (sub)folders themselves. For students we haven't done something similar yet. Henk At 19:39 1-2-2006, you wrote: >Hi Henk > >Yes the breaking of links was the reason we were -pragmatically- >advised to keep it off. I am getting a large institutional content >structure and dread to think what would happen in a traditional uni >with hundreds of courses and thousands of users! Wondering if I was >missing something. > >Peter > > >---------- >From: Blackboard/Courseinfo userslist >[mailto:BLACKBOARD-USERGROUP@JISCMAIL.AC.UK] On Behalf Of Henk van Rijssen >Sent: Wednesday, February 01, 2006 6:31 PM >To: BLACKBOARD-USERGROUP@JISCMAIL.AC.UK >Subject: Re: CMS - Course Content anyone? > >Hi Peter, > >there's a CS mailing list hosted at Princeton university. >More information you can find here: http://kb.princeton.edu/9277 > >We've disabled the course content feature in CS as well, indeed >because of the poor integration between CS and LS. Once a course has >been removed from LS the according folder in CS isn't visible >anymore, but all content is still on the server. >We have noticed that the same is valid for user content as well: >when a user has been removed from the system, the folder isn't >visible anymore, but it still remains on the server. Be careful for >this when you recycle usernames. > >Henk van Rijssen >ROC Midden Nederland > > >>Hi All, >> >>Firstly is there a more appropriate place to discuss the blackboard >>CMS or as there have been a few threads on it lately is here as >>good as anywhere? >> >>When we had our CMS installed and the training it was advised to >>turn off course content mainly because of the orphaning problems. >>This seemed a bit cart driving the horse but is what we did as we >>could not see a requirement then. I was wondering what others felt, >>do you use course content section and if so how? >> >>I get a lot of feedback from our students who use groups >>extensively and because they are often working offsite love the >>file exchange but are frustrated by it's flat, chronological >>structure. I thought that "course content" folders with course and >>group level permissions would be a good way to manage that rather >>than deeply nested institutional content and lots of specific >>permissions. Before going too far down that road can I ask have >>others done this and was it successful? >> >>Peter >> >>-- >>Peter Harrison >>Teaching and Learning Systems - Bldg 62 >>School of Industrial and Manufacturing Science >>Cranfield University - Bedford - MK43 0AL >>Tel: 01234 75 4097 >> >>This communication is sent in confidence to the named recipient >>only. If you are not the named recipient, any use, disclosure or >>copying of this communication is prohibited. If you have received >>this communication in error, please notify the sender immediately >>by telephone or email. The opinions expressed do not necessarily >>represent the corporate views of >/>>"urn:schemas-microsoft-com:office:smarttags" />Cranfield >>University. Cranfield University accepts no liability for the >>content of this email or the consequences of any actions taken on >>the basis of the information provided. >ns = "urn:schemas-microsoft-com:office:office" /> >> --=====================_92889546==.ALT Content-Type: text/html; charset="us-ascii" Hi Peter,

be aware that creating much folders and subfolders in the institution content folder will make the whole tree appear very slowly. It might take almost a minute before the whole instution content folder tree will be visisble.
Working with institution roles in order to show/hide specific folders might improve that.
At this moment we have almost 1500 users using CS, but mainly for Portfolio. Also the webfolder is very popular.
Some departments use their own (department)institution content folder to store and share all kind of files. They manage the right on these (sub)folders themselves. For students we haven't done something similar yet.

Henk


At 19:39 1-2-2006, you wrote:
Hi Henk
 
Yes the breaking of links was the reason we were -pragmatically- advised to keep it off. I am getting a large institutional content structure and dread to think what would happen in a traditional uni with hundreds of courses and thousands of users! Wondering if I was missing something.
 
Peter


From: Blackboard/Courseinfo userslist [ mailto:BLACKBOARD-USERGROUP@JISCMAIL.AC.UK] On Behalf Of Henk van Rijssen
Sent: Wednesday, February 01, 2006 6:31 PM
To: BLACKBOARD-USERGROUP@JISCMAIL.AC.UK
Subject: Re: CMS - Course Content anyone?

Hi Peter,

there's a CS mailing list hosted at Princeton university.
More information you can find here: http://kb.princeton.edu/9277

We've disabled the course content feature in CS as well, indeed because of the poor integration between CS and LS. Once a course has been removed from LS the according folder in CS isn't visible anymore, but all content is still on the server.
We have noticed that the same is valid for user content as well: when a user has been removed from the system, the folder isn't visible anymore, but it still remains on the server. Be careful for this when you recycle usernames.

Henk van Rijssen
ROC Midden Nederland


Hi All,
 
Firstly is there a more appropriate place to discuss the blackboard CMS or as there have been a few threads on it lately is here as good as anywhere?
 
When we had our CMS installed and the training it was advised to turn off course content mainly because of the orphaning problems. This seemed a bit cart driving the horse but is what we did as we could not see a requirement then. I was wondering what others felt, do you use course content section and if so how?
 
I get a lot of feedback from our students who use groups extensively and because they are often working offsite love the file exchange but are frustrated by it's flat, chronological structure. I thought that "course content" folders with course and group level permissions would be a good way to manage that rather than deeply nested institutional content and lots of specific permissions. Before going too far down that road can I ask have others done this and was it successful?
 
Peter

--
Peter Harrison
Teaching and Learning Systems - Bldg 62
School of Industrial and Manufacturing Science
Cranfield University - Bedford - MK43 0AL
Tel: 01234 75 4097

This communication is sent in confidence to the named recipient only.  If you are not the named recipient, any use, disclosure or copying of this communication is prohibited.  If you have received this communication in error, please notify the sender immediately by telephone or email.  The opinions expressed do not necessarily represent the corporate views of <?XML:NAMESPACE PREFIX = U1 /><?xml:namespace prefix = st1 ns = "urn:schemas-microsoft-com:office:smarttags" />Cranfield University.  Cranfield University accepts no liability for the content of this email or the consequences of any actions taken on the basis of the information provided. <?xml:namespace prefix = o ns "urn:schemas-microsoft-com:office:office" />
 
--=====================_92889546==.ALT-- ========================================================================Date: Thu, 2 Feb 2006 09:36:56 -0000 Reply-To: Blackboard/Courseinfo userslist Sender: Blackboard/Courseinfo userslist From: Najib Maan Subject: Re: CMS - Course Content anyone? MIME-Version: 1.0 Content-Type: multipart/alternative; boundary="----_=_NextPart_001_01C627DC.3537E302" This is a multi-part message in MIME format. ------_=_NextPart_001_01C627DC.3537E302 Content-Type: text/plain; charset="us-ascii" Content-Transfer-Encoding: quoted-printable This is a bit worrying, is this the case even after all the upgrade, app pack and service packs have been applied? I did read that the slow loading of CMS was a known problem and was apparently resolved with app pack 3 Najib. -----Original Message----- From: Blackboard/Courseinfo userslist [mailto:BLACKBOARD-USERGROUP@JISCMAIL.AC.UK] On Behalf Of Henk van Rijssen Sent: 01 February 2006 19:04 To: BLACKBOARD-USERGROUP@JISCMAIL.AC.UK Subject: Re: CMS - Course Content anyone? Hi Peter, be aware that creating much folders and subfolders in the institution content folder will make the whole tree appear very slowly. It might take almost a minute before the whole instution content folder tree will be visisble. Working with institution roles in order to show/hide specific folders might improve that. At this moment we have almost 1500 users using CS, but mainly for Portfolio. Also the webfolder is very popular. Some departments use their own (department)institution content folder to store and share all kind of files. They manage the right on these (sub)folders themselves. For students we haven't done something similar yet. Henk At 19:39 1-2-2006, you wrote: Hi Henk Yes the breaking of links was the reason we were -pragmatically- advised to keep it off. I am getting a large institutional content structure and dread to think what would happen in a traditional uni with hundreds of courses and thousands of users! Wondering if I was missing something. Peter _____ From: Blackboard/Courseinfo userslist [ mailto:BLACKBOARD-USERGROUP@JISCMAIL.AC.UK ] On Behalf Of Henk van Rijssen Sent: Wednesday, February 01, 2006 6:31 PM To: BLACKBOARD-USERGROUP@JISCMAIL.AC.UK Subject: Re: CMS - Course Content anyone? Hi Peter, there's a CS mailing list hosted at Princeton university. More information you can find here: http://kb.princeton.edu/9277 We've disabled the course content feature in CS as well, indeed because of the poor integration between CS and LS. Once a course has been removed from LS the according folder in CS isn't visible anymore, but all content is still on the server. We have noticed that the same is valid for user content as well: when a user has been removed from the system, the folder isn't visible anymore, but it still remains on the server. Be careful for this when you recycle usernames. Henk van Rijssen ROC Midden Nederland Hi All, Firstly is there a more appropriate place to discuss the blackboard CMS or as there have been a few threads on it lately is here as good as anywhere? When we had our CMS installed and the training it was advised to turn off course content mainly because of the orphaning problems. This seemed a bit cart driving the horse but is what we did as we could not see a requirement then. I was wondering what others felt, do you use course content section and if so how? I get a lot of feedback from our students who use groups extensively and because they are often working offsite love the file exchange but are frustrated by it's flat, chronological structure. I thought that "course content" folders with course and group level permissions would be a good way to manage that rather than deeply nested institutional content and lots of specific permissions. Before going too far down that road can I ask have others done this and was it successful? Peter -- Peter Harrison Teaching and Learning Systems - Bldg 62 School of Industrial and Manufacturing Science Cranfield University - Bedford - MK43 0AL Tel: 01234 75 4097 This communication is sent in confidence to the named recipient only. If you are not the named recipient, any use, disclosure or copying of this communication is prohibited. If you have received this communication in error, please notify the sender immediately by telephone or email. The opinions expressed do not necessarily represent the corporate views of Cranfield University. Cranfield University accepts no liability for the content of this email or the consequences of any actions taken on the basis of the information provided. ------_=_NextPart_001_01C627DC.3537E302 Content-Type: text/html; charset="us-ascii" Content-Transfer-Encoding: quoted-printable

This is a bit worrying, is this the case even after all the upgrade, app pack and service packs have been applied? I did read that the slow loading of CMS was a known problem and was apparently resolved with app pack 3

 

Najib.

 

-----Original Message-----
From: Blackboard/Courseinfo userslist [mailto:BLACKBOARD-USERGROUP@JISCMAIL.AC.UK] On Behalf Of Henk van Rijssen
Sent: 01 February 2006 19:04
To: BLACKBOARD-USERGROUP@JISCMAIL.AC.UK
Subject: Re: CMS - Course Content anyone?

 

Hi Peter,

be aware that creating much folders and subfolders in the institution content folder will make the whole tree appear very slowly. It might take almost a minute before the whole instution content folder tree will be visisble.
Working with institution roles in order to show/hide specific folders might improve that.
At this moment we have almost 1500 users using CS, but mainly for Portfolio. Also the webfolder is very popular.
Some departments use their own (department)institution content folder to store and share all kind of files. They manage the right on these (sub)folders themselves. For students we haven't done something similar yet.

Henk


At 19:39 1-2-2006, you wrote:

Hi Henk
 
Yes the breaking of links was the reason we were -pragmatically- advised to keep it off. I am getting a large institutional content structure and dread to think what would happen in a traditional uni with hundreds of courses and thousands of users! Wondering if I was missing something.
 
Peter


From: Blackboard/Courseinfo userslist [ mailto:BLACKBOARD-USERGROUP@JISCMAIL.AC.UK] On Behalf Of Henk van Rijssen
Sent: Wednesday, February 01, 2006 6:31 PM
To: BLACKBOARD-USERGROUP@JISCMAIL.AC.UK
Subject: Re: CMS - Course Content anyone?

Hi Peter,

there's a CS mailing list hosted at Princeton university.
More information you can find here: http://kb.princeton.edu/9277

We've disabled the course content feature in CS as well, indeed because of the poor integration between CS and LS. Once a course has been removed from LS the according folder in CS isn't visible anymore, but all content is still on the server.
We have noticed that the same is valid for user content as well: when a user has been removed from the system, the folder isn't visible anymore, but it still remains on the server. Be careful for this when you recycle usernames.

Henk van Rijssen
ROC Midden Nederland



Hi All,
 
Firstly is there a more appropriate place to discuss the blackboard CMS or as there have been a few threads on it lately is here as good as anywhere?
 
When we had our CMS installed and the training it was advised to turn off course content mainly because of the orphaning problems. This seemed a bit cart driving the horse but is what we did as we could not see a requirement then. I was wondering what others felt, do you use course content section and if so how?
 
I get a lot of feedback from our students who use groups extensively and because they are often working offsite love the file exchange but are frustrated by it's flat, chronological structure. I thought that "course content" folders with course and group level permissions would be a good way to manage that rather than deeply nested institutional content and lots of specific permissions. Before going too far down that road can I ask have others done this and was it successful?
 
Peter

--
Peter Harrison
Teaching and Learning Systems - Bldg 62
School of Industrial and Manufacturing Science
Cranfield University - Bedford - MK43 0AL
Tel: 01234 75 4097

This communication is sent in confidence to the named recipient only.  If you are not the named recipient, any use, disclosure or copying of this communication is prohibited.  If you have received this communication in error, please notify the sender immediately by telephone or email.  The opinions expressed do not necessarily represent the corporate views of <?XML:NAMESPACE PREFIX = U1 /><?xml:namespace prefix = st1 ns = "urn:schemas-microsoft-com:office:smarttags" />Cranfield University.  Cranfield University accepts no liability for the content of this email or the consequences of any actions taken on the basis of the information provided. <?xml:namespace prefix = o ns = "urn:schemas-microsoft-com:office:office" />
 

------_=_NextPart_001_01C627DC.3537E302-- ========================================================================Date: Thu, 2 Feb 2006 10:01:18 -0000 Reply-To: Blackboard/Courseinfo userslist Sender: Blackboard/Courseinfo userslist From: "Corcoran, Terry" Subject: Re: CMS - Course Content anyone? MIME-Version: 1.0 Content-Type: multipart/alternative; boundary="----_=_NextPart_001_01C627DF.9CDA9106" This is a multi-part message in MIME format. ------_=_NextPart_001_01C627DF.9CDA9106 Content-Type: text/plain; charset="us-ascii" Content-Transfer-Encoding: quoted-printable Hi Peter - I think it would be useful for not-yet CMS folks like myself to keep the discussion on this list. This will help minimise the risk of us re-inventing the wheel should we ever buy into the CMS. I agree that File Exchange is pretty uninviting & boring with its list format. Perhaps there's a Building Block out there which would make it more interesting & engaging? Of course, you could argue that it's attraction is enhanced by the straightforward interface and minimal functions, but even some icons or (better still perhaps) snippets from posted files would liven it up a little. I'd also like the facility to link posted files directly to messages posted in Group Discussion Board so the user could pop between the two areas more readily. Terry Corcoran Senior Lecturer (ELearning Co-ordinator) School of Nursing, Midwifery & Community Health Glasgow Caledonian University Glasgow G4 0BA "This email is confidential, may be legally privileged, and is for the intended recipient only. Access, disclosure, copying, distribution, or reliance on any of it by anyone outside the intended recipient organisation is prohibited and may be a criminal offence. Please delete if obtained in error and email confirmation to the sender." _____ From: Blackboard/Courseinfo userslist [mailto:BLACKBOARD-USERGROUP@JISCMAIL.AC.UK] On Behalf Of Harrison, Peter Sent: 01 February 2006 18:11 To: BLACKBOARD-USERGROUP@JISCMAIL.AC.UK Subject: CMS - Course Content anyone? Hi All, Firstly is there a more appropriate place to discuss the blackboard CMS or as there have been a few threads on it lately is here as good as anywhere? When we had our CMS installed and the training it was advised to turn off course content mainly because of the orphaning problems. This seemed a bit cart driving the horse but is what we did as we could not see a requirement then. I was wondering what others felt, do you use course content section and if so how? I get a lot of feedback from our students who use groups extensively and because they are often working offsite love the file exchange but are frustrated by it's flat, chronological structure. I thought that "course content" folders with course and group level permissions would be a good way to manage that rather than deeply nested institutional content and lots of specific permissions. Before going too far down that road can I ask have others done this and was it successful? Peter -- Peter Harrison Teaching and Learning Systems - Bldg 62 School of Industrial and Manufacturing Science Cranfield University - Bedford - MK43 0AL Tel: 01234 75 4097 This communication is sent in confidence to the named recipient only. If you are not the named recipient, any use, disclosure or copying of this communication is prohibited. If you have received this communication in error, please notify the sender immediately by telephone or email. The opinions expressed do not necessarily represent the corporate views of Cranfield University. Cranfield University accepts no liability for the content of this email or the consequences of any actions taken on the basis of the information provided. Email has been scanned for viruses by Altman Technologies' email management service ------_=_NextPart_001_01C627DF.9CDA9106 Content-Type: text/html; charset="us-ascii" Content-Transfer-Encoding: quoted-printable

Hi Peter – I think it would be useful for not-yet CMS folks like myself to keep the discussion on this list. This will help minimise the risk of us re-inventing the wheel should we ever buy into the CMS.

 

I agree that File Exchange is pretty uninviting & boring with its list format. Perhaps there’s a Building Block out there which would make it more interesting & engaging?

Of course, you could argue that it’s attraction is enhanced by the straightforward interface and minimal functions, but even some icons or (better still perhaps) snippets from posted files would liven it up a little. I’d also like the facility to link posted files directly to messages posted in Group Discussion Board so the user could pop between the two areas more readily.

 

Terry Corcoran

Senior Lecturer

(ELearning Co-ordinator)

School of Nursing, Midwifery & Community Health

Glasgow Caledonian University

Glasgow G4 0BA

 

“This email is confidential, may be legally privileged, and is for the intended recipient only.  Access, disclosure, copying, distribution, or reliance on any of it by anyone outside the intended recipient organisation is prohibited and may be a criminal offence.  Please delete if obtained in error and email confirmation to the sender.”

 


From: Blackboard/Courseinfo userslist [mailto:BLACKBOARD-USERGROUP@JISCMAIL.AC.UK] On Behalf Of Harrison, Peter
Sent: 01 February 2006 18:11
To: BLACKBOARD-USERGROUP@JISCMAIL.AC.UK
Subject: CMS - Course Content anyone?

 

Hi All,

 

Firstly is there a more appropriate place to discuss the blackboard CMS or as there have been a few threads on it lately is here as good as anywhere?

 

When we had our CMS installed and the training it was advised to turn off course content mainly because of the orphaning problems. This seemed a bit cart driving the horse but is what we did as we could not see a requirement then. I was wondering what others felt, do you use course content section and if so how?

 

I get a lot of feedback from our students who use groups extensively and because they are often working offsite love the file exchange but are frustrated by it's flat, chronological structure. I thought that "course content" folders with course and group level permissions would be a good way to manage that rather than deeply nested institutional content and lots of specific permissions. Before going too far down that road can I ask have others done this and was it successful?

 

Peter

--
Peter Harrison
Teaching and Learning Systems - Bldg 62
School of Industrial and Manufacturing Science
Cranfield University - Bedford - MK43 0AL
Tel: 01234 75 4097

This communication is sent in confidence to the named recipient only.  If you are not the named recipient, any use, disclosure or copying of this communication is prohibited.  If you have received this communication in error, please notify the sender immediately by telephone or email.  The opinions expressed do not necessarily represent the corporate views of Cranfield University.  Cranfield University accepts no liability for the content of this email or the consequences of any actions taken on the basis of the information provided.

 

Email has been scanned for viruses by Altman Technologies' email management service

------_=_NextPart_001_01C627DF.9CDA9106-- ========================================================================Date: Thu, 2 Feb 2006 10:11:54 +0000 Reply-To: Blackboard/Courseinfo userslist Sender: Blackboard/Courseinfo userslist From: Arthur Loughran Subject: Re: CMS - Course Content anyone? Mime-Version: 1.0 Content-Type: text/plain; charset="us-ascii" Content-Transfer-Encoding: quoted-printable Content-Disposition: inline Henk, Possibly I am missing something here but in order to overcome the orphan files effect can we not simply delete the contents of the CS course and personal folder before deleteing courses or people. Can this be automated via a snapshot process? thanks, Arthur Loughran >>>>>>>>>>>>>>>>>>>>>>>>>>>>> Dr. Arthur J. Loughran Senior Lecturer Centre for Learning and Teaching University of Paisley Paisley PA1 2BE tele: +44-(0)141-848-3558 fax: +44-(0)141-848-3822 email: arthur.loughran@paisley.ac.uk >>>>>>>>>>>>>>>>>>>>>>>>>>>>> >>> henkrys@WANADOO.NL 01/02/2006 6:31:23 pm >>> Hi Peter, there's a CS mailing list hosted at Princeton university. More information you can find here: http://kb.princeton.edu/9277 We've disabled the course content feature in CS as well, indeed because of the poor integration between CS and LS. Once a course has been removed from LS the according folder in CS isn't visible anymore, but all content is still on the server. We have noticed that the same is valid for user content as well: when a user has been removed from the system, the folder isn't visible anymore, but it still remains on the server. Be careful for this when you recycle usernames. Henk van Rijssen ROC Midden Nederland >Hi All, > >Firstly is there a more appropriate place to discuss the blackboard >CMS or as there have been a few threads on it lately is here as good >as anywhere? > >When we had our CMS installed and the training it was advised to >turn off course content mainly because of the orphaning problems. >This seemed a bit cart driving the horse but is what we did as we >could not see a requirement then. I was wondering what others felt, >do you use course content section and if so how? > >I get a lot of feedback from our students who use groups extensively >and because they are often working offsite love the file exchange >but are frustrated by it's flat, chronological structure. I thought >that "course content" folders with course and group level >permissions would be a good way to manage that rather than deeply >nested institutional content and lots of specific permissions. >Before going too far down that road can I ask have others done this >and was it successful? > >Peter > >-- >Peter Harrison >Teaching and Learning Systems - Bldg 62 >School of Industrial and Manufacturing Science >Cranfield University - Bedford - MK43 0AL >Tel: 01234 75 4097 > >This communication is sent in confidence to the named recipient >only. If you are not the named recipient, any use, disclosure or >copying of this communication is prohibited. If you have received >this communication in error, please notify the sender immediately by >telephone or email. The opinions expressed do not necessarily >represent the corporate views of />"urn:schemas-microsoft-com:office:smarttags" />Cranfield >University. Cranfield University accepts no liability for the >content of this email or the consequences of any actions taken on >the basis of the information provided.= "urn:schemas-microsoft-com:office:office" /> > Legal disclaimer -------------------------- The information transmitted is the property of the University of Paisley and is intended only for the person or entity to which it is addressed and may contain confidential and/or privileged material. Statements and opinions expressed in this e-mail may not represent those of the company. Any review, retransmission, dissemination and other use of, or taking of any action in reliance upon, this information by persons or entities other than the intended recipient is prohibited. If you received this in error, please contact the sender immediately and delete the material from any computer. -------------------------- ========================================================================Date: Thu, 2 Feb 2006 12:43:51 -0000 Reply-To: Blackboard/Courseinfo userslist Sender: Blackboard/Courseinfo userslist From: "Harrison, Peter" Subject: Re: CMS - Course Content anyone? MIME-Version: 1.0 Content-Type: text/plain; charset="US-ASCII" Content-Transfer-Encoding: quoted-printable Arthur, That would seem to be sensible especially if I could run a report of who/what was linked to the "about to be deleted" content. Caveat: I could easily be totally wrong! I am thinking of content that exists in an instructor's personal area (or Course Content) and is linked into several courses. They leave and in our situation would be disabled after 28 days grace normally. Fine I still have the content but my understanding is that when the user is deleted the content is still there and accessible via the link or searching but I can no longer get to it to move it to a better location. On a practical level for us it should not be an issue other than filespace as currently we keep disabled courses and users for 3 years and in theory a username cannot be reused. But you know how it goes :-( Peter -----Original Message----- Henk, Possibly I am missing something here but in order to overcome the orphan files effect can we not simply delete the contents of the CS course and personal folder before deleteing courses or people. Can this be automated via a snapshot process? thanks, Arthur Loughran >>> henkrys@WANADOO.NL 01/02/2006 6:31:23 pm >>> Hi Peter, there's a CS mailing list hosted at Princeton university. More information you can find here: http://kb.princeton.edu/9277 We've disabled the course content feature in CS as well, indeed because of the poor integration between CS and LS. Once a course has been removed from LS the according folder in CS isn't visible anymore, but all content is still on the server. We have noticed that the same is valid for user content as well: when a user has been removed from the system, the folder isn't visible anymore, but it still remains on the server. Be careful for this when you recycle usernames. Henk van Rijssen ROC Midden Nederland ========================================================================Date: Thu, 2 Feb 2006 16:51:18 +0100 Reply-To: Blackboard/Courseinfo userslist Sender: Blackboard/Courseinfo userslist From: Henk van Rijssen Subject: Re: CMS - Course Content anyone? In-Reply-To: <4E9E9056B353854C8AB90B2B6647183010D6DC54@exchange1.exchange.tvu.ac.uk> MIME-Version: 1.0 Content-Type: text/plain; charset="us-ascii" Content-Transfer-Encoding: 7bit Hi Najib, We're on version 7.0. It's not that CS itself is slow. I've no complaints about that, but when the CS page is opened and you want to see the institution content (and library comntent included) tree in the left frame it takes quite some time before it is shown. I know that in version 7.1 it has been improved. Henk _____ Van: Blackboard/Courseinfo userslist [mailto:BLACKBOARD-USERGROUP@JISCMAIL.AC.UK] Namens Najib Maan Verzonden: donderdag 2 februari 2006 10:37 Aan: BLACKBOARD-USERGROUP@JISCMAIL.AC.UK Onderwerp: Re: CMS - Course Content anyone? This is a bit worrying, is this the case even after all the upgrade, app pack and service packs have been applied? I did read that the slow loading of CMS was a known problem and was apparently resolved with app pack 3 Najib. -----Original Message----- From: Blackboard/Courseinfo userslist [mailto:BLACKBOARD-USERGROUP@JISCMAIL.AC.UK] On Behalf Of Henk van Rijssen Sent: 01 February 2006 19:04 To: BLACKBOARD-USERGROUP@JISCMAIL.AC.UK Subject: Re: CMS - Course Content anyone? Hi Peter, be aware that creating much folders and subfolders in the institution content folder will make the whole tree appear very slowly. It might take almost a minute before the whole instution content folder tree will be visisble. Working with institution roles in order to show/hide specific folders might improve that. At this moment we have almost 1500 users using CS, but mainly for Portfolio. Also the webfolder is very popular. Some departments use their own (department)institution content folder to store and share all kind of files. They manage the right on these (sub)folders themselves. For students we haven't done something similar yet. Henk At 19:39 1-2-2006, you wrote: Hi Henk Yes the breaking of links was the reason we were -pragmatically- advised to keep it off. I am getting a large institutional content structure and dread to think what would happen in a traditional uni with hundreds of courses and thousands of users! Wondering if I was missing something. Peter _____ From: Blackboard/Courseinfo userslist [ mailto:BLACKBOARD-USERGROUP@JISCMAIL.AC.UK] On Behalf Of Henk van Rijssen Sent: Wednesday, February 01, 2006 6:31 PM To: BLACKBOARD-USERGROUP@JISCMAIL.AC.UK Subject: Re: CMS - Course Content anyone? Hi Peter, there's a CS mailing list hosted at Princeton university. More information you can find here: http://kb.princeton.edu/9277 We've disabled the course content feature in CS as well, indeed because of the poor integration between CS and LS. Once a course has been removed from LS the according folder in CS isn't visible anymore, but all content is still on the server. We have noticed that the same is valid for user content as well: when a user has been removed from the system, the folder isn't visible anymore, but it still remains on the server. Be careful for this when you recycle usernames. Henk van Rijssen ROC Midden Nederland Hi All, Firstly is there a more appropriate place to discuss the blackboard CMS or as there have been a few threads on it lately is here as good as anywhere? When we had our CMS installed and the training it was advised to turn off course content mainly because of the orphaning problems. This seemed a bit cart driving the horse but is what we did as we could not see a requirement then. I was wondering what others felt, do you use course content section and if so how? I get a lot of feedback from our students who use groups extensively and because they are often working offsite love the file exchange but are frustrated by it's flat, chronological structure. I thought that "course content" folders with course and group level permissions would be a good way to manage that rather than deeply nested institutional content and lots of specific permissions. Before going too far down that road can I ask have others done this and was it successful? Peter -- Peter Harrison Teaching and Learning Systems - Bldg 62 School of Industrial and Manufacturing Science Cranfield University - Bedford - MK43 0AL Tel: 01234 75 4097 This communication is sent in confidence to the named recipient only. If you are not the named recipient, any use, disclosure or copying of this communication is prohibited. If you have received this communication in error, please notify the sender immediately by telephone or email. The opinions expressed do not necessarily represent the corporate views of Cranfield University. Cranfield University accepts no liability for the content of this email or the consequences of any actions taken on the basis of the information provided. ========================================================================Date: Thu, 2 Feb 2006 19:30:17 +0100 Reply-To: Blackboard/Courseinfo userslist Sender: Blackboard/Courseinfo userslist From: Henk van Rijssen Subject: Fwd: Re: CMS - Course Content anyone? Mime-Version: 1.0 Content-Type: text/plain; charset="us-ascii"; format=flowed >Hi Athur, > >sure that's possible (although I don't know if you can do it with >snapshot, we still don't use snapshot). >But the question is who should do that? You can delete users using >f.i. a batch file, but these folders should be removed one by one >and, since they're not directly related to the username on filelevel >on the server, also in the CS user interface. For as far as I know >only a system admin is able to see and delete all userfolders, so >he/she should do the job? >In our situation I can imagine that it could be done that way, >because user management (creation of useraccount) is done centrally >by the system admin as well. >For courses it might be a different thing. There we have course >admins with the rights to create and delete courses, but do they (or >should they) have the right to delete course folders in CS as well? > >When it should be possible to do the job with snapshot it would be >wonderful and we would start using is asap. > >Henk > > >Question At 11:11 2-2-2006, you wrote: >>Henk, >>Possibly I am missing something here but in order to overcome the >>orphan files effect can we not simply delete the contents of the CS >>course and personal folder before deleteing courses or people. >> >>Can this be automated via a snapshot process? >> >>thanks, >>Arthur Loughran >> >> >> >> >> >>>>>>>>>>>>>>>>>>>>>>>>>>>>> >>Dr. Arthur J. Loughran >>Senior Lecturer >>Centre for Learning and Teaching >>University of Paisley >>Paisley PA1 2BE >>tele: +44-(0)141-848-3558 >>fax: +44-(0)141-848-3822 >>email: arthur.loughran@paisley.ac.uk >> >>>>>>>>>>>>>>>>>>>>>>>>>>>>> >> >> >>> henkrys@WANADOO.NL 01/02/2006 6:31:23 pm >>> >>Hi Peter, >> >>there's a CS mailing list hosted at Princeton university. >>More information you can find here: http://kb.princeton.edu/9277 >> >>We've disabled the course content feature in CS as well, indeed >>because of the poor integration between CS and LS. Once a course has >>been removed from LS the according folder in CS isn't visible >>anymore, but all content is still on the server. >>We have noticed that the same is valid for user content as well: when >>a user has been removed from the system, the folder isn't visible >>anymore, but it still remains on the server. Be careful for this when >>you recycle usernames. >> >>Henk van Rijssen >>ROC Midden Nederland >> >> >> >Hi All, >> > >> >Firstly is there a more appropriate place to discuss the blackboard >> >CMS or as there have been a few threads on it lately is here as good >> >as anywhere? >> > >> >When we had our CMS installed and the training it was advised to >> >turn off course content mainly because of the orphaning problems. >> >This seemed a bit cart driving the horse but is what we did as we >> >could not see a requirement then. I was wondering what others felt, >> >do you use course content section and if so how? >> > >> >I get a lot of feedback from our students who use groups extensively >> >and because they are often working offsite love the file exchange >> >but are frustrated by it's flat, chronological structure. I thought >> >that "course content" folders with course and group level >> >permissions would be a good way to manage that rather than deeply >> >nested institutional content and lots of specific permissions. >> >Before going too far down that road can I ask have others done this >> >and was it successful? >> > >> >Peter >> > >> >-- >> >Peter Harrison >> >Teaching and Learning Systems - Bldg 62 >> >School of Industrial and Manufacturing Science >> >Cranfield University - Bedford - MK43 0AL >> >Tel: 01234 75 4097 >> > >> >This communication is sent in confidence to the named recipient >> >only. If you are not the named recipient, any use, disclosure or >> >copying of this communication is prohibited. If you have received >> >this communication in error, please notify the sender immediately by >> >telephone or email. The opinions expressed do not necessarily >> >represent the corporate views of > >/>> >"urn:schemas-microsoft-com:office:smarttags" />Cranfield >> >University. Cranfield University accepts no liability for the >> >content of this email or the consequences of any actions taken on >> >the basis of the information provided.> >= "urn:schemas-microsoft-com:office:office" /> >> > >> >> >> >>Legal disclaimer >>-------------------------- >> >>The information transmitted is the property of the University of >>Paisley and is intended only for the person or entity >>to which it is addressed and may contain confidential and/or >>privileged material. Statements and opinions expressed in this >>e-mail may not represent those of the company. Any review, >>retransmission, dissemination and other use of, or taking >>of any action in reliance upon, this information by persons or >>entities other than the intended recipient is prohibited. >>If you received this in error, please contact the sender >>immediately and delete the material from any computer. >> >>-------------------------- ========================================================================Date: Thu, 2 Feb 2006 22:23:02 +0000 Reply-To: Blackboard/Courseinfo userslist Sender: Blackboard/Courseinfo userslist From: Arthur Loughran Subject: Re: Fwd: Re: CMS - Course Content anyone? Mime-Version: 1.0 Content-Type: text/plain; charset="us-ascii" Content-Transfer-Encoding: quoted-printable Content-Disposition: inline Henk, Thanks for your message. We have a central admin team who control all of our Bb admin processes. However if we stay with a certain amount of manual admin it is possible that we could nominate course admins in Schools in order to distribute some the admin tasks. In that case your comment highlights the problems to which this could give rise. However if we go with a Snapshot process all of this will be done centrally. It strike me though that Bb should consider publishing a list of admin scenarios that would collate the potential problems that have been identified in this thread. regards, Arthur >>> h.vanrijssen@ROCMN.NL 02/02/06 18:59 PM >>> >Hi Athur, > >sure that's possible (although I don't know if you can do it with >snapshot, we still don't use snapshot). >But the question is who should do that? You can delete users using >f.i. a batch file, but these folders should be removed one by one >and, since they're not directly related to the username on filelevel >on the server, also in the CS user interface. For as far as I know >only a system admin is able to see and delete all userfolders, so >he/she should do the job? >In our situation I can imagine that it could be done that way, >because user management (creation of useraccount) is done centrally >by the system admin as well. >For courses it might be a different thing. There we have course >admins with the rights to create and delete courses, but do they (or >should they) have the right to delete course folders in CS as well? > >When it should be possible to do the job with snapshot it would be >wonderful and we would start using is asap. > >Henk > > >Question At 11:11 2-2-2006, you wrote: >>Henk, >>Possibly I am missing something here but in order to overcome the >>orphan files effect can we not simply delete the contents of the CS >>course and personal folder before deleteing courses or people. >> >>Can this be automated via a snapshot process? >> >>thanks, >>Arthur Loughran >> >> >> >> >> >>>>>>>>>>>>>>>>>>>>>>>>>>>>> >>Dr. Arthur J. Loughran >>Senior Lecturer >>Centre for Learning and Teaching >>University of Paisley >>Paisley PA1 2BE >>tele: +44-(0)141-848-3558 >>fax: +44-(0)141-848-3822 >>email: arthur.loughran@paisley.ac.uk >> >>>>>>>>>>>>>>>>>>>>>>>>>>>>> >> >> >>> henkrys@WANADOO.NL 01/02/2006 6:31:23 pm >>> >>Hi Peter, >> >>there's a CS mailing list hosted at Princeton university. >>More information you can find here: http://kb.princeton.edu/9277 >> >>We've disabled the course content feature in CS as well, indeed >>because of the poor integration between CS and LS. Once a course has >>been removed from LS the according folder in CS isn't visible >>anymore, but all content is still on the server. >>We have noticed that the same is valid for user content as well: when >>a user has been removed from the system, the folder isn't visible >>anymore, but it still remains on the server. Be careful for this when >>you recycle usernames. >> >>Henk van Rijssen >>ROC Midden Nederland >> >> >> >Hi All, >> > >> >Firstly is there a more appropriate place to discuss the blackboard >> >CMS or as there have been a few threads on it lately is here as good >> >as anywhere? >> > >> >When we had our CMS installed and the training it was advised to >> >turn off course content mainly because of the orphaning problems. >> >This seemed a bit cart driving the horse but is what we did as we >> >could not see a requirement then. I was wondering what others felt, >> >do you use course content section and if so how? >> > >> >I get a lot of feedback from our students who use groups extensively >> >and because they are often working offsite love the file exchange >> >but are frustrated by it's flat, chronological structure. I thought >> >that "course content" folders with course and group level >> >permissions would be a good way to manage that rather than deeply >> >nested institutional content and lots of specific permissions. >> >Before going too far down that road can I ask have others done this >> >and was it successful? >> > >> >Peter >> > >> >-- >> >Peter Harrison >> >Teaching and Learning Systems - Bldg 62 >> >School of Industrial and Manufacturing Science >> >Cranfield University - Bedford - MK43 0AL >> >Tel: 01234 75 4097 >> > >> >This communication is sent in confidence to the named recipient >> >only. If you are not the named recipient, any use, disclosure or >> >copying of this communication is prohibited. If you have received >> >this communication in error, please notify the sender immediately by >> >telephone or email. The opinions expressed do not necessarily >> >represent the corporate views of > >/>> >"urn:schemas-microsoft-com:office:smarttags" />Cranfield >> >University. Cranfield University accepts no liability for the >> >content of this email or the consequences of any actions taken on >> >the basis of the information provided.> >= "urn:schemas-microsoft-com:office:office" /> >> > >> >> >> >>Legal disclaimer >>-------------------------- >> >>The information transmitted is the property of the University of >>Paisley and is intended only for the person or entity >>to which it is addressed and may contain confidential and/or >>privileged material. Statements and opinions expressed in this >>e-mail may not represent those of the company. Any review, >>retransmission, dissemination and other use of, or taking >>of any action in reliance upon, this information by persons or >>entities other than the intended recipient is prohibited. >>If you received this in error, please contact the sender >>immediately and delete the material from any computer. >> >>-------------------------- Legal disclaimer -------------------------- The information transmitted is the property of the University of Paisley and is intended only for the person or entity to which it is addressed and may contain confidential and/or privileged material. Statements and opinions expressed in this e-mail may not represent those of the company. Any review, retransmission, dissemination and other use of, or taking of any action in reliance upon, this information by persons or entities other than the intended recipient is prohibited. If you received this in error, please contact the sender immediately and delete the material from any computer. -------------------------- ========================================================================Date: Fri, 3 Feb 2006 15:43:19 +0000 Reply-To: Blackboard/Courseinfo userslist Sender: Blackboard/Courseinfo userslist From: Netskills Subject: Netskills e-learning workshops in Northern Ireland Mime-Version: 1.0 Content-Type: text/plain; charset="iso-8859-1" Content-Transfer-Encoding: quoted-printable Dear Colleague, Places are still available on the following Netskills workshops running at LIFHE in Lisburn, Northern Ireland: * For a limited time, these workshops are available for just 80 (standard price is 145) * 1. Design Solutions for e-Learning (21st February) Examines how analysis of traditional teaching and learning methods can be used to guide the design of effective e-learning. 2. Content Solutions for e-Learning (22nd February) Investigates practical solutions for developing, converting and re-using content for e-learning. Further details, together with booking forms are available from: http://www.netskills.ac.uk/workshops/forthcoming.html These workshops support a range of a BTEC-accredited qualifications in e-learning. * Register in February and save up to 15% * http://www.netskills.ac.uk/accreditation/ Regards, Steve Boneham. Netskills, University of Newcastle, Newcastle-upon-Tyne, NE1 7RU. Tel: (0191) 222 5000 Fax: (0191) 222 5001 Web: http://www.netskills.ac.uk/ ========================================================================Date: Fri, 3 Feb 2006 15:46:56 -0000 Reply-To: Blackboard/Courseinfo userslist Sender: Blackboard/Courseinfo userslist From: "MURRAY M.R." Subject: Re: Durham December 2005 Presentations MIME-Version: 1.0 Content-Type: text/plain; charset="us-ascii" Content-Transfer-Encoding: quoted-printable Hi Nicole, The materials are available in the UK & Eire Group from the Event Presentations button. A direct link is here: http://communities.blackboard.com/bbcswebdav/orgs/UK-BbUG/Event%20Presen tations/Durham05 Sorry that you missed the conference, but people liked your talk. Cheers, Malcolm. --- Dr Malcolm Murray Learning Technologies Team Leader IT Service Durham University -----Original Message----- From: Blackboard/Courseinfo userslist [mailto:BLACKBOARD-USERGROUP@JISCMAIL.AC.UK] On Behalf Of Nicole Kipar Sent: Thu 26 January 2006 14:33 To: BLACKBOARD-USERGROUP@JISCMAIL.AC.UK Subject: Re: Durham December 2005 Presentations Hi Malcolm, I only got around to going to the site today and am sorry, but I cannot find anything. I managed to join the group but where are the presentations? Awfully sorry to bother you with the question, but would love to see the presentations, especially since I had to miss the conference. Best wishes Nicole On Wed, 18 Jan 2006 12:00:16 -0000 Malcolm Murray wrote: > Presentations from the Sixth Durham Blackboard Users' Conference are > now available in the UK/EIRE User Group on the Blackboard Communities Site. > http://communities.blackboard.com/ > If you're not a member you will need to enroll in the Community - > which you can do as follows: > Log in to the Blackboard Community Site (you will need to create an > account if you don't already have one. > Click on the USER GROUPS tab > Look for the portal module called 'Join a User Group!' and click on > the International link Enroll in the UK/Eire Blackboard User Group > http://communities.blackboard.com/bin/common/category.pl?type=CLUB&cat > eg > ory_id=_7_1 > > Thanks to everyone for making them available. > > I will also be posting the comments submitted to Blackboard there > shortly! > > Cheers, > > Malcolm :-) > > --- > Dr Malcolm Murray > > Learning Technologies Team Leader > IT Service > Durham University ---------------------- Nicole Kipar n.kipar@canterbury.ac.uk 01227 767700 ext 2019 Learning Technologist for the Faculty of Arts and Humanities and Blackboard Co-ordinator http://www.canterbury.ac.uk/lteu/ Canterbury Christ Church University Learning and Teaching Enhancement Unit (LTEU) ========================================================================Date: Mon, 6 Feb 2006 09:16:05 -0000 Reply-To: Blackboard/Courseinfo userslist Sender: Blackboard/Courseinfo userslist From: "Sam J. Mcfarlane" Subject: Stats problems Comments: cc: Susan Westerman MIME-Version: 1.0 Content-Type: text/plain; charset="US-ASCII" Content-Transfer-Encoding: quoted-printable Hello all, In relation to a previous post I made about zero hits being displayed on content areas within courses in blackboard, we have been told it is because the amount of days we keep stats for is too long. How do you all deal with stats management within your system and how long do you keep the stats for? We are currently using blackboard version 6.3. Regards Sam McFarlane Learning Technology Support Officer Canterbury Christ Church University Email: s.j.mcfarlane@canterbury.ac.uk ========================================================================Date: Mon, 6 Feb 2006 12:52:18 -0000 Reply-To: Blackboard/Courseinfo userslist Sender: Blackboard/Courseinfo userslist From: John Edmonstone Subject: Re: Stats problems MIME-Version: 1.0 Content-Type: text/plain; charset="US-ASCII" Content-Transfer-Encoding: quoted-printable That conflicts with what we were told Sam, we were told it was a known bug and that it was to be fixed in the next service pack. John Edmonstone E-Learning Development Officer Cardonald College ph: 0141-272-3234 -----Original Message----- From: Blackboard/Courseinfo userslist [mailto:BLACKBOARD-USERGROUP@JISCMAIL.AC.UK] On Behalf Of Sam J. Mcfarlane Sent: 06 February 2006 09:16 To: BLACKBOARD-USERGROUP@JISCMAIL.AC.UK Subject: Stats problems Hello all, In relation to a previous post I made about zero hits being displayed on content areas within courses in blackboard, we have been told it is because the amount of days we keep stats for is too long. How do you all deal with stats management within your system and how long do you keep the stats for? We are currently using blackboard version 6.3. Regards Sam McFarlane Learning Technology Support Officer Canterbury Christ Church University Email: s.j.mcfarlane@canterbury.ac.uk ========================================================================Date: Tue, 7 Feb 2006 14:37:32 -0000 Reply-To: Blackboard/Courseinfo userslist Sender: Blackboard/Courseinfo userslist From: Najib Maan Subject: English spelling and date format MIME-Version: 1.0 Content-Type: multipart/alternative; boundary="----_=_NextPart_001_01C62BF4.07BC5CFC" This is a multi-part message in MIME format. ------_=_NextPart_001_01C62BF4.07BC5CFC Content-Type: text/plain; charset="us-ascii" Content-Transfer-Encoding: quoted-printable Hi, Is there any way of getting English (UK) date format? Is there any way to change spelling e.g color and enrol etc? Najib Maan Blackboard Administrator e-learning@TVU ext 7832 DISCLAIMER ************************************************************************ ************************************** The information contained in this message may be CONFIDENTIAL and is intended for the addressee only. Any unauthorised use, dissemination of the information, or copying of this message is prohibited. If you are not the addressee, please notify the sender immediately by return e-mail and delete this message. Although this e-mail and any attachments are believed to be free of any virus, or other defect which might affect any computer or system into which they are received and opened, it is the responsibility of the recipient to ensure that they are virus free and no responsibility is accepted by Information Services department of Thames Valley University (or any of its associated subsidiaries) for any loss or damage from receipt or use thereof. Please note that the opinion(s) expressed in this email are that of the sender, and does not necessarily represent that of Thames Valley University (or any of its associated subsidiaries). ************************************************************************ ************************************* ------_=_NextPart_001_01C62BF4.07BC5CFC Content-Type: text/html; charset="us-ascii" Content-Transfer-Encoding: quoted-printable English spelling and date format

Hi,

Is there any way of getting English (UK) date format?

Is there any way to change spelling e.g color and enrol etc?

Najib Maan

Blackboard Administrator

e-learning@TVU

ext 7832

DISCLAIMER
**************************************************************************************************************

The information contained in this message may be CONFIDENTIAL and is intended for the addressee only. Any unauthorised use, dissemination of the information, or copying of this message is prohibited. If you are not the addressee, please notify the sender immediately by return e-mail and delete this message. Although this e-mail and any attachments are believed to be free of any virus, or other defect which might affect any computer or system into which they are received and opened, it is the responsibility of the recipient to ensure that they are virus free and no responsibility is accepted by Information Services department of Thames Valley University (or any of its associated subsidiaries) for any loss or damage from receipt or use thereof. Please note that the opinion(s) expressed in this email are that of the sender, and does not necessarily represent that of Thames Valley University (or any of its associated subsidiaries).

*************************************************************************************************************


------_=_NextPart_001_01C62BF4.07BC5CFC-- ========================================================================Date: Tue, 7 Feb 2006 15:04:14 -0000 Reply-To: Blackboard/Courseinfo userslist Sender: Blackboard/Courseinfo userslist From: Matt Elton Subject: Re: English spelling and date format MIME-Version: 1.0 Content-Type: multipart/alternative; boundary="----=_NextPart_000_0004_01C62BF7.C24EF9F0" This is a multi-part message in MIME format. ------=_NextPart_000_0004_01C62BF7.C24EF9F0 Content-Type: text/plain; charset="iso-8859-1" Content-Transfer-Encoding: quoted-printable English spelling and date formatNajib, I've not looked into this, but it might be possible to add a new English language pack with 7.0 (possibly 6.3 too). There should be a folder somewhere in the blackboard directories containing lots of text files either ending with en_US.txt or in a folder called en_US (fr_FR for French, sp_ES for Spanish, and so on). You might be able to just create a new language pack by duplicating all the en_US files and renaming them to en_UK, then just change the default locale in the System Admin tab or Bb config file. I suspect somebody somewhere has already tried this, so you could try the US lists too. Matt ----- Original Message ----- From: Najib Maan To: BLACKBOARD-USERGROUP@JISCMAIL.AC.UK Sent: Tuesday, February 07, 2006 2:37 PM Subject: English spelling and date format Hi, Is there any way of getting English (UK) date format? Is there any way to change spelling e.g color and enrol etc? Najib Maan Blackboard Administrator e-learning@TVU ext 7832 DISCLAIMER ************************************************************************************************************** The information contained in this message may be CONFIDENTIAL and is intended for the addressee only. Any unauthorised use, dissemination of the information, or copying of this message is prohibited. If you are not the addressee, please notify the sender immediately by return e-mail and delete this message. Although this e-mail and any attachments are believed to be free of any virus, or other defect which might affect any computer or system into which they are received and opened, it is the responsibility of the recipient to ensure that they are virus free and no responsibility is accepted by Information Services department of Thames Valley University (or any of its associated subsidiaries) for any loss or damage from receipt or use thereof. Please note that the opinion(s) expressed in this email are that of the sender, and does not necessarily represent that of Thames Valley University (or any of its associated subsidiaries). ************************************************************************************************************* ------=_NextPart_000_0004_01C62BF7.C24EF9F0 Content-Type: text/html; charset="iso-8859-1" Content-Transfer-Encoding: quoted-printable English spelling and date format
Najib,
 
I've not looked into this, but it might be possible to add a new English language pack with 7.0 (possibly 6.3 too).
 
There should be a folder somewhere in the blackboard directories containing lots of text files either ending with en_US.txt or in a folder called en_US (fr_FR for French, sp_ES for Spanish, and so on). You might be able to just create a new language pack by duplicating all the en_US files and renaming them to en_UK, then just change the default locale in the System Admin tab or Bb config file.
 
I suspect somebody somewhere has already tried this, so you could try the US lists too.
 
 
 
Matt
 
 
 
----- Original Message -----
From: Najib Maan
Sent: Tuesday, February 07, 2006 2:37 PM
Subject: English spelling and date format

Hi,

Is there any way of getting English (UK) date format?

Is there any way to change spelling e.g color and enrol etc?

Najib Maan

Blackboard Administrator

e-learning@TVU

ext 7832

DISCLAIMER
**************************************************************************************************************

The information contained in this message may be CONFIDENTIAL and is intended for the addressee only. Any unauthorised use, dissemination of the information, or copying of this message is prohibited. If you are not the addressee, please notify the sender immediately by return e-mail and delete this message. Although this e-mail and any attachments are believed to be free of any virus, or other defect which might affect any computer or system into which they are received and opened, it is the responsibility of the recipient to ensure that they are virus free and no responsibility is accepted by Information Services department of Thames Valley University (or any of its associated subsidiaries) for any loss or damage from receipt or use thereof. Please note that the opinion(s) expressed in this email are that of the sender, and does not necessarily represent that of Thames Valley University (or any of its associated subsidiaries).

*************************************************************************************************************


------=_NextPart_000_0004_01C62BF7.C24EF9F0-- ========================================================================Date: Tue, 7 Feb 2006 14:56:18 -0000 Reply-To: Blackboard/Courseinfo userslist Sender: Blackboard/Courseinfo userslist From: "MURRAY M.R." Subject: Re: English spelling and date format MIME-Version: 1.0 Content-Type: multipart/alternative; boundary="----_=_NextPart_001_01C62BF6.A677322F" This is a multi-part message in MIME format. ------_=_NextPart_001_01C62BF6.A677322F Content-Type: text/plain; charset="us-ascii" Content-Transfer-Encoding: quoted-printable Hi Najib, You should soon be able to change references to color, etc. in version 7, as the internationalisation facilities become better embedded and also more customisable. These use a Java object called Locale (which Blackboard re-use) to determine what language to display buttons, menus, etc. in. Just now, "English" Blackboard uses the default American one (en_US). In version 7 you have the ability to create your own language pack, which is essentially a list of pairs of terms, "you say 'color' we sat 'colour', etc. I am not sure if Bb plan to release a language pack for the UK locale (en_GB), but if not, it's something we could collaborate on. When you talk about date format, do you mean in the date pickers? This uses some Java, which would have to be recoded to reflect different locales. If this is what you want, I suggest you contact Blackboard to see if it already does this (including support for the UK locale) and if not submit an enhancement request. Cheers, Malcolm. --- Dr Malcolm Murray Learning Technologies Team Leader IT Service Durham University ________________________________ From: Blackboard/Courseinfo userslist [mailto:BLACKBOARD-USERGROUP@JISCMAIL.AC.UK] On Behalf Of Najib Maan Sent: Tue 07 February 2006 14:38 To: BLACKBOARD-USERGROUP@JISCMAIL.AC.UK Subject: English spelling and date format Hi, Is there any way of getting English (UK) date format? Is there any way to change spelling e.g color and enrol etc? Najib Maan Blackboard Administrator e-learning@TVU ext 7832 DISCLAIMER ************************************************************************ ************************************** The information contained in this message may be CONFIDENTIAL and is intended for the addressee only. Any unauthorised use, dissemination of the information, or copying of this message is prohibited. If you are not the addressee, please notify the sender immediately by return e-mail and delete this message. Although this e-mail and any attachments are believed to be free of any virus, or other defect which might affect any computer or system into which they are received and opened, it is the responsibility of the recipient to ensure that they are virus free and no responsibility is accepted by Information Services department of Thames Valley University (or any of its associated subsidiaries) for any loss or damage from receipt or use thereof. Please note that the opinion(s) expressed in this email are that of the sender, and does not necessarily represent that of Thames Valley University (or any of its associated subsidiaries). ************************************************************************ ************************************* ------_=_NextPart_001_01C62BF6.A677322F Content-Type: text/html; charset="us-ascii" Content-Transfer-Encoding: quoted-printable English spelling and date format
Hi Najib,
 
You should soon be able to change references to color, etc. in version 7, as the internationalisation facilities become better embedded and also more customisable.
These use a Java object called Locale (which Blackboard re-use) to determine what language to display buttons, menus, etc. in. Just now, "English" Blackboard uses the default American one (en_US). In version 7 you have the ability to create your own language pack, which is essentially a list of pairs of terms, "you say 'color' we sat 'colour', etc.
 
I am not sure if Bb plan to release a language pack for the UK locale (en_GB), but if not, it's something we could collaborate on.
 
When you talk about date format, do you mean in the date pickers?
This uses some Java, which would have to be recoded to reflect different locales. If this is what you want, I suggest you contact Blackboard to see if it already does this (including support for the UK locale) and if not submit an enhancement request.
 
Cheers,
 
Malcolm.

---
Dr Malcolm Murray

Learning Technologies Team Leader
IT Service
Durham University

 


From: Blackboard/Courseinfo userslist [mailto:BLACKBOARD-USERGROUP@JISCMAIL.AC.UK] On Behalf Of Najib Maan
Sent: Tue 07 February 2006 14:38
To: BLACKBOARD-USERGROUP@JISCMAIL.AC.UK
Subject: English spelling and date format

Hi,

Is there any way of getting English (UK) date format?

Is there any way to change spelling e.g color and enrol etc?

Najib Maan

Blackboard Administrator

e-learning@TVU

ext 7832

DISCLAIMER
**************************************************************************************************************

The information contained in this message may be CONFIDENTIAL and is intended for the addressee only. Any unauthorised use, dissemination of the information, or copying of this message is prohibited. If you are not the addressee, please notify the sender immediately by return e-mail and delete this message. Although this e-mail and any attachments are believed to be free of any virus, or other defect which might affect any computer or system into which they are received and opened, it is the responsibility of the recipient to ensure that they are virus free and no responsibility is accepted by Information Services department of Thames Valley University (or any of its associated subsidiaries) for any loss or damage from receipt or use thereof. Please note that the opinion(s) expressed in this email are that of the sender, and does not necessarily represent that of Thames Valley University (or any of its associated subsidiaries).

*************************************************************************************************************


------_=_NextPart_001_01C62BF6.A677322F-- ========================================================================Date: Tue, 7 Feb 2006 14:58:38 +0000 Reply-To: Blackboard/Courseinfo userslist Sender: Blackboard/Courseinfo userslist From: Evan Dickerson Organization: University of the Arts London Subject: Re: English spelling and date format MIME-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit That's possible in version 7, I understand. Not v6.3... Evan Dickerson eLearning Consultant University of the Arts London > Najib Maan wrote: > > Hi, > > Is there any way of getting English (UK) date format? > > Is there any way to change spelling e.g color and enrol etc? > > Najib Maan > > Blackboard Administrator > > e-learning@TVU > > ext 7832 > > DISCLAIMER > ************************************************************************************************************** > > The information contained in this message may be CONFIDENTIAL and is > intended for the addressee only. Any unauthorised use, dissemination of > the information, or copying of this message is prohibited. If you are not > the addressee, please notify the sender immediately by return e-mail and > delete this message. Although this e-mail and any attachments are > believed to be free of any virus, or other defect which might affect any > computer or system into which they are received and opened, it is the > responsibility of the recipient to ensure that they are virus free and no > responsibility is accepted by Information Services department of Thames > Valley University (or any of its associated subsidiaries) for any loss or > damage from receipt or use thereof. Please note that the opinion(s) > expressed in this email are that of the sender, and does not necessarily > represent that of Thames Valley University (or any of its associated > subsidiaries). > > ************************************************************************************************************* ========================================================================Date: Tue, 7 Feb 2006 15:19:49 -0000 Reply-To: Blackboard/Courseinfo userslist Sender: Blackboard/Courseinfo userslist From: Cathy Colless Organization: University of York Subject: Re: English spelling and date format In-Reply-To: <4E9E9056B353854C8AB90B2B6647183010D6DC87@exchange1.exchange.tvu.ac.uk> MIME-Version: 1.0 Content-Type: multipart/alternative; boundary="----=_NextPart_000_0015_01C62BF9.EFA92A90" This is a multi-part message in MIME format. ------=_NextPart_000_0015_01C62BF9.EFA92A90 Content-Type: text/plain; charset="us-ascii" Content-Transfer-Encoding: quoted-printable Hi Najib, This will not get all of the dates but we have updated: calendar_timestamp (BBI18N.06665) in /usr/local/blackboard/content/locale//messages/DateSettings.properties. That has fixed some. Cathy Colless VLE Application Manager e-Learning Development Team Projects Office Raymond Burton Library University of York York YO10 5DD United Kingdom Email: cc518@york.ac.uk Tel: +44 (0)1904 32 1140 Fax: +44 (0)1904 32 1130 http://www.york.ac.uk/univ/org/vle/ -----Original Message----- From: Blackboard/Courseinfo userslist [mailto:BLACKBOARD-USERGROUP@JISCMAIL.AC.UK] On Behalf Of Najib Maan Sent: 07 February 2006 14:38 To: BLACKBOARD-USERGROUP@JISCMAIL.AC.UK Subject: English spelling and date format Hi, Is there any way of getting English (UK) date format? Is there any way to change spelling e.g color and enrol etc? Najib Maan Blackboard Administrator e-learning@TVU ext 7832 DISCLAIMER **************************************************************************** ********************************** The information contained in this message may be CONFIDENTIAL and is intended for the addressee only. Any unauthorised use, dissemination of the information, or copying of this message is prohibited. If you are not the addressee, please notify the sender immediately by return e-mail and delete this message. Although this e-mail and any attachments are believed to be free of any virus, or other defect which might affect any computer or system into which they are received and opened, it is the responsibility of the recipient to ensure that they are virus free and no responsibility is accepted by Information Services department of Thames Valley University (or any of its associated subsidiaries) for any loss or damage from receipt or use thereof. Please note that the opinion(s) expressed in this email are that of the sender, and does not necessarily represent that of Thames Valley University (or any of its associated subsidiaries). **************************************************************************** ********************************* ------=_NextPart_000_0015_01C62BF9.EFA92A90 Content-Type: text/html; charset="us-ascii" Content-Transfer-Encoding: quoted-printable Message

Hi Najib,

This will not get all of the dates but we have updated:

calendar_timestamp (BBI18N.06665) in /usr/local/blackboard/content/locale/<your locale in use>/messages/DateSettings.properties.

That has fixed some.
 

Cathy Colless
VLE Application Manager
e-Learning Development Team
Projects Office
Raymond Burton Library
University of York
York YO10 5DD
United Kingdom

Email: cc518@york.ac.uk
Tel: +44 (0)1904 32 1140
Fax: +44 (0)1904 32 1130
http://www.york.ac.uk/univ/org/vle/
 

-----Original Message-----
From: Blackboard/Courseinfo userslist [mailto:BLACKBOARD-USERGROUP@JISCMAIL.AC.UK] On Behalf Of Najib Maan
Sent: 07 February 2006 14:38
To: BLACKBOARD-USERGROUP@JISCMAIL.AC.UK
Subject: English spelling and date format

Hi,

Is there any way of getting English (UK) date format?

Is there any way to change spelling e.g color and enrol etc?

Najib Maan

Blackboard Administrator

e-learning@TVU

ext 7832

DISCLAIMER
**************************************************************************************************************

The information contained in this message may be CONFIDENTIAL and is intended for the addressee only. Any unauthorised use, dissemination of the information, or copying of this message is prohibited. If you are not the addressee, please notify the sender immediately by return e-mail and delete this message. Although this e-mail and any attachments are believed to be free of any virus, or other defect which might affect any computer or system into which they are received and opened, it is the responsibility of the recipient to ensure that they are virus free and no responsibility is accepted by Information Services department of Thames Valley University (or any of its associated subsidiaries) for any loss or damage from receipt or use thereof. Please note that the opinion(s) expressed in this email are that of the sender, and does not necessarily represent that of Thames Valley University (or any of its associated subsidiaries).

*************************************************************************************************************


------=_NextPart_000_0015_01C62BF9.EFA92A90-- ========================================================================Date: Tue, 7 Feb 2006 15:48:27 -0000 Reply-To: Blackboard/Courseinfo userslist Sender: Blackboard/Courseinfo userslist From: "Sam J. Mcfarlane" Subject: Re: English spelling and date format MIME-Version: 1.0 Content-Type: multipart/alternative; boundary="----_=_NextPart_001_01C62BFD.EFA981B0" This is a multi-part message in MIME format. ------_=_NextPart_001_01C62BFD.EFA981B0 Content-Type: text/plain; charset="US-ASCII" Content-Transfer-Encoding: quoted-printable Hello all, After a meeting with Blackboard last week, we were told that an English UK language pack is not in the pipeline for the next version. But it is possible to change certain words that blackboard uses to describe objects/functions in version 7. I think the date is also changeable easily in this version. Regards Sam Sam McFarlane Learning Technology Support Officer Canterbury Christ Church University Blackboard Queries: blackboard@canterbury.ac.uk Other Queries: s.j.mcfarlane@canterbury.ac.uk ________________________________ From: Blackboard/Courseinfo userslist [mailto:BLACKBOARD-USERGROUP@JISCMAIL.AC.UK] On Behalf Of Cathy Colless Sent: 07 February 2006 15:20 To: BLACKBOARD-USERGROUP@JISCMAIL.AC.UK Subject: Re: English spelling and date format Hi Najib, This will not get all of the dates but we have updated: calendar_timestamp (BBI18N.06665) in /usr/local/blackboard/content/locale//messages/DateSettings.properties. That has fixed some. Cathy Colless VLE Application Manager e-Learning Development Team Projects Office Raymond Burton Library University of York York YO10 5DD United Kingdom Email: cc518@york.ac.uk Tel: +44 (0)1904 32 1140 Fax: +44 (0)1904 32 1130 http://www.york.ac.uk/univ/org/vle/ -----Original Message----- From: Blackboard/Courseinfo userslist [mailto:BLACKBOARD-USERGROUP@JISCMAIL.AC.UK] On Behalf Of Najib Maan Sent: 07 February 2006 14:38 To: BLACKBOARD-USERGROUP@JISCMAIL.AC.UK Subject: English spelling and date format Hi, Is there any way of getting English (UK) date format? Is there any way to change spelling e.g color and enrol etc? Najib Maan Blackboard Administrator e-learning@TVU ext 7832 DISCLAIMER ************************************************************************ ************************************** The information contained in this message may be CONFIDENTIAL and is intended for the addressee only. Any unauthorised use, dissemination of the information, or copying of this message is prohibited. If you are not the addressee, please notify the sender immediately by return e-mail and delete this message. Although this e-mail and any attachments are believed to be free of any virus, or other defect which might affect any computer or system into which they are received and opened, it is the responsibility of the recipient to ensure that they are virus free and no responsibility is accepted by Information Services department of Thames Valley University (or any of its associated subsidiaries) for any loss or damage from receipt or use thereof. Please note that the opinion(s) expressed in this email are that of the sender, and does not necessarily represent that of Thames Valley University (or any of its associated subsidiaries). ************************************************************************ ************************************* ------_=_NextPart_001_01C62BFD.EFA981B0 Content-Type: text/html; charset="US-ASCII" Content-Transfer-Encoding: quoted-printable Message
Hello all,
 
After a meeting with Blackboard last week, we were told that an English UK language pack is not in the pipeline for the next version.  But it is possible to change certain words that blackboard uses to describe objects/functions in version 7.  I think the date is also changeable easily in this version.
 
Regards
Sam
 

Sam McFarlane
Learning Technology Support Officer
Canterbury Christ Church University
Blackboard Queries: blackboard@canterbury.ac.uk
Other Queries: s.j.mcfarlane@canterbury.ac.uk

 


From: Blackboard/Courseinfo userslist [mailto:BLACKBOARD-USERGROUP@JISCMAIL.AC.UK] On Behalf Of Cathy Colless
Sent: 07 February 2006 15:20
To: BLACKBOARD-USERGROUP@JISCMAIL.AC.UK
Subject: Re: English spelling and date format

Hi Najib,

This will not get all of the dates but we have updated:

calendar_timestamp (BBI18N.06665) in /usr/local/blackboard/content/locale/<your locale in use>/messages/DateSettings.properties.

That has fixed some.
 

Cathy Colless
VLE Application Manager
e-Learning Development Team
Projects Office
Raymond Burton Library
University of York
York YO10 5DD
United Kingdom

Email: cc518@york.ac.uk
Tel: +44 (0)1904 32 1140
Fax: +44 (0)1904 32 1130
http://www.york.ac.uk/univ/org/vle/
 

-----Original Message-----
From: Blackboard/Courseinfo userslist [mailto:BLACKBOARD-USERGROUP@JISCMAIL.AC.UK] On Behalf Of Najib Maan
Sent: 07 February 2006 14:38
To: BLACKBOARD-USERGROUP@JISCMAIL.AC.UK
Subject: English spelling and date format

Hi,

Is there any way of getting English (UK) date format?

Is there any way to change spelling e.g color and enrol etc?

Najib Maan

Blackboard Administrator

e-learning@TVU

ext 7832

DISCLAIMER
**************************************************************************************************************

The information contained in this message may be CONFIDENTIAL and is intended for the addressee only. Any unauthorised use, dissemination of the information, or copying of this message is prohibited. If you are not the addressee, please notify the sender immediately by return e-mail and delete this message. Although this e-mail and any attachments are believed to be free of any virus, or other defect which might affect any computer or system into which they are received and opened, it is the responsibility of the recipient to ensure that they are virus free and no responsibility is accepted by Information Services department of Thames Valley University (or any of its associated subsidiaries) for any loss or damage from receipt or use thereof. Please note that the opinion(s) expressed in this email are that of the sender, and does not necessarily represent that of Thames Valley University (or any of its associated subsidiaries).

*************************************************************************************************************


------_=_NextPart_001_01C62BFD.EFA981B0-- ========================================================================Date: Tue, 7 Feb 2006 15:08:27 +0000 Reply-To: Blackboard/Courseinfo userslist Sender: Blackboard/Courseinfo userslist From: Trish Murray Subject: Flash and Bb Is it possible to use flash movies in Bb modules? If not whats the problem? Cheers, Trish ========================================================================Date: Tue, 7 Feb 2006 16:23:48 +0000 Reply-To: Blackboard/Courseinfo userslist Sender: Blackboard/Courseinfo userslist From: Arthur Loughran Subject: Re: English spelling and date format Mime-Version: 1.0 Content-Type: multipart/mixed; boundary="=_8DAF2B87.5F3E6BA3" --=_8DAF2B87.5F3E6BA3 Content-Type: text/plain; charset="us-ascii" Content-Transfer-Encoding: quoted-printable Content-Disposition: inline Sam, Please find attached a few slides that I have chopped from a Blackboard PP. Note slide 4 which highlights a "Language Pack Editor". Does this address the issue that has been raised on the list? It looks like we can change a lot more than a few words with this tool. regards, Arthur Loughran >>>>>>>>>>>>>>>>>>>>>>>>>>>>> Dr. Arthur J. Loughran Senior Lecturer Centre for Learning and Teaching University of Paisley Paisley PA1 2BE tele: +44-(0)141-848-3558 fax: +44-(0)141-848-3822 email: arthur.loughran@paisley.ac.uk >>>>>>>>>>>>>>>>>>>>>>>>>>>>> >>> s.j.mcfarlane@CANTERBURY.AC.UK 07/02/2006 3:48:27 pm >>> Hello all, After a meeting with Blackboard last week, we were told that an English UK language pack is not in the pipeline for the next version. But it is possible to change certain words that blackboard uses to describe objects/functions in version 7. I think the date is also changeable easily in this version. Regards Sam Sam McFarlane Learning Technology Support Officer Canterbury Christ Church University Blackboard Queries: blackboard@canterbury.ac.uk Other Queries: s.j.mcfarlane@canterbury.ac.uk ________________________________ From: Blackboard/Courseinfo userslist [mailto:BLACKBOARD-USERGROUP@JISCMAIL.AC.UK] On Behalf Of Cathy Colless Sent: 07 February 2006 15:20 To: BLACKBOARD-USERGROUP@JISCMAIL.AC.UK Subject: Re: English spelling and date format Hi Najib, This will not get all of the dates but we have updated: calendar_timestamp (BBI18N.06665) in /usr/local/blackboard/content/locale//messages/DateSettings.properties. That has fixed some. Cathy Colless VLE Application Manager e-Learning Development Team Projects Office Raymond Burton Library University of York York YO10 5DD United Kingdom Email: cc518@york.ac.uk Tel: +44 (0)1904 32 1140 Fax: +44 (0)1904 32 1130 http://www.york.ac.uk/univ/org/vle/ -----Original Message----- From: Blackboard/Courseinfo userslist [mailto:BLACKBOARD-USERGROUP@JISCMAIL.AC.UK] On Behalf Of Najib Maan Sent: 07 February 2006 14:38 To: BLACKBOARD-USERGROUP@JISCMAIL.AC.UK Subject: English spelling and date format Hi, Is there any way of getting English (UK) date format? Is there any way to change spelling e.g color and enrol etc? Najib Maan Blackboard Administrator e-learning@TVU ext 7832 DISCLAIMER ************************************************************************ ************************************** The information contained in this message may be CONFIDENTIAL and is intended for the addressee only. Any unauthorised use, dissemination of the information, or copying of this message is prohibited. If you are not the addressee, please notify the sender immediately by return e-mail and delete this message. Although this e-mail and any attachments are believed to be free of any virus, or other defect which might affect any computer or system into which they are received and opened, it is the responsibility of the recipient to ensure that they are virus free and no responsibility is accepted by Information Services department of Thames Valley University (or any of its associated subsidiaries) for any loss or damage from receipt or use thereof. Please note that the opinion(s) expressed in this email are that of the sender, and does not necessarily represent that of Thames Valley University (or any of its associated subsidiaries). ************************************************************************ ************************************* Legal disclaimer -------------------------- The information transmitted is the property of the University of Paisley and is intended only for the person or entity to which it is addressed and may contain confidential and/or privileged material. Statements and opinions expressed in this e-mail may not represent those of the company. Any review, retransmission, dissemination and other use of, or taking of any action in reliance upon, this information by persons or entities other than the intended recipient is prohibited. If you received this in error, please contact the sender immediately and delete the material from any computer. -------------------------- --=_8DAF2B87.5F3E6BA3 Content-Type: application/vnd.ms-powerpoint; name="v7_Overview.ppt" Content-Transfer-Encoding: base64 Content-Disposition: attachment; filename="v7_Overview.ppt" 0M8R4KGxGuEAAAAAAAAAAAAAAAAAAAAAPgADAP7/CQAGAAAAAAAAAAAAAAAMAAAAogUAAAAAAAAA EAAApAUAAAEAAAD+////AAAAAKsFAACsBQAArQUAAK4FAACvBQAAsAUAALEFAACyBQAAswUAALQF AAC1BQAAowUAAP////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////8A bh7wva8AAJbpnAqzSnv9rA+hRaZWha3/iVBORw0KGgoAAAANSUhEUgAAAZAAAAGQCAYAAACAvzbM AAAABGdBTUEAANbY1E9YMgAAABl0RVh0U29mdHdhcmUAQWRvYmUgSW1hZ2VSZWFkeXHJZTwAAK8+ SURBVHja7L0HfBzXdS5+ZkF0kigECLD3ToqkKInqorpVXCTZkqvsOPFzSeIn+5fk77yXf1yS58Rx YidOebGd2JZsSVYzLdkSVSiRKpREib0XkQQJkARYARYUosybc6fsnTv33rlTdlF0DzXaxezs7O6U +93vO80wTRO0adOmTZu2qJbRh0CbNm3atGkA0aZNmzZtGkC0adOmTZsGEG3atGnTpgFEmzZt2rRp 0wCiTZs2bdo0gGjTpk2bNg0g2rRp06ZNA4g2bdq0adMAok2bNm3atGkA0aZNmzZtGkC0adOmTZsG EG3atGnTpgFEmzZt2rRpANGmTZs2bdo0gGjTpk2bNg0g2rRp06ZNA4g2bdq0adMAok2bNm3aNIBo 06ZNmzZtGkC0adOmTZsGEG3atGnTpgFEmzZt2rRpANGmTZs2bRpAtGnTpk2bNg0g2rRp06ZNA4g2 bdq0adMAok2bNm3aNIBo06ZNmzYNINq0adOmTZsGEG3atGnTpgFEmzZt2rRpANGmTZs2bRpAtGnT pk2bBhBt2rRp06ZNA4g2bdq0adMAok2bNm3aNIBo06ZNmzYNINq0adOmTZsGEG3atGnTpgFEmzZt 2rTl04b19xcwDEOfBW3atA0KM03zAevhs9ay2loqrWWRtXzNGsdWx9zfoD4exqD/ARqAtGnTlh/w +Jb1MKmnp+chazF6e3uN8+fPN9TW1j515syZP6ysrNyIm1Hbm0P9mGgGok2btkFt3/zW3y5y2IDL CNAWOn9DfVnDMvY9ze2TkTE0WMuryCa+/a2/apB9RmtraxUyD2u8mmHhQncmk9liPa8oLi4+tHbt 2k9ccskl37Ne/5i19Dog0mfYg5upGYhmINq0acsvKNBg4AIE2nX4vxFFpyaXDzszGZ9XlTRDUUEn FGU6oNp6TtYV2+tkdq67ElraJ8Ohs3Og8cyszdZY+C/f+c5f/8Id2+lhpru7G0Ho+sLCwu9a23Uc P378fxcVFU0cPnz47cOGDbuks7PzNyUlJXdY23Q7IEKWoc5C+h1ANABo0/a+ZAtoLjOYZC0EDEaV HFlUmLlQWWgN/i4YDC88bS2t5HldWUNOvteF3hLY17YIdp5aevBMZ8V3/uZvvvkLGkTOnTt3Q0FB wfWlpaX/YI2ZbT09PU0WcIzftWvXd+fMmfOL8+fPP1ReXn6PtWmXsyCQ9CATkbEQzUA0A9GmTQPD t/7WBYPJLhiAIyMVF7RXVhUfI2yi3AKC4UU2GNSXHQBvnQMQA8E2n7gedp5Y8nrLqe4//NG//IB8 yaeffnrUnXfe+aIFIjdbY2bLY4899vlbbrnlT/r6+oxvfOMbf/vd7373T0ePHv0Va9PzztKBuDTU WYhmINq0aROBAg0GLnOocJ7DiMLTi8oL2wibqCtvCLAFFRlpoBrKW6sb72trOlXxxe9//+9+h0NV W1vbP1rMo+bFF19c8a//+q9NnZ2d5V/5ylcuvueeez754IMP/tsDDzzwhrXdWWtpc0DEZSJ9moFo BqJN21ABBp7T2ZORXKczzRaqi48SMCjMZKWloW4oa73bchtsbJz6pz/8wT88aq0q3r9//1/W1tbe 0tDQsC2TyVTV1dVNtcDkwW9/+9vrHPDAA3baed5uLT3WGNujGYgGAG3aBjIo0GBAMwclp/NAk5EG kq05chcsueXbfzZv3rzf4qFCFmaxjUV79uwxnnvuOWQbOIh2OMwDweOk89yVsXo0A9EMRJu2/gAG GgyWsWyhv5zO7zdb1fQJWLUh87WHH35oDR5iZxlhLYVhAKIZiAYAbdrSBoZlHLag5HR+P8lIca3l 9DCyoG0+UEJN+S1QreqBhVM7yaOqoZz1QsNnzv3i8Xc+v2nThlPWqmJrKbWWAgpAzlIg4klYQ5mB 9HsiYdIDqAFI2wBlC0GnMyUj1ZWvJhtFzV14v9uW/RYYGAgQhR5A7DtaBOc7C+BcZwb2Hy0mr9uj gvfEHWzwP2u0N8m4M7W+C+6+6gzcsuRc6Ofieblq3O+GN918/19ZAPLnDih0OC+jk7zTAQx8dHNB SELhUE4F0QxEm7ZwYFByOtMy0vvR6RzX7IG/iAz4Nhhk4FxHFgwIm2gttLHAGi8MBxhokDAosDBY 4HCYhwsc3tKHj30wxQKSP//oCZg29kLod0Wn+k+fufC/Xl754joHJFywcAEEF18YL+g8kAH8AzQA aYsHClKnMy0jaadzPEMAQHA47zIDy1pabTAgbOJAqW/w9wOCBwXuje4DB+6j83bmnQQ4yH8UePRZ wIEAgo99fX1QVtQDX7rzJNy65Lz0N6GU9ci2/9HwN9/94RcR+xygQPBwEwg7HeBwned9QzkPRNfC 0jaUZaRlzqMnI2Wdzru00zmGIRjss8DAIGBQSAABh+utDhiglLS/uThwb9tPnWHd+V9RkfeqmEWY zH4EAOIHGx7zoADEAoyMmYE+ow+MPvt97ReGwT8+UQvDS/rgqnkdUilrXv3eyTfedMsSi4WscgDj PAUcbgZ6ryNtmbIxTvtAEpr2gWhTBAYXDHgF8yrryxocp/Mm7XSOYQgGx1rt4WBLQxkZVGkwwEf8 WygfeX8aUFjovzfZRxHb4EtQWWAwOEyEtz2DHgHpqq8vQ0AEvw/5TtRbvm+ByLSxR6Be4mCfU/0W zJz5yVstAHnDkae6HfbhsQ5ngaFekFczEG0DRUbSTucc2NaGUjKoEhnJAYMDzSXk7/NdLkAYYHiz eT8Y0I9FRRwZidnWP6Ab2d2xIMIwE3cfJrs+S1gYYYreP81QPOjITlA92cr2eRiGibQAgAYP0wml ulAA3398FPzTF1uExxTZ6sxx3ZeCHcqLUVcZBzDcIorex4eNb5qBaAaiLQgMik7nXQGns5aR1GSk /c0lDhjYzMAFAxxiCZtoK/QPvAZvYHdlpOzf7CMw0pM7hBsBJsBKSAbl9HbWGQbDIljSQEtcHMAw /H9nAczgDSxkFKeZR8ZiHX1mxtq8D2ut+8GDbG871tE3s3l/MSyc2iU8B2NGNJUtW3bD0tWrX1nh jKMZBzjM90MfEM1AtCWRkSaD1On8tgcGA7Vg3kA0VybCBYEBB8ZjRFoqJIPdtoYy3yDMMoHsLN9i C4UOCLCDdgAo+Ou5zm0GkKhPDrKEAINg9+0f+P1AwbARDtqwTEQ0Mc0CSB+RrgxPuqKpCiVxZRBk DHhh3XApgOB1XVM7f4719E2wcz46HBmr10CKk6cJtGYgmoH0NyjQYOACRMDpTMtI2ukcVUYq85zO yAxwwLPBwPYzHGgpkUcXOY+ELbDAYcgcy+w6wzdZd/V/gwISbmRTQKYSSUsc1gEGQxIM33PKV+7t 02QkLOn97ycdEgCxmYfr9/DHaCFw2BFZRp+93Zs7rPNDEsr5hhOistKyMdbTkdaCG+PZwZOLta/6 NAPRDGSosAVplzbtdI5nx0gEki0TbT1YBq6fAcEAnx9oKYZ2Cxy4Az6zDoGB/pse2IEjPfFAweDI TQGmIFrnDKjs5waBwg8SjLrkBxIB0ACHVZjsOOAO/r5tDQ8UDOo5Dz3cpyyIeOBhUNDh5IP0ZVDi yliPdmQWnsvm08OEznS8PyoqKieAXc4E62Ohs+m8/fXCOxFqBqIZSH+AQoQubW/H6tKm2YLNFs51 OTKSAwYkAsm61sjrnOgi3rrCIsk29KAdeOQBBcsigkBAO8F9s2zu9qx0xTAFgwMCHK3Jt95032d4 wycPbNz7PnjvmoFteeMD/70U8Jj+bVwAoT/H3qaAAo8+69Gww3qd89NyukAajWXiDmzwoBlIgcNC NAPRDCRvwCDt0mYBwLIiixVop3M8c8NR8Urb31JC/kbbRpiDxSbaigijEA32WQ3fYQsGny3ww1X9 r2df8wOInwVQoascYGGjpgL+C2rgZh9ZxhB8zgGS4DAfiHZy98Eb3A2IkAdh8IGC3o5lIN5zzzlv Otv4d53JZHxYQyKzrHUZ0w8eLkPEbHiZja68UOEwD1xKHADJOCxEMxDNQFKTkSaDdjqnbtnchKyM dMyLQDLIOlo2krGF4qIsSGSdz5znXAd0uE+Ct00AaDiAwn2kIqBCneE8iSkgPxnye8tIfl8bIGch 7PYm+F9jtzMYSSsAJOQ9QVRyQcR1rOPfxLluuIvhnZt9R4qkSYW1Iy+g/6PYAY8iZzzF2YmhGYhm ICJQoMEgkLsQ5nTWMpKajESYgaLT2RucGWDAvAUhq/A9DwJDGOCoOrL9AOYwBx+bCAELWoLyzbI5 27EsJAwYAtuYSmhhgtgXwQ7q3EmiCYGBn92XHYVlSreTgUrW0WFywNQ9x4xj3TeBUL5cixjwKHAY SF4m0JqBDBAGIshdkDqddcE8dXOdzmgkd6GrwJGWSsgNS5LbugpCHc7ghahSr4f4JMSAIQEGGUhw 6zIZTLgqz58hzrfgylDsc+p7cqUiQbIeWw4kDTbBDu5RJCdW/zIEfg8XFlnAis9GgtdEJmMthl+6 chlnc6t8eMQ2vosvXjJt44b1jY585eaDaAYyFBiIdjrnT0bKZjobHkAQaamhnPET8OWhbKZzdpYu HLhDgELkl1BhCb7nAmBhwUHmyM6+H7jrRfeB8DVuXobCfQbxMqJZoBIN7jymwGMkASAxIQA0gfem wUYoSSt4rWSZB32u3XLxIXQsw4KHZiCDjIE47GGZAwyVumBeMqPLXrgA4UpLJJ+hrdBzOgdDSf3O YAIKjBOZ7zOQhKjyBl53nxmD68zmswW/H4FmDOIoKFH0khgExI8CdsHzS3DWia5/UxIxKr2/TD5g sexBBgSBqrdRgcRQk7XispGggx1IKRMfCzH810zWJ2XwDpVn5daYUlVdXUVJVwWagQwSBuL4Ij73 j9/9+mfHD397Mjqfsey2djxL2IJTXhuP+Bbaz+BIS/td5sAOxpzB1I1GCkYHGfzII2p2J4piCoSq stFI1HdhQ2FZMOP5NFi/gkGJ3YYQXOSgwIJBECiMyNe7yjasv0DkqzBkYbGGOpgoSVWcQT4JkCRh IzJJy5Wu+voMqK8fAyUlJbBr184sM3auxS37i/nQ7KwcPqwVKiqmVDL+DzcKSykXRDOQPDOQb337 /+AJ+2F9WcPnsCrmhBG73vfAQPoqgN1rwQcGnQW+EFZhZBE1YHqMgRqU/QOx4Hlg8OYM9j6AEOj/ gqgjNsRVyH6YzwhjBmFsgZczEQYaaUu0vHvEMAwlX4WIHUQFExErSQNIRLJWHDbibjN16lQoLy+D /fsPwOjRo+17Yv9+HxtBEGlpaYGenh7qXqCuLcjms/CGKbLOJBsGAGQogMOQYyAW6/jIiMLTP79y 7G8rh7oMZXdhc1t2Fttd2ggYFJGLGzu3tXcVQDCyJ6jdFxYGo5V8kk6GyS+ggMPPMthw0UxQCmKk J/HfjNOZjS4KsIawHAhVwAiCQFhORNh1mis/Hm/2HwVUZCyFZScyJ3eugESVjcyfPw8OHGiA8+ft Zk+XXnqps84OeT/QcIC8Xl5WBnd+8E6y/ty587Bt2zb7dWc732diOC/2BTHAP6GiZSxrOduRIT1C eIaKx6iamloHOIaxABKVSWoAySEDsZjHz+dUv/25S+tWDOoDnm3ZWUCeGw5zwB7PNm0uzV7QjJOZ Bwy+2b4Txw4AXCkJOIM6cHwBAelJAEwBlsAyDBYM6Ogng82WZkEjq0OzbIDPIIKyVZiPQgYAquty ed3LgEOJgUhCaVl2InRyA99HIZKjREDCOtvx9fnz5kGZxRImT5oMkydPsgCiHZ599lnr+WQCFufb 2+Hej30Mjh8/Zq1rgFWrVpP17777LrzzzjuB34/bP/bY49zjwAUrxoHuk1md63jfkUJSVJF3tjD6 sqioqJgCkAy1GO+HqrwDnoE4kVSrrhq7fNG0ik0D8iCSns5HipzIjUIvemPzgVIfQIikGvo4FBYx A2VIxjMNHrzB3ScfsWAklZs4rAGC0pM/vyHjk5/40hUFGAxw+AZ5OtGOxyY4xy4sukklL2IgMe+o 0pUUMBTAJCkrwb9ra2ugpqYmO6hbA35ZWTnMnTuHLGXl5bBjxw4LFI6TfW23nr/77jrrfbVkP7i+ 4eBBb5/f3L49lm8kzC/iLZlgcEfWkR74yQE5a3hJb7GAgRiagfQzA0F/R3FB+6pl4x9b1B+SFZGR EAys62Dz/tIAW7DZRIEwqYtmDYWFspBUppidBDiEDmJaZmJZgSLrCLyHAx60FMT1ZzCfDQqhuCxw 0ANUsASHnFGE3bRxwSJtkEnKQMKkK6mcJYq4krCSOXPmeK/NtZ4jMEyaNIkAxvHjJ6znE6HdYgDI IvDxoAUCDQ0HrecdUG6Bxrp16+DJJ58K+GTc70MABSSSmaJvJAxEgoBrZJmIO3GBrA/kPWtiuGCK qKy7AZPrukaBPwrrfRWJNaAZiMU+fnhJ3Qupg8eW/XYzHkxsw4qbBmTBgLAJ7PnM7YsQfPTad0bN TOZEDAWK7UlCXH0x7MADAU5tJTLjCrIOnnwVcF4HIq1A2VENTAlxbiIe55oIk5HSAouhwkBUAYXe HkEAnc24as6c2WRdWVmZIwmdhzmz5xBwOHjwEBw/cRxOWGCBduLECTh46BC0n7fBQvZ9XHAQDfZS ZuELxQUhG5FFaclA1HeNZ6gsdAdXUG5WSLbRPpCBxkAs8PjawtrVn4sqWyEQYA0bZAoICPi3XSMp yxzCBvcAW5A90no9ByBYfV6axGbw8yIC1Vu5Dmbn9UwQBLzvIItsMoJtTbPRKOJSILy/2Z4UYUwj it8hqTM7NlikjTFmPJBRAZUJEyYQEJg9exb5e+LEidbfpd7rs2fbQLFr1y5moD9BgMFlEOvXb4Dl 8FsuawhLCJT5SGTRVNztQtgICzxhUVr0PeFe/9kJjeGLwnJzoERWPqwVxo0bX334cNNBCkA0A+nP mdj//qtvTZlQceivF9asUvZBLH9jJLy0YQRJcguEoDrPhxWq9V2Q919gJSQ+A+E6fzmPOOADNfDz IouCCW88duB/PUP1fPY1GAqU3Aj3QRiiZDqOH4IdaH1Ak2fQiAQWRhxMUcw25qGFER1g0LdQUzMq ABSlpaUEJGhD8Dh0qJGAwSGLKSBY7Nq1m/wtAiOZ81nkKxGxA+77Jf4L0YAvZSOJJS27lTnN5r17 xln2HS3kh/A6j2WFrTB6dF2VBSDaBzIQGAge9WEFBT9fMvqFSpX3/2bNSPjVy1UkpBVD8woKcPDM BLOeOUlsIMk2DuYi8AAjPGeA/37W1+BRBElCmyD6CeRAoFoChDcoirbhDs55BI5EznAjHVBIG2hG WcBQM2oUzHJYAwGBWbMCYGHLRyfh5MkT3nNkDbt37yaAsXHjRuVBSbWOlchXogIkYWyEBZIoSYJx JC3e/gyKjfhYuHNPmiFAj/0MgZMLohlIPzCQ//+vv7NsWuXm61SKE37/iRpYuXEkKcmMwIEAQsAj EwSRML+CSoE7IShkp+NC4AlIWQF/h19ukpXe4DGEwEBvRCuzIQOPXAJHTkHDyC1QqAAWsgN78C/1 5CQCGBZYIJuYRYFEY2OjtX0ZAQcEhjVr3vQimnZZALHbYhAnTtqAIWMrKtFYsvVhobq5AJIoSYKq klYYiHhBVxnabe5nISiFy3CgtrQBpk5ZPHHTxg0F2gfSzwzEyf//3MLaVergUZAhAMIuSE8zbJhe WBY0+PMQAESNhYKgIH/O+gvA55/gsQLhOpD7H3hO69DnoBb2yvo50gKOXINGFLBQlb3cgR+BAQHC lphGWcBQ41uPktFJa9DfvXsP+RuZAgLFxo2bPNCIOqAEChka0cFEdb1o4BdJUHGARJWN8EAtLoj4 VQR7nAB2kun4ThUkSoNhH56MNdRzQQYUA/na1/+iaszwQ/eH1bN6aGWlBx4FmQIPRPA5YSHIQCQg EnQwi8BBlrFsxJJjAo67COU2lFhCCHjIusUlZR1pAEdk0IgJGLz9oUS0ePEiwg5YQMj+bb+GoICD f2Njk/f6xo2boaOj3ZGYTsaaaYp+J9d5zsku57YPTAgmqvIWCyQqlXfTYCMyv4gPDFmgY0LgM2wI u/O3rB5W2bBWGDFiZAUEI7EyKhMSzUBSYiBIPoaXl39kWuXL0u0xLwN9HsTXgWDhA5EC67nDQDwm YniPvIzoKOAQR34JFt0DbvhrYnlJxghC9ifcJoFclQZwqIJGGGDgflwfgssM8LnLHCZMGO/5F5Ap uABhL6eIZOQCgvt6LuQu2YAStfYVF1BiVN9VBRJuPokBsdmIrLmUVNKK4BfhtgBglAp83Lq/WJgL glFYw4cPHwmcPJChABCDiYHgGftIWM4Hsg9kGAYtWQlAJAskdAcycShqUp1ePoNmn+QGPOJKVlFY R78Ah+GyAJsR1BAmENwOo49mzZrpvQlZAzIC2lwZadOmTVy2EAvU0ptIqTMQWaVd4BRTjFkwUQVI ZCVMVCvvSuUqAYjElbToy8owggoFXdrEBLq/usFTCgH85UzoqrymZiA5ZiBOvFtmZPHphTL5Cpvc Y6huQYHtLM9wQcQBEOuRlrIMQ15wL5HuHgqS/QceUSWruHJVFOAQDczIAiZOnOCtQ4aAgIHrSvG1 CRMC70MgQFkJQcD1K6xc+TLJgEb/A74eBvgDoa1yGHCkXfsqap0rEVio9gsJk7VU2IjI16Iqafly QQJle/zgkaFqYmGagClhuZPrumooABnG+EA0A8nTjVMwvPDsRNm2b+4oy9avcSKtfEBCQMQGjwKH jdASVhzgSP77BgZ4qDjK47AOFeCwgWGidxjsxLYyT0rCdXQ0kjvw4yO+7spGmxyAwHyGjo4OAhp0 XkPk36d88nI+i4oELGGzdVUwCTjhI7KSOECiImtFdbAnAhE6UZaSummJ+0BzIVw+u0N4jsqKeosE PhBD+0DyxED+9KtfW1xVsle6Laleyzq5MjSIFPjAI0P5QRINJEMQPOJEWPFYh1v+wk5yqyFlMWyw MLxMaNYwXwGdzQgE7t8vvrSSSEsuIIj8GlEYolpeSP+xD2RON914A6x8+RWhjAYRpKvITnIRK0kI JGH+ERU2ouJgTwVE6KoMwEnMdV6RjfNYlXdkRUX5mbY2NgpL+0DyxEAQQ6rD+o/vIxVvKaqZcSIn 3IgrR7LigUe/yRQDHDzY4zJp8iQy68ciebXY6sB5GWsiobHVVl2zy2IYBADcjOc33lhDtsdH9EXY wNEhl8ggfmRW6DmOeA3k6oopLSuFG2+8ET545x2wadNmmDhhvBhAeN85Qe2rMDAJk7dUgEQmeYWy kYiSVlIQcfdDZ6Lb44nzJutJQ3Oh9HxWFLXAtKnTx2zcuH6PZiD9xEB6e3szyjd1INTOcBzltMPc 6FfwoJskDRTwwHLauBZZAhbRo30PWDAP17nRSGhYQM9lBFgOwwYHu5CeXTOpw6udFDaYBwZIIw+g oVIbK6GPIjJ4lJbCX/3V/yLH+WWLeSCgYvKgaO+myu8K8YVEAZMwVqIUhaXi5BaxEUVJSzVfJCzM 11+mh2YiGe81rIcVNs5zstG1DyRPDIQk4fT09BSEbTu8tA/8BZdpJ1jGAxE2dLcfSUfojD8JeGCZ bGy+g6vxEf92WUR5mf3cBg3w+RewUB4NDlhldd369eS5Cw6i78P7fpEc5jGAQxk0wqrz5gEgwiSr z372fgIeyDyuvPIKAii///2zkugjBVCRAEpUMAllJQqZ5VLpSeDPUMkuF4GTavFEL8w3INEF2yJ4 1zYWVOySz20xF6S6qroKtA+k/3Bk08YNOy6dMU260bQxF2Dtbr9uKm+72o/godDcSAYeo0fXOr2c DdKtbcqUyVBba/d2RgaBgOEaNuBpd9p9IihgHwYXDJ566ilw81x27Nip5CiXRVjFDX1OChxxQMNI ESySXEsIEjfccD3ceecd3rorrricPDY1Nfkq5co+TwQqUkCJkGWeKyAJYyPCSC1JwUQuOKlKWhwQ Mag+PobhTy5uaC6S1sMqtQCkonISnUzoRWHBEM9GHzAAsnbtW+c+d8+8EJpInXeKdgLQDjDof+Yh AY8pU6aQQR7BYar1nLAICxyGO+xh3jz7GGAPhWPHjpOeDA0NDXAM/8ZubaRJz3nyi5FJ0FFIkfwd Co5yGeuIxBAMdeBQYhsRQSOnZd5DGAcCBYIHggiCxfjx4xlG2GGtmxCa0yGSaNjfHBVM4ta+Uk0K jMtG0pK0ZCBigMF09TQCLW1d34gUAuyByYBgQcXQbHTNQFIae3Hp6ik8az2OEG1UX9XjVr/M3ikG +GpL5Rs46upGYzln8h0QDKZOnUK+FAIEvoY2f/588ohd3A4caPC+94EDB6DB+nv79u1kPYLL9u3f 4g70qTrLI4bnJmUdadXGEgGHEREMYl0jEd6DIHHnHbfDwoUXBdazdvLUSVi0cGEkBiIDFCUwiVH7 SgokCiVKpADIYSNhDva0QISVMwy2DYKzPdbEqq3o4U8Uihtg7Njbx4E/lLdgqIDEYAAQYkfPjMIo hiXCwbqqR2nemRaILFiwgHpugwACRHn5cAosbDt27Bi0WAvatq3bLLZwDNauXUtYAwIFb2BnB2wE kv4Aj6SsI4pcFRk4UgCNfIXzIstA4EDGEWXuhO8bVVPjDzSIk3nOgoEITCKwEpVM8yhsRDaoK7GR HIGIIWwBbV/BMgBxwNRgAMQAhWx0zUDybmaiAcVlDNnno31gQa/bagEBbVu3boX9+w/4XsN1oogr aeSVosO8v8BDlXVgdztchSG6RJLpaM8ZcKie47TDeUUsymUVd9xxG8ycOYP8vWfPXieyqlRR5qr2 Hn0AEjN8NzaYxASSMFkrqW8klyDi1z8g2xOd1xtEKJDaVlvRPQL49bAMzUDygwpmd3f34XPdlUtE 5UwWTu20r3PTdC4MV8oyoa6+DltLkmqq7mzCBQubNZQHQAEHf9eefvoZIjGdP3/OA4k4yobMGaz8 Wh7Ao9aa8dbW1pI2puQGsJ7TZcnc33b11VfDxRcv9oX3ZvX79sB6TAbEzPE1a9aQOlNpA0e8Eu9G bICQfdb1118HH/3oPeQ5gobr41AFD/q3TbDet3fPe/SMNvx3KJYyEYFJToEkoW8kHyDir4EFVDn3 YNO57QdLYO7ELuF5rBnRwwIIXQ8LNAPJPYD0XejqOmIBCCCAmGKqmH2N8oc0N7eQAQsznMeMGUMu AhFYpGUqTnPZwK9SVTcueGCUlpvfgeA5ER/LygK5HkmMtx8sSYIlSuiChkTrd5okYfnzPXv2cBIK jchsIy5oyMBCRe66/PKlcPvttxHWsHfvex5gzJgxI/IxxPc0NR0mDneuL4C59lUBRalEO4+VcOSt qECShI0o+0Wo/fOAKBKIeOABVCRWhpKylE8nnQvyvshGHwgA4gZXma5WKKu/X1/ZAyfPFZKTYnJm Uvv27SeRSpgHkktTDdeNCx4iAEIwaD/f7rEGDPedO3cuGcwx3LemppZkf/en4Xeha1vZNtP3FwLJ yy+/DG++9XYkthEvnDedApk0cKB/a/Xqw3DRRRdZrGNcouOFAOQ62OXhu4Y6oIQlDMZgJaolS+Ky kbT8IpHlLMr3QTUk9AXmtDO5IOwYNbKoGWbOmj12z+5dhyBCLohmIEnRwz6RhIG0tDSvbT4/5ct1 pQ3CsLnRVT1w4pyZvbBNPp1nwxNziyJiiUa59DkHPDCkF5kEAsPoWhsohophD44PfvBO66abCXt2 7yWsxPUBqJd4jwYaauG8/AH+f/7PrxKgWLVqNRw+jMCxAO655+5UjgUC0qlTp+zmRWY40AmzxiOA SRgrCQCJYqZ5HDYSNUorTRCh71NaxqI6XZP3NbQUQZ9krB9mdGLybimHgWgfSG7HYMNjIUYm08fB Ai4TcR9tCcvxiOTpREVxmsskJ5dRYB4IggQ+H107GmotVjFvCIGFeOAcBVdecQVZ0N6y2MgTTzxB ciPiAIcRMRpPdX5x/fXLCHh885vftkDjLvJ3HuckgftB1m1PCiZJgCSEjcgGfBEbSSJppQUivAkf 3TXUYLqUigwLKpZgTRrtA+k/BtLR0d52obcEhDKWZVPHdMH2xnLHF2Jm/ejUO3LJPuI4zTFJEHM8 kE1ghNeUKfYjSlDasoZJdxjN9OCDv4S9e/emDhqGEe8kb9m6lYDGN77xF7Bq9avkU5GBpGkzZkxX /t5mSN9zIZhI/BsiJhEVSJTYSAJJK1cg4kscBKY3uvXk4LEi6fkbWdgC9fUX1UGwHhbAEM5GH0j9 QMxnnl6+/QNX/REXPNzDX17Sl72iafAwc4/oqk5zBIuP33cflA8vJzWpEDC0qbOSr3/9AXjllVUW G3lSEJWl2gQsxnSfs9/Dh4/A33/v+3D7bR8gS9Phw7BixfOwdOllUF1dnVv6wUEMGaBEBhPVMu0K QKLMRgxTWdLKF4hkAcNtJgW+aKz2LgWfqn2YaPbhPkbqNKkBJCYDcRaJhGXYAGKaWQaC/3fwIy8n Q0Gf/8tv/H9eLslAN7vKbgcpt+6WacecDrozYH8YJuMhG/nBD//Fi9iSJTwqYUKCbpPoo/jVw4/A U79ZDtcvuw6WWcvate8QAEmLjQjzOkLDd6OBSVIgEflHkrKR/gARv3RFtX/I+CUsfDzfmYGy4j7u uSstaIURI0e+73qjDygfCAJIy5nKvdZaYTzk1DHdYNIMhI7pzSNuiPweyD4GKnhg3sby5U+TkFoE Ca/qLvMb7OZQo8jfEywgcSv7YnguAsuoUaPy8n0xMun//O134Ic//BHJsRBLhskAXzxdCW7X2dFp sY8XYPXq1+Duuz9C2AkCHLKRxL933DjCbmTf040aigsmQlYiABJuBnlKbGQggIi7XQA4wOk1ZPe3 JT8RHelzJ3ZyZcSSTCsMHz7cBZBAQUVRNrpmIOkwEHDYR29nT8mZEJro5X9k5SvTd0LTPiky6SoI KAMTOB62Zs/Y2EkGfq6Rku4nbXBx28nS22CILiZsYjnytHJKWKOT8r72ta/CP//zj0i+RChwxAAM I0brKASNhx9+FD71qU/Ce++9R5zs48YlC+cl7X1lznAOq5DngsRgJRIfh5KsFSNJUJbTwT4PA6So IBJoa2sYwrIm/gmr0Nh6WARIhioDyfT3F2AZSF9v79mu3hJblqKWPmeprezJXuwm7UR3boNcnSgF Zzk+YlHEY05NrIFiLniISt0HwokN8N1Y7DYYcvvYY4/DAw98nTRFyoW9/fZa+Lu/+55XFuSBB+ww WqpxXPD8cCNq+D4UX08ZybUZtjzyyKOEfSAjSf2SC/me3N/IOTiiY+a7HtjPEBxP/nvl54F3vXE/ N6RZGu83y3Ksgl9OfN9mn1N9hDwQsfd9/EwBO4/1LbPGdYwVSVii60cDSAoMhD4n7R3tu0931QdO jmt1TkVedypgUsCRC+xQCdll//7e9/6BlGJHw/Ioq1evhscff4Is27fvIEs+2YcLHmE3J696Lnuz sr8fgeSf/umH4pasMe2OO24nj8g8aBBxa0fxRkbRjRllII5zc694/gUSRfXOO+8mh4yYwBd4nwA1 cgEk1LyDO+FSaT4WFUSE4ATxSgN5pd0BPOnKX9Id4HgbJjAbZAHeEmQgGZqB8JbBbgMpCotIWBkj 02eGUEXKfQ4MBeFJY6mRDqVueWCzkC996cuc2aG1PPGEt+6ySy8lA2UuEwQ3bNiQCDzCgBMP0m6L kfzl//or+IPP3Q9XODkdSc0FDGQimLyHGeC47gtf+AL8vQXQYfJU0nIlotkrz1DC+tQnPw6rX30N LoNLY//matLUTvw9A9V3BXKXVOby5B+xvCWUtkSZ5yInexJJK6JfRFXOku3PAMNXD8tb5/pDwq7Z glYYN3589eGmpoM8BhIygdYMJC4DoWKkkYEcPt9TKX3PgsmdPnpi+jzqKZ8QRelKNnMXzYLeXbcO vvXt78CTTz6Vs+OL9adyAh7szNRafvGLh0gyYFqGgIH5F1hCBEuHoKGMdfnSpaFMQ8YwuEDBWyLI WWhLL0vmSCfsSvD5Yb8jMjOJwEjisJGoklZemIhEEqNBhC1j4iYS7mwskUxqsTNhG4yurasGgQ9k KDKQAeEDofwgfefOnm08310Z1Bgpf0iWhVCudJPezkwdN1S78fFn6XIddvWrr/o6C+aY6aUDHuzY 65zHBx9MF0TQTp48RT4FQ2nJQH35ZdEHThlgKIBEmJ06dRrGjRsbLBKZ4DzJAE1VshMBgyqQqMpa ge+kKGmlBSKy/WR/syKIUHkgdGl3oMajPtO/mNnJrAHBciYZ7QPJLQPxzo1bzkToBLFstNvYhQ3l TQnRo0RdiS5W2UXLPmL72lyxEAzJzSV48N7z0EO/hM2bN6f2G9C/sMWppowD9Izp06GstCw+aKgy kwgMZN++faldeMLvlQBM4gKJkI1wQEGJjeQIRML2EwVEXF9U9jsbTjJhAcjk9RGFzTB27Lh6CPpA QDOQPDGQXz/6q7ePdUymGIfttOqjFhKJxSQTgmlyS5rkW7pSBhzmIn/uuRUESHIBIPkED9f+8z9/ kurvcBP3sqXTp4vlQsHsPQwwkjAQzAchj0eOpMdAZECnILflAkiispEwEFGJqkoLRHiKAPsdMhnq d1KP+J7G40U+yYpdsKBicXFxCQQd6YZjmoHkkIF4IGI/MZxFUt7d5wdxhK2EJU1yIV2pFFnE9Vge I21zM8pVwYM/WFGRTgrg4W7/0EO/So+FWKwDZSLXsIOkFDgUWEkkBhLyb9u27QREMNEwrl137TUE IKMAneh3i7bjyVthQCKStSCEXbAgYoSADjfaLwKIhDGasPBeH/vwwAN8pd5lXtZhmU4oKvIAhGYg QhaiASRlBmItvRd6Cs/J3jOl/gL4vSBmuuCRsnQlvFGYjdatW5/68cXkNLcbowp4qLIOKXg4hhFU r7yyOrXfgmVDPD/I0kvhtttu5Uo7QjnHiBYmKwz9pUNkqaWzswPmz58X+/cheKAfJQrQSZlJRFYS AJI4bETiV4graamCiBGxNw87wfMnELqvZ4AOrz54rJCa/PqX4QUtWKWhlsdARAxXA0h6DIQqZ1K9 h3eC3KWs2MwGXDF+kMSoniPpSqWtLWaAHzx4MGcshAUPnnQQVbISzlyddwSq6iaSsa71dZn8wAdu hWonL0R5gJUARhhA8DMY/XtEJpLESktK4yUQysBEAUi417GCrBV4f0JJK5cgEhaZxQIj3R/dBZH2 zgzfD+KnJgUcFmJoBpIfBtJnrZAe2/KS3iADMc1ETvRcS1ciXZb9nFxEY2HdKx7zkP7WCP4O4Egk 7jZbtmx1oqiSmz1Dz5YLITWoLrtUGTS4A3MkgOAzAndB8Bg7Nlkk1jjsbsgmSEZJIOSCu1jai8pG 2D+lkVp5BpGwe5cLIoZYgvX5QpxQXnSkcx0gjo0ZBTUcBuJ8hGYguWQgHoh0dLTvbsVsdAEDmVzX HWQgwGalm8lRJGXpKnTGB5i5nj6AeH6QhLKVCnjwBqctW7ak9lumT58G7723zwOU6dOnK4MGl2FE AIiwmx4d6JgMeOTI0ci/67XX37BluqoqsVwm+02CYxDGSpSBROIbkeaN5BFEouaI8CZ8LlhkfL+Z lFYkTxuPF/LHMWcZUdJRBBGy0TWApMdAPADp6+07091XIgeeYCZIoJyJ6gmKyj6SSFeyZEN8juXV 07ZRGMqbR/Bgxz4s5ZKmHaYq1iKgsM2YQllGBB+D6HqRqVtHYkRiXXrJEhtAqqslociGlJ2ESlUR gUQoa0WVtFICkcB3UwQRkQIgPtdUb3SfP8Sggnv8kaHZEieehBVoLKUZSA4ZiJONTpbe3t62CxaA 8Jiiu5BcECrL0HOjxM1Gj+A4TyJdhV3cufCB1HJCefMBHq6dPHU6UEk3iXV0dgpue3mIqSpgxHWB nHaixOI40t3w5EjAJgCTyEAiG2RjsJFcgUhYiK/oM5RAxWDZGieUwlp/8swwqVpeWXQQFi9eMgW0 DyS/DIT2g5w8eWJn6wWxhGVSVXn5jaXis48oDCKudCW7MY47PTrSNHdwSgU8BM5yEXi4f2C2fVqG NcTe27ePLGgYOstlGwq+AgWCIgQq9t/p063k9SpWhopg06ZNFX4PJTABhVBd3rWbAhsJfE8eC8wh iEQN7xU51dme6LQ/5MSZwoBsxbpCrJEowwMQzUByy0A8ACHZ6BLwMDlnzn27yTAQJSCRsI+krCSK 7IWb5CoKSx7OGAE82EHUF8nFBw983Q2/TcPcooPVVXYEVgfmXkQADRXAUA7pDRvYI9jp0zaDQUd8 2PcUfmYIK5GVZecBiYyNJJG0uBGAOQIRJTmMYiEA2fa2QEtYRrbOoxnU1MlSkmnD67IKtA+k/xhI S/PRxvaeCun75k7qDERhmVSbEBXwUGUfYQxCVlpCFWBoS5+FyIo8isFDmBegwjqYAW7v3vdS/UXb tm73gGQslTuhAhoqYCGSkcJmkfv3708OkBaD4QNVTDCJAyQKbCRNSUsVRETgpjrhC42u9H6K3Z2Q zUjf3VQijcIqzbRCRWVlBQR9INxsdA0g6TIQsmr16lcOtfdWgrhMqluDP8s+6O6EEREsMvtQvUjD LnBeUtPkSZMg7cvKDQ3mDjAS8OBvpyZZ8WavWPY8PRaS7QuCyXdRQCMKWChfQ86yb9+B2L/Jlb7c ZEJ5+G54Jd24QJIWG8kFiMhkqrhOdZpNu59J537QvUKEZdlpLLGr2nOTCTUDyQMDIQuJapD7QOjO ILQPRKUzIdsoKir7YC9aVce5sNCfY2V01nhK1tHRzmFNctkqTfBwbe/efan9Jrry7bixY0XjJRc0 RIARBg5KXvUU0B8bjqmWIRH+XgUgkfkI4rCRfICIUKaCCL5IwT2YbWFLS1fBHiHnuzLCWq/lmI1e U1MLip0JNYCky0Dcc9HX1Dp6g+x9tRU9Pl8InUoSnYTEDNuN4TgPA5hdO3f5CiCmYaNG1UQCj9iy lQQ8cD0O+EnLnbuGzuYXX1xpywakfhRHg2cG3EhRTaoedYDUBwQ2IotbdJALiPJqugGJMSU2khaI BLcTX18qIKLiD+GyEKYXSMZNJHQesaiiaGKLBRWLioqKKQZC18MyNAPJFwMxDFNEEZmIB39FXnWf eSigxF0f1XHOvpZ2NvqsWTMFDsT8gQcaFht0kwBzMdDKJBbVvArZ9aniAzl6tFkYZhxJylLIWxH9 Xh4rEQKJTJIKYSNpg0hodFbIhE/1nhNP5vxyFXhdChl/T4iVFfUWCyQs7QPJMQPxQMSyM5gLQjds oZdJo7uz7TYDnW0VEF7RqRaVfUS6YA3+xX/8+IncHXDmxswXeKC9t++91BiI6Pjx2IaS8wDkPhAV JQuXo0ePwoGEjvSq6iql7yxiJZGARCBrSdlIf4FIlMgsBX+IUMoCCIAIHZbMYyB0c6lxNRdGMRJW gWYg+WEg4DKQjvb23W0X6oXvKy/pcxiHPBs9X+wjTs6HaN+5qIc1atSonIMHbwBnB3sRa0iOJUa4 9q9QnTdy/UTGMBQ3aY/7aVOnRgbAVIBEgY2wkpboc3kz9lyBiPAejeAP8eWuGBlKyvKDCO6zXeID oUypIq8GkBQZCJWN3mcwEhaXKhb30TvinkkuyueAfUQGH4P/WXT7zDRt0eJFwu+kVHSOAx6iGki8 PhW4DvuZpwUgOFCXlpSQulOdnZ3imXXYrF0RKIwI//bvP5D499HfJwqY8KrKyiZQqmwkkaQVBURU rs8YTnXVXK5szofh1cPy54EY0HEhE7yZzexSbLTBzFmzx4JCNroGkBQZCM1CWttad57prpO+d1Jd t+P68HLRPVbCQ5P+Yh+q0pVrO3fuyt3xhpABJAJ4hElW7M2LPhCsXZWGYXMpTLgrLS3xFy+MCBqq YJFPw98kwgiVnA/eYMpztquwkdQkLVUQkTZfU58EyiaAsn7owJQuMTiVeZuwM6FJg4b/c0sK2qC8 rLwUtA8k7wwEXFZ4oaurDQsqyrPRTcoP4m9oKyxnopj3kVP2oUrBU7QJE8Yr5XrkCjzS/n3oa8BI LA88wmSdCImEUkqgsIwdOwZ27NgZ+7eNGTNGKZFQBUhk0pYoc5x+UVnSyjGIRHGqpyJl+YDDz6Zx vaxOnyOmZ8CfTKgZSJ4YiF3SvbOjla3IywJIDVVQ0QS2nIka+zASJhKmxT7o7U+cOJm+hLVwkURO k0kCku1igIfbOzypYfkSzPq2I5bC2YYMNJTAIoKVlJSQaKwkhvtQSSQUspKIQBKVjeQKRHgvCkFE MUkwjpSVPU7gb3Fr/Tt1dpj03I0sOAhTp0ybCPw8EEMzkDwwkGeeXr79TLe/oCJrtRW9tgPdDIbx 0iDiPc8x+1DKOFcAphM5KKhYVlZKwnmDv0lWEkIiGfQT86Blnm3bd5LZPlbBVWEbyi1qFSY6suXA gQayJDH8XSLQi8RKQoBEmY2kBCLBgZ85xoo5IiqTnyhSFp+F0M71LANBAJEqI/aY4xZUZFmIZiA5 ZiBoJBJL1DWSKRuQZSe+LbPgkS/2ETpgShznKmwpiTU1NcGECRNCwYMehNMGD3wfr+d3VEMn9dVX X+UNskebm4VsQwk0FMAiCpjIJhsRbgxxIEAEViIDEhU2kjaIhIX4BgZ8kd9CIkvHkbIMJnnQYCoo sqXeQSJhFWdaYcTIkSOB4wMRMkYNIOkyEASQc12lR01fsxb/MndClz+RUMJCwkblUDBIkX1wZ2XU hUVa0KZs48ePdzK2wyOucgUeaURgoXSFDZvQ9zFv7lwSjYX+EMMIn61HCeeVAUWYIfuYOmVK2jMt KZjIgEQmDYnYiBBEjGB2f5ogohqZJbolVaSssrIymDRpIrfig2Fk9+wdcgjmBO05XCw8VcWZNhg+ fPhI4JczMYYSAxk2EBgIh2ggA+k90zECPaRjhODDTANUamGFVuUERZkrIfuQ7S8XeSBoM2fOhGef fY47o5T5RkIlOFnpCMoxOn/B/MS/4Y01a2DsmDFEwsJlzZtvhgIzKIdwqpYukb9+tPkoXLx4cbL7 ghm0hJMhZ73hzYpN32b4srsfVsr13otOYWTqpNOeGdiE+35qe/f99L68uuf0OuZY29sZAX068H2o bbzXvG2cj2H2Q3/mVVdd6d1T+Hyxc25w3Te/+W0iGbv79Eq5B3qiG5DJ0LkthkrfOq6EJTyvGkDi MRDm4slCgiQXBF8gTnSmqRSTkh4XxPLOPngggjOlHKG28HOzVR2M8BlkBPBAq66uSvS1j1hMY80b b8I3vvHncArzQDo7rb/XhOrsYbPTuEAhstbWVjjd2protyI40gN3KJgIgEQFCNhBm32/yQOCmCDi Byk/iPA+CxNgkbmiBIsvIpPGe+PkyZMWg7BfO2E9b2/v8PazePEiuPLKK8h7cf3JkyfIc6wJh++h jb3HaImKqu3uutM9MCHJhJJxZvyorhoQlDMZCsxjIDMQj4WcO3d23cmuSUuqiw/S94hnNSN7A82l fKXdmTxR1YG9P9mH+zfKWLNnz0r1WKMjXQZkRkh70yTgkYY98cRTxPeBshWykF/+8mHo7OyK5HiV h1Wr8wMpAznaAnffNZkkOGI0VRzDUN4dTj4QCx4BIIgBJCIQ8T6DYSNpg4jrC2s6fNj3O9zPwqTT Bx74KgEILH+zafMWaGpshIULF1pAUA1vvfU23HnnHQQgfvCDH8Ch9iZvH42NTWT9qFHMeGGBB0Y4 4n3QaO0LAYVudZD97hBwooPhT/I9fKIQLposPn/FRX1FDmgEGktpBpJbBgKuhGUgWIO8xYfJNLb1 lTMx5SNDlByNqKwlCfvIleHsTSRdqeZ6xAUPfO3SSy+J/d1/9/tnCXBcffWVTpjsUX+uRUzgkB/2 8HMi2m9VVSUJ5Z0yZXKs31tCGEjw2uexkqhAwgURBUkrLohMnzGdNMnC5E9kVn/0R5/3vu6KFc/D c9Zi+j4fYMaMGT6f2RWXL4UmC1QaLSayefNmuOKKywkLefzxJwlg0FIWrv/d734Pf/ZnXyeBI+3t 42H37j0ELBBE8BHBA5kJvzabwXQm9EtZroxlSgfWLhhZUVF+pq3NBx5DATQGOgPxcnF6e3vb+qAk 8AJtWFTxyKlCLxHENP3aME8CUJGhRANlVJ9JHPZhz6LSZyBKg59KrkcM8MCkv+qYvcLXr98Aa9a8 CTfddCN/Rq9Q2kINNNIF94aGg7EBZEx9feC7+nFCAUjomT3Hv+FFE4VIWjwQucyaDMyfPw9ee+0N uzc9tS3KQh/58IdI1YF33nkXFiyYb7cd5siYdGMw+gPcgf3kyVOEceDfRL6yHhdZLARtz549RNoK +FgcEFm58mW47757yffBts54TyGQIKgcajwEV115FfGJvPTSSu848iPqDMjWZ7TXHz5RZAf2iNh+ QQtMmzp9zMaN6/doBpJHBuJcvETCOnXq5I7WC/Uwqmi3+EQV9wUYSDYr3QyATmwZKg/sIx+OdLwJ DzcdVvJ7CCOuQL1WkfsaDjbIIKoigggyjSeefIq872rrZkc7fboVfvnLRyIBhypoRAUL0fYIdHHl K5fB+PQfAZhIgSQuG3Ge4+COkmF1dSUcdjL+sbf9tGnTSB2ysXQjL4qJ4GCP5xpBY8GCBaQTpVvC xmUVbm8YFyhYf8jatWsJcCxdutT7CASLmRYzQXAY5ehT+Jw+k/T9vmnTZrIdbrNr124CIO7vHGUx kd3WOlwvO7e+sF7qb6yHFTb0c7LRtQ8kL7Ngh08YmUyfH2yCG5ZiQUXP3ZHtSmgqeNJVnedxfSZR 2Uc+5Kyg0zD8s1m/hyxUV5QdjAASFTxwEPrJT/6LPL//M58iAzIykZUvryL+hfjAEdWZHv18oCP9 iiuWxj5PlZWVnO9qipQqLpBcvHgRkcJKS0pJ1j4C71VXXUGO4/4DBwgIlFiv7bNew9waFkTmzZsL l1yyhMhO8+bN8z4bw6jd84PBDDwG8fwLL1qfXQrTLbC57LJLSR8Y9Hu4Pg33ke4PQwMZgsdFF11E QGPVqtVk+z1795LvMsEJSUc/CBuVxbKQxx9/gvGx2NudPHHSTth1UIfeTyCRkG5p65yTjm55BkSR 0WYB7Lj6TRs3aB9IfzGQzZs27LjmoiV8H4izbmLtBdh8wAw0lhJJXrGAQGEgCX0vRGMtu3fvzg2A ULkgKmVKeE5zIXgIXrv00iWx5CtkHtic6WMfvYc4lZGNiMAjKnAkOZcqsldraxsFAvFs6tQpXka7 fZ8Y1nGoJwO3ewxEQFJfXw8f/ejd3r4QOFxWcMACD8yhQZZDpCUDPGaH2+BnIcuYP3+u9Tk2Q0AA QkBBo5nHJz5+L/zH//2xD3wM057Avfba67Bg/nwy2CMDQcB49dXXLCAZB1u2bIVly66Fu+/+CHnu i8xypKstW7aQx82bt5D3up+Bf/NmlIYDYDzVgTvOUPIcT+YkZd3BoBpLZVnIkZNF0gEGK/IWF48v AX9nQoNiIUOChgxUBkIuj507d7R2m1eBAlcMRmHxgSk5EIT4TMLYS3+yD1fCwhuWN9pKf5vEF8T6 PejXMOLl1ltujgUeB/Y3wCVLlsCSJReTGTPKVtmBU5QRHR04wo959HOC2fGTJ09KdK5uu+1WzxeC s20E0yuvuJwcAwSWOXNmk+dP/WY5BTT2e7u6OkkocZUDYsg6EIRdYGKB6qYbb/Ctw0RNlzHudxpk Ya92BBEEHbpiMG+QJjWjTp2Cd999F6qqq2Hr1q2EbbjSLLIirIt26tRJ/mBu7e+551YEwFEw4WQ+ W54bEmQrQRZCXfBOWXeKjVBAFzIuGc4Yy7IQvt9KA0i6DASX7p5h56zH4QICAjUj+bkgWRAxYwFB mPM8yoAflX2gnTh5MifH2zBiSFeyQnQS8MCnH/7QByNLVytffgU2rN9IgANn0es3bIQnn/xNDNYR FziMyMeTtebmlsTnygUPNIw6cvNLNm7cDIsXLyTg8corq311t9wxc8qUyR54RJEM11vHvcNiHR+8 8w4PKFzm4QKLW0IGWcG27duDAznlD0Epi77P3W3wM9A3wmMEAUBgotF4CYahbEORhbClTTB50Ncj PZNNMMSaWNUjerjHckTBQRgz9ubxEOxMOCSAY6AzEK+cyYnz1XvMGuNiAamAUSP7ArkgPpAxE30P pW0CA1rS2lsG5KSgIpov6sWVHMLyPSB6rgeuwsgr1NCj2O9//yysWfMW3HTTDSRCBoEDASQa64jQ tU4BNHhvQXYxZfJkqK+vIwP7iudf9L1elVC+co2W61ASO7pzF9xw/XUESJCRHGhooL67ST73iiuv IP6PqIZAj8fdNWQeKD+5fo5pFlNxJwMINu+uWw/rrIUXbqyUIyIZ3L0ZfhhAeEmI6bAQDzyA6g8i KGlz6mwBVA3vCTusBcDPBTE1A8kDA8FsdFOBK/r+mVRElsslo8hXSZ3nKejsuWpihFEpbNSV9DPD mAq37Latk3/us/dHBg/MnfjMZz5FZJWf/PRnxO+hzjqiAkd4bggChevLuO0DtxBmgeG5ixYttNZX eNvt2r2HrHetta0t8blCYEIAcT8fn6Ns5QIUymToa8Hfht/zhuuXxQ4b5pnLPKbCFI+N4CMuCCS3 3HwTXHP1VUTa+u3TvyOMRDVHhB20RYyAl6XO3U4KDnyQ4e2LDt31A0YmWwHMcGN6DWYsYwB5eM8I kNTD0gwkdwzEtd7u7u7DHb2VS0oLWrlkYhYWVOQ2J6by0c2I8lUMIFAFm1CfCPUyhh26FXTzefxF QKoScYUPl1qs40Mf+mBo8UTSltbZBnM9MM/DlkY6Q8FDxDrobVACqqyqJIPtzl27yQCMrAHtqAUE Yyz2gINzc0uzb/B393P50suIo9eVo3CQRMZx+eWX+UJ0cb80U0jLyHezPvutt9+xPq/Y+wxcj5/f cKCBAMb1FiNxf1euzPV5sL4PPH/IMhFsXn99Dbzw4kvCsGDuIM/4H2Rsgw07lklZAnxSYiF8xgFZ +cqRsPYdLYap9eLzTgGIMBJLM5DcMBBwGciFrq4jnX0VUFLQGhS5OAyEng2wkSlpyFehoGOkxz5y kQsyY8Z0KfswEvRXQEPwwOStMHv8iafIXj72sXvI3yhX4QCJYbpvrHkr4CzngQfOxqsqq2DDxk1e X/SsHFMJn//8Z72BHgdZBBH82w2xxRk8DryrVrdyf+vba9+Bzq4u+MiHP0hm+h+/72OkpIa7T1zn fs+2tjO+92PCGg7+CDhJDL/zW2+tDQDU4kUXkd9UmZJUFtcwCQ9DfNEvcsstN8Elly6BX//6cdi3 b3/AqS5iDIGBXcBCpFJWDliIYQR7zINBsZBwYYQnYQ2pbPSB7gMxiZwl9oXbsszIXmhrL/QAKRjE a8tamUwmsXwVCXRAMaJLsC9SIC43Bz0cFI0QAGX2gRnGt9xyMwGQMFu58hUy4LiJgcg00O+xfcfO QIguSiVz5872wnhbvcgig8y+MawVB/mNFoj4v6vhq0WFj4sXLSRMo8oCDZSfUPZ5/vkXyWAvYmIY MoogsGjhRdBw8CDMnjWT7Le5pQUqKyrJI742edIk2EWFXuN7kiQSeiD29loSUeWOobjfu+/6cGJg SstuvvkmjzUiO8Fw7a98+Yvw4osrCRthnepRpSxZwUXfwJ8WC2GuIX4iob3u9LlCaTZ6aaYFZs6a PWbP7l2HNAPJIwNxTiDxg7S0NK89PWHSlysLDwoA3o7Eamv3tQOjGk2Z0oEwDT9GUue5aNBGCQtL MIxiq8IlNCxUx2stqyJdsewlCnCgYcIasgOMsMKBGP/GmlZ0boP7mbggeNxx+23EN4KOYXzEgQpn 3tmopE2B72n7D7o8FkCDCYKH+xqCQti5PthwiIBEfV0d8XW0WO9rbjlm76uigpv012C957HHn4TP 3v+pRECCLAszqvE6xt89kMCDJ3G5hmwEJwmPWmyEZJunKGXFZiEh7xPKWHQtLCov5NS5YWJRBBHD 6MLE3TLQPpC8MxCPhbjZ6KYUhETdCk2gHhJ/x5yAjoC1uK+nDR6ubp1UusLMcrceUhTDzOglUy/2 wATtzjtvh1/+6pEAeKAh83BLo+/cucvnJO5wfBq33/YBWPH8CwEkRvkHpR4XRJB9IOuwHdMVxK/g OqFliN5w8BA8+NDD5H329hS4WMvmLVt4qqD1WRMJ0EyeNDH2ufrArTc7/o8u53nJoBhY3BIlf/yV L8K//8ePsyVLUpCyYrOQEBDL7odzz7qVeKkILSNkXCoAZGWkBHbAka4ZSJ4YSEdHe1ufUSwFgQmj L8C+5jLK8RExEz2ifKUEIiHOc9FnswwkF3a7NaP/0Y/+TYkF4fdzQ38/+Yn7SHkKlCnidhccOybb HwyZCALEyy+v8sDEDx71BDDwLwxXxdIbBxzHMXndyZPA7Xg/YIwzU1+1+lWyTwIAT9vRUVMsIEH2 0dXVJT0A+FVQQmpp6QRV6du12bNmkc53SQwB4wO33qK0LbKu/vaJ0JOUsePGwosvvgSf/4PPws9+ /qANIhGlrP5gIfS964EHuE2+shfBkVNFgYms7xgYOHGZVwfBelgAQyQbfaBHYZnPPL18+/WXfQFA MvEqKzI5fdKZXiCCmXQSkIgLPqqgkysfyIzp0+ELf/SHpFIqlorAbHGiYVuPKEmNsgADBwCsohrI G0nREDwww3z9hg0B8EC75+67CGigkxzlKwQPBAF0fqMfxB0sd5K+GcGBH3MzEKSQgbBO+U1uOQwB aCS9LrKDepsv3DdNw9/09tvvEHA9cOCgI89VkvIjtByI0psHanNmwZzZsxnQzY255Wsweo0FkbCB Pl8shPt5hulv90v3BKHyQrouFECftNUEuNnoNPvwdSbUDCTHDMRZuAzEXVVCCipmcz78+CFmI3Gi rxIBhKHGSlQHsiR20UULyNLfhr3Dv/qnfww//a+fkYHeLrlRT377cytWQOtpTJjrIhnXqKm7Wddu WQ7X18E7Zm1tbWQRH2sj9FgnOd84iFekDB6ujIYOewQP/Nt0BlT3eLDTeXT0u/cZgi8eSzzO99z9 ES+vJFf28fvuhddef8MDkX//j/+US1mcjqJCxqLAJkLZhug1dkLIK/WOrPZCBkqK+oA3yBRBG9TU 1NYAPxdE90TPMQPxstFPna/Ya46AGUIJq7Y7Cx5uVV63sElIOnp/ylci2cg1jA4aioaDHkZcLbl4 sSfT/OmffMV2qlsAMdWRqHA9sguy7NrtgQcez2ZrIBSBQLg/Rw4cadXGOnjwEMyaNTO144YA+9jj TxAAoQcgfyVeerKVBRE2E9yuofVbuOP2D5AWsLm0a6+52mEiz5A+IfgIskx0iUM9CgsJy05XYQD+ 3iBZFuLKWkdOFsLU+i7ue7Eib2FRIV1Q0SvpDk42umYguWMg4LCP3gt9JWe4N3CWdADt+YhSwiRf 8hW+VlNTQ8qpY5lpjK7C6KUJE2yN/N/+7d+Jz0MZdAaxITAg80DfBx47fD7FAg1cP5eZEeN6d5aM QOJKNirgEQU45Mc7ZkOpg+n5sJBFuI589juzJUKigsgrr6yCxRaYYyZ7LkEEy8Bv27adBF7go1u1 V4UR5IOFsH3hmQd/FBYjtwqHnKyENYxlIZqB5ImB9PX2nu3pK4VhBj/rE/NAfKFYdDFFukthRClK Rb6qtRjqnDlzLJr+um9bNAQLDFdFRyr2YsbmPLjFoUOHnG6DBmmxiYaJdL/+9WOBz6eb5wwlQ9/E jTdeb/s0jjZ7/g2XoaCWj1IWHXWEQIILyjSrVr0GGzdtVgSPqMCRTn+QY8eOEQmtoiK5jPXM078n znz/9+MDAy1p2asN6banLUaDIIJl3j/1yU/kLNLr0ksuIaXfMSETEw072ttDHepRWUjw9XjAQlfe pRtJ+QowWE9Onxtmfc0uweTYmgDVd44Bf0n3DMVAtA8kxwyEQEJ7R/vuc711yyqGHRQCiAluEqGZ bS4V0lZKdSCora0lS3l5mQcAtUTaNOADt91qAcQkOH7iBOzatcu3bwSQW2+9hTCPDRs2ku5nuA7B A9e5meb4iIyEZ0MVQGg2MsWRrFhDvd7V/FetepVsi9nXc6zjd9ddH7KeXwvLf/sMkYrE59VIDBxy Zin/fe+8sw5uvvnGRMdo8+athIHQn8cDhqyMxZO0sqDDL2xoEBD/75/9HP7w83+QExDB4pq4vPDi SpLdjzkikDabkPT44MlYoUqlj2kYzD+wAcQ0qHMSBBEI+kAysrFPA0h6UhGRsDKGvzOhnLBQtNh5 mDp1KhQUFMDIESPIYFNeXg6jR48my44d26HWejx//jwZyI8fPx74Ttdddy0JfUXLbneCAEd7+3k4 Yb2HBg/XsKLuv/zLv8IXvvCHXn/zQ4cafV0BkZmcPHkCHn30sfeFfBXF6HLmGJKLJT127bRrWi0m xQwr4Q8+dz/J70AnbZuvgCGfdagCh3pLXLlhlvxBa8IxaWL8cN4WCzyCclUQGGRshJW0RCCCbBBB 5Pbbbku1MKNr2Bvm5794EN6zGAh2K8SS7qosJCwiK25Ir0zGotmtV6GXykzHP2Q4gH6QcePHVx9u aqKz0TUDyTUDAbuMCTgM5HBnbwWMLBDvZ+a4C7D/WKGXBuLyj7q60fC97/09DLdAAwf/Y8eOw/bt 2wl4oGG7TSwEh8DxiwcfJI/sAILsA9fjwI86/LXXXmM9L7cZibUZAsk111wDrzsyFgsijzzya/jq V/+EMBBbxrKBBFnHSytXwsWLF5OSED//+S8CA1hjYxPMnDkzb+fDTfjCMN59+/aRa/3wkSPQ2dEJ p06fIhnjaNVV1UTLRnBms5BzYdhh7667PuwVLsRj6YIyJgd+6Yt/BK+++jqpX6XOOozEoBEG9ghq daOTZY7TlX39A7+6TMWbcIeBCDKRtEEEGQhGZmFI76233mwByb7csZAwlqEkc7nAAVn3N+VMP9BS DNeDHEBG19YhgGgfSD8wEOIDOXf2bGNnX6U8G90L/6NlLLAApI6ABxoyjylTkH3UWmDSbrOPWhtI MNkMy1KzNtp6HQcoBJF169bZctVxu1cHAorLJtDP8cbr/Ogrt7fHxRcvtpjGrz3WgU2jMNkML0RR 4URc/+Zbb8GihYtIvkbadvjwYTh1ygYFbPJz2nqOf7v9rvE5rwXufjhABnJsMITvw/LtGPePvo0j R4+Slqm5krzc5W1SpbYEFi26iDzigDTJOldP+/wF0YAj7XBe9INgJnki8LSu4d2793LlqiAbUQER +XauPfzIowRE0s4ZwYkHnqsXXngpMOiHsgiBRBXGQrgyVgg4uWzDRY9sSRPwPYonx65r1swAp5yJ ZiC5ZSBuLohXzkRmo0b0wv4Wk2EgAOfOnrMHvAMHCJAg80AgwYEZwQPBBA1bb/Lsy1/+kvP6Opg7 dw5hIOj/QACy/SDhAImf9Wd/9hfc2llYxwkXkXzVbjGCReMnQFNTY+pMBFuObt26Dd6xfhs+9wUN yHR/56ZBwCWg62yLrAVnmJivgWvm5ghEXCDBsup2TsQeUuQQDR8rP/sp4nRupqSfOMChBhrybegc lbjW4Pl4ZHJVOiBCD7E4QUAQ+ZM//nLqPhGUst59dz257qRMIXy0j8Qy4uSEZDGEDuO1Xzl9fli2 BB/vOjWOWffDuLpNGzewrW21DyRfDOTXj/7q7cvmfQEmSI43aS3pJX5k2QhS5G9/+zvwpS/ZQICO QvzIyZMnE1ZBblAvLDT4fVasWEHkK2Qd+B4EkR//+CcEPH6zfDlhIBhNEtZBULXwon8bA5oam2DC vePhLYuFpG3/9d8/J6GVvu8Hon4l4u/o/o0Dzo4dO8iC+8GmUBcvudhiI3NyFtmDWd64YFkSHKwx cx3Z4P33fwoe+uUjxH8gA49owBGHhST3Z+Fv8g9uRs5AhJay8DWMeMPrBEEkbVtgMZFXX3tdyELi hvT6ZKwwFiKRsdysc6Ar81LFFPHvVgQQyW/MQCcUFxeXQNCJbgyFRJCBzkA8EMlqvWKo8XdGz2a0 fvrTn4bhw8uJfOR2TUPHK+m4Ztgzadf3wQ6myDzcdTt37iQLPicylgMa3oUVUeqI0nUQS46kyTxQ mkL5yuCPoLG+M/s2rG+FiYFPAhBW8tF77s5ZCQ0sp46GJcRxUFq48CK499574Je/fNgaBM+oA2II APRHgENdfR3s3rM3VRCRTfHZbZqd7PUbbliW6u+65tqrswCiwEJUQ3rTkIZYdprFEbq8u/9+4H1k xuyCoiIugGRgCNigYCDW0tvRMwK1qOGiDcdjNjpTjtcGEROW/3Y5cQIjGGBPEFxsEGlIpQFU0vfI oq8am+xktDTrYqFs5QKp7LtGYR9ckKHWo2P23/79/xKn7D333JVaz3CeNIKGzOOnP/2Zj/mog0e6 oOEGTMS+R0Ck8ftDc90JmYpMpRaZlRVmXn5lFdRb4D83xdIn6DObPh0jsfYJ5aRU/AQJZKysnOuy kKyE5SYTHj1VCPVV3dzBq9howTD8WhA0lhrs1u8oSHI3BAsFB31nOkr38Eq2u0tpEV080S9KYkXQ t95627t4kgCCigQlek+07HZ/QcWOjvS6E44bNw7WvvNuZEYUhX2IBmCUEP/pn34Izz23gqrblINZ e12dUx6liymM5/9eQR+Jv4AeLzIr6oKRgMl+y2jmsw1JoiT7Ow3J9agy8clu23y0OfXzdOmll6hd YwZwpVYjJlvmXbxsImq2H4igza0jY3VcyPDbSfiNlwsy6EGk3wGE33/YYOWrPiByoQGipaQo24nQ pEokmArydJL8i1izUyP6pmknExLnpeLNlJR98AatNy1A37FzV06vLYx++tAH7yCPhiHLBwkChwg0 VK5l1oqLixP+jhKuwz9dEAnPhXll1SqvHlkahiwYG5EhCwmdhSiDgPp9aUQao5iqvFRmOhZUBMns trbSqOEwkIgjgQaQOAzEAxFrBr77fF+d8DyNq7ElLI+4UBJWrgEhcvHEiO/Zs2dP6iG8hkpbW/qG TIF9sEfgueeeh98sfzqn19esWTPgM5/+pBdKK5q9s+tFoBEy4Qlsg0wo2HMkmlVUjOTMkOUgEjw3 hsK5MUIlvad+szy1c4NRe++uWy9kIepVq5XkAOV9Brdhe4L4nenNp4ukH11W2FHEARDNQPLAQDwA 6evtO9NjyiN5PPc5U2Qx22gqPij0t6XpAxk3bmx0JOCwD6FkYKhHcmEIM5YpyaWhBHTzTTdyWYcI OETXaPic1r/NzBnTEzMQrKVFA6AKiPBDlEXdJ1UGUdtQdtxA9Z9PLGFZDOS0k4cUPhsBpUlPLBlL YXwCIwsabDgvTxXpcxZKwuI1ltIAkisG4oS4kaW3t7ett69YShWrh/dQUJLtj061SI/lkEvDZxI1 fJfe1G76VJbqzE/WUZAd8I0YNaLC2AdtmMTpFkbMlWHvE2ydG2UgFYOGIViCrx9qbErl+1dUVHKP a3QQiStlZddv3LAx1XNDB3QkHO3jy1gCP4h3HQAtW/knum1OKK/IB1IKjbB48ZIpoH0g+WUgtB/k 5MkTO2USFi6YTBhgH8JBOr7sk0b3wSiGBRXHjx8PmzenN8hiCZcoM7kw+SoMZMIGsBUrXvB1Dkzb WlqOWWxgBly0YAF3cJU71yEAFGHXrde1rit5ImFb2xmy8HwZYQNmWIRZHCnrAJU3lYZhOG+YApCL ey1SRW4jyzYMhoW0OsmEosWZ0mY0gOSfgXgAopKNTjvRXYeIS2Jc5hFIFuqHAoZRbg76NSy5nSYL SSJfGeKaH6Hsg/caRks98ujjJD8nVzIWhi9fc82Vwpm5OCrLiChlZQ1rryGI2AAQl32MpCK5VEEk 3KkepfYXu+3OFAMgMJwXWyknkbGUorHiREMy1y2VV5iVsEJ2VwhtWDuuCrQPpP8YSEvz0cauvgop 0k8f2+WBB40Tfn98aAn5nIFBXGtqwoKKMwgLSctEUViq8pUC5kjDRXmDHerrKGXlioW4n4U+hahR WUnCeRFEzpw5k+hbI4D4OuNJQETONkBxAiW/njGhNk3DWmr9xTJUx6fs/eBnIIeOFQsmx/YyzGyD ikrS25j1gZBsdA0guWUgZLPVq1851GVWck+QRxUZ8DBN05cMper+6A8Husj/gZbNBUnPkY4SFrIQ JUekYgtfFfYRJodhld1du/Z4bVvTNAThPXv3QqU1o3cT+1SjsljQiGqNCX0hdaNHM+dDDCJh/hDZ uQj/bY6MlWI4L9q4sWPTmZyFTFqkV6Xkc7Kl3P0hva5PRCRdQXZYYjsTagaSTwYCVDkTUVBVlecD ocHHcaLnseRMHAe6zNwkwjRzQUpLSsXRWKE3Z3zQ4YZIMq8//8KLXtn2NA2lIIz6wdk8PspYBw84 +ENP+ILg0ZaQgeB3lzGM8D7w6v4oEfjQr5+22GKaMlYVLWFFRYCU2Ib0WqX8HoHe6FRNLHrpM+2l yGyBUTU1tRBMJtQAkgcG4o78fcfP1W6QaqnDe6UMJA0wyKcD3f2MpqbDqe8bNWdv1ieIyFGRrwwF VqHKPlxD4Ni9ew+pspsLI610u7rgkksulrKOIHAEo67CJkButefRTuHOuOb6UKL4OkQgnRYLwY6R qV2PVVURWAbze6OE8xoJckwMKg+ETigkjvQCIQPJANbDKiqGYGvbQQ8ig4uBhGSjmxRfNCkCaVJV ev31gAa2A93PQtKVscJCeWOcyNDfo157y4DVr74GLc0tOTkH6NRuPNQIV191pdevXA04QJg8KDLM Iu/qugDz5ycrbT9z5vQgeEsAIszvpM5CxK+3nj6d2jlxq0Lnm2VEkbmyfg/nTvaxkpDroLCvWCBh aQDJMQPxQMSyM11mhU9bpJexo3rsDBC3J7ppUiXeI+cS5gwM4hjKIFjQrrGpKbV9Yk0s5Rs2BflK NJUUbf722ndJaG/ahol9xdbAvnXrdpg4YYLEES0vcaLKQI4dP544mRDfLw/TNUKkrLgsRHwuT6dY y6xDIFfG8kfGyAdRkrAM5jklZbWQbHTx5HZ0RfcoRsIaEjLWYGAg4DKQjvb23RcsABEUK4PSor4A A8kCDJVYCAOrBL/Mge7a3r17nd4j6TnSsflTPK056nbxQYdX9DENmzhhPGzdtgMqKisk4CFypkdg IIKBPw5rQse/qCikCssI+jSisRB2X2k50k8zTCas4kGuGEb4RInxmVEg0tmdkU5QnZe0Ez3fDITK Ru8j/Vd87w0uJS6ImKx05XxW2GwjYQRWnAq8KobJhFdcvpQ8pjbr6+gUDjpJdOU48pVoxoy+kFyE 9eJgjD1gupx9i8AjDDTCQnjRkuSA0AyE7W6oErardg2qvc6VsVJgIYe9pmbRR/y07luV65bORmcZ SFd3Rjgm4ZLpPQUzZ80eC0MsmXDAMxCahbS2te5s76vzohtMrozV7chYLu9I7khPd4oTD4hQukKf RZqhvOhIVylpEotNJZSv3Ndch3ouZCyMbFq3fiPDlPjFEUWgEWbz5s2Bs2dtAEmaC6JeD0s9Byfs +EeZhMQ1jAhc5zRuy+0tGN+RbjjvM7z3+xlIS2uRcEzCpShzDsrLyktB+0DyzkA8JepCV1dbL11Q kXOmspFXkPWB+AosBvwrg8IwEmv8hPGp7hPBiBd/LxpJojXJii5fifa/ecvWnBzTipEjpdnZKoUW aeDhRWmNHGlX0t2+Y2diP4gsbFedhRiRWYbs+6TFDk9JHPL59DXKLmgaRAKNpVTGOrucyTDQPpC8 MxC7pHtnR2uvWSzs2EJm1V4ob7akuy83JEqhtZRDeJPeCNgfPc3WtjHvo8SyXlS6dvDgobywQhHr UAnn5QEOvmaHYBuw7739dhvkHFDZuCwkqaSDlmYoby4uVCPNsPsAA8m2sm5rl9fDKu5rhKlTpk3k gcdgzkYfVAzkmaeXb+8w62QEBCqpgop+8PAISJadDDI7SXqZpwcgKF9hAleu/R9x5St3v9ddew1p UZu2YQSW92sMlfIgfMCQ9QM5c+YsYTrv7dsP71kgkogxOX1BAJJl/Ic506MwyTQYyJEjR6nJFXMO +nlsFXcmpHIK8Ty3D1MZ69yCiiwL0QwkxwwELZuNLiAgJvUCT75KEzTSotUqEViulTn+irT9IGnP TtNmJ5hQiI2Z0rZOUinXkLAQ/qAbFtJLW6PFQEaSLHIDikuSSVgL5s+T5GmEnwPV85NvqWjduvU5 uSdjczvR7ze8bJBAa1swQMpACsw2GGHrmdoH0l8MhMhY3aVH7ZNiQF+ff8F1U+ovZPM+mMq82XVm okGvvwzrOKFt3rwlL8CeXOYyktzGniH72L17b+q/EYscigbMsKgsVQayf/9+mDDezrdJo7R72HeK wzLUmUvQkobyIvs4evRoIjUvl/ewLwqLqn1FS1jua4eOFwvzQAr6zsDw4cNHAj8PREtYOWYgbjZ6 7/kLw4/aJ0UCSj62YTKdCQcv2qP/Y7w1GL399jup7XP6tGlKaJCYYcUAIPq9uZCw3ByNipEjBQDI H6ijlHTHLPR9+w8oO1rTOKaqDvC4AEMPqkklLATYgW60ZMUdn4xsgUtZvyLHtITVjwzExHImsv1V ESc6jSRUnxBv5cC/YHny1ikLQEpLywblhRbMmI421WzIgSPdrVM1ffo0wUBqcGehUc1znqc+U44O AkbKiaNHjyZzorthwCSpNYI8lTSQBSLnaxmBToS+qrzWv7b2Avn1VtFdA0OsnMlg8oEQFnLu3Nl1 582JAjACqCzvzYIPDRp5yAVJuwovz1C+akqxnElVBB9IwMmeR60cI7Ha2tIt8e4CCP6cYIit2gCj eO36gSSmjawYmXOAEU5iRNdPZWWi3+RmoVdVVcFANX8yoStbQaA3OutIZ/0gRcP6ipwxd8g0lhos DARcCcs6WSZ9UvqoJeBcN1kJi5W3mAsE+jHOXNEQPFJ1ovfjjRtW2p027MfDZmInNRc08BHBRJQT ouowlwFMGoZSmxuJlbtrNNp+K6uSAci+fbaENXbsWBjI5ksm9NXEokAE5O0mDOi0JgEV5aAz0fPO QDyHRm9vb9sFqJClgsCYqu5szStWwjJNGOyWahVdEbuIDQbxBqIwQ/DItnVNG5QPBxo+RYlmUmEf aQ34daNrlViGkcMaZ2kZOtCRgSD7wGq8qYfypp0LQjvRKenKPd/H2wq5qoi7FPYdh2lTp4+BIVTO ZFAwELo3+qlTJ3dcoCvyCuphZRmHSVOPQQ8eeKHecMOyVFnIQJr9iUqVpxvBpA58MiAIYxfs6ydO JK9jNnr06NR+M/Qz437jjTXk8b77Pgrbt+8Y2OyDBQz3mqHCeLEeVp9AFaHa27HZ6NoHkmsGQrEQ 08hkfJ0JWcUKl+LCviznMLPBVzLW0n+yTf+zkNLSEng/mlubSpV9iJMN5QzEfY4gmBQIJ0wYn252 dUIbM6Y+1vvQeb59xw4yecHnaU6Icj3D8drbgkGVxTKgqydkOO05Zf3ecfWgfSD9x0A2b9qwo9Os k4XJwZjqbqqUiUtFfAWz8l4Py0jxGkm7nEkuJDE+WKZfWiOJtZ05qzhTVwOSuNtFsej1tOI70vny ln9/UyZPjrW/9evXE+C4+pqrUkskzM997AcP16mO/51oK5ImExYa5/D8lYC/M6Gzy8FZzmQwMRCC BDt37mjthWKQBVzTpUzcsu6+YOBBbmkDiLCgojHwgwrSYCAqfht5Myc1EHJLmySTsGoHzPEbU18P U6bEA5A31rxJmO/YMWOIfDXQr7Fszke2Eq/3SEViMVCDmgmzkBeGcViIZiD5YCC49PQOOyfbZ+Xw 3iADyXpD4mHIAJINOjrac36zvB/s+LETXrXc+KyKPxESHc+uCxcSf+8JKVdljmuLFy8kLXvjgMfp 062wZMkSzw8yuBgIBH0ibu2z88PATXRmpfPC3kYYM3bseAh2Jhy0Nuh8IAggZ7qq9vDKBfQ5C+aC eA5006QULHXZyhjAs2+MGkrXiT5mwF+okyZNTH2f2Gp2/rw5ic+7KjuZOnVKKt87WwRSLlPl+tqt j+H/wLIlv/vds1BVVQnXXH0lrFu/IfmIDsFQ/JxNrOh6WM7BpvNB2joKmAkyN7S3AIaIH2RQMhBw OhOKfCCmSTnQvXRCphvhII/IWrVqNbyfrLKiItX9vfnWWqitrSEgkrrMIbBrr7mKONGTyliYOd/f hswjjv/DTRxcsuRieMYCksHIov2hvIyERSaxIGx6N7K0ZwQMoXpYg80Hgtbb3d19uBt7owucVZPr LlAMBHwMxHOgD/IBde/e91LbV66c6Gka3bs8DTvTdgbmzZtrPZ7N2284e/YsTLNYyMiRIxLtB/0g FZGz0tO1KZMnxXofylfIeKdNnTqgQ3flioRBdYOhy7sb0HSySMpAhpf2jtAMpH8YCLgM5EJX15Fu kA8oIgYyVJIJc+0HGXgMJL0BE6vwbrMGL5Sv0mQgYZF9TYft3t9JGYg7g+9Pu+uuD0d+zxoLPI4e OQof+9g98PgTT+Z8XMkFmzEYBgJ0AIYRBA2B8ephDUobjD4Q03AkrOBFk11ITSwRA1G42Qd6w6k0 /SBV1VUD/kKtSFHC+u3TvycyEC8nwz3vUc4/b1vZ+8+cTQ4gC+bPpUJ6Tea75/YaRukqqvMcfR8r V74Cn/nMp4kPBJ3ouQCMXGoLfh+IwTAQe83ZDnljqWG9x2DmrNljNAPJMwOh/SAtLc1rO2CiyEFl z1jLe/wMhC6uGGdwGIB4sndvOj0ysB4WLWMNRPCsTEnCQvaB4buEfRw7kXjAEl3HvG3dsOHx45Jn /iN4IIj0h11//XWR3/P73z8HY8aOgR07dsD+/QdSHED6Y9JLURFfb3SwAKRAcs1Y25hdUGYZaB9I fhkIm41uchxUPueVyclENyGx/2MgDa45j8SKMRvPhS1cuCA1BoJZ5+iDQAayfsNG8M8nwhkpfSyi HheUrtIsyTJ//ry8nwv0fUyO6P9Yv34jqXs1b+4c4gMZjIyfGbX4FXmdxW14xza9M0keSBe2ZCgF viNdA0g+GEhHR3tbN4yUMpA6UlCRDuWlstHN/slGH8hWWlKak3PrHxxMiEgAiWEIb1odCRFA5s+b Sx7ZEiaqg5oqiNDXFz5iOXdsMJUWiKAz/eqrrlCaorPyVvRzaUde3XbbrZGlqyeffAruvPMOWLny ZQ6zHzz3n78roQ0kvjBe6/nJs4W+PBD2TBT0Hof6+vo6CNbDgsGYjT7YGAg5D888vXx7jyGfkZYU mn5Huuf76J+EdDNwIyf/BmlmpI8dNzDLaZc4fcTr6pMXEcSB+1BjI8ybP5eE8aYFHCGBH+Q5sh47 hPdMjHIkYrvKApCJEyfk5Vx8/g/uB3vsUwePn/z0ZxZ43E4c6B0Juxf29zjlYyAMmLhl3S/0ZPzK CDN3ddviMexj0HYmHJQMhCwmOHSRv5CCiu77fC1tnYisQco8ks4kRYZhlQPj9/l/56xZM6GttS2V PJAVK17wAMllH8HjaUrBJKqE5W4zftw47zkGQKRpN96wLBIoRb32Z8+eBXfd9aFI4LFhw0b40b/+ ByxZsphIWLH7ng+ge47CD38YL/PvwoWMcJZqdp+GmpraGi1h9Q8D8dwdZy9U7JXdB3VVPV7wbtaJ PmSquqdubkvRuB6isIE4HvsogaWXXQLFJcmrBW/btgNajh2Hj3z4Q7Ddeh42iKpG6CmGn8OIhLkf cilrNHzyE/cSP1G0CKxweWvZddfCJz5+LyxetFD5+zz51HKyYOY9OsxVwcMEQRRZEt0N0o1KMzzJ KhvGazCPJ84O8x1hehlmnIPCokK6oCJd0l1LWDlmIOAwkN4es/gMAEirX9J6lZ+BgI+F5CMEcDCB SP/N8PzHf+FFCwh4zJo1I7F0hSUzPn7fx8jfa958S8p+QEFuVPWfsduhDyRq/S1VEEGJKa2mW8j4 PvfZz8CyZdeGbnvgQAPs3LkLOjs74eGHHyXsA80Gj+Yhd594VXgpMKGTCUU19ygBxGAAZNCykGED S1tUmjIRBtLX23u2Z1ixddT5DskKkgciYiCmb1bCfgfeOtWBEN/HPpIPzcGlcepUulV558+b57UY FQ2w9s8x7RvHWZH0eHEHsMoKuPbaq6HTGvyTyldvrHmLyDwoX/326WeE5yt4qRmh3zXKrBZLpxw/ fhyKi4sSZ6PzDGUsBJE9e9+D119fAy0tLaEMI8j6iuHypZfB0qWXKuV6tLZm8zm+/48/JCAyVI1u S+AREIOOxrKB5Gx7AZhVYh4+prprDPhLug/aUN5+B5AoNyAtY7V3tO++UFK3rMQ8JAQQX4l3YL1Z 6cgsuTomfgByBmp34HYs7bLu+WEg9sDsgpHIrrv2GjKAlSSUr7DkC+Z+IIC88spq8lwGEP7vZTp/ G75rNQ5YovM8X9LpzBnTybJl6zY4dPAQ7N6zVzqwI1hPmjSJ+JtmW4uq4T6ffe55i33sDAAUKz+Z kDAKLKUgFE9lMOPtzzCoUu7gL+DoPp7tLBCOLF5riaAPZFA60QcbA/EkrIzh5IKY8osly0AoWulV 5h2cM6FRo6odADmZ6n6xOxwmFaaZJSyf5fOtrq4OFi68KPFnHzt2DF5+ZRV84uP3wbZt22Hd+o2e BCFjFjwQoa/VOIxr+3Z7kJ0+bUrerpOLFswny02dXdByrAVamo+RQR+PrxfdVjc6MkgfaGiAzo5O eG7F8+ReunjxItiwcRO8X8xjHXQ5EyObTOhOkESW6T0D48aPrz7c1HQIBnky4aBiIGCXMQGHgRzu qRwpJRETay/A0dOFVFKhX8pKMpPpT7vnnrvh8OHD8NxzK1Lf9zXXXA3PPPP7IPuJJVNF1+5wNnzf vR9NBTweefRxuPvuD5Pnzz73AgUA7o0ulqlYELEHBTPARkQTIWEoMMVIcuELEclSkyZOJEsSQ/DZ uGkzYXIIOjdcv8w6X5Xw3z/7ebx7foAkqkZDD/+TrD8kK2MdPVUEi6cY4jui7wyMrq1DANE+kH5g IMQHcu7s2caeMRVyFmGa/p4g4K+JlUyIseWkODNs3gw9K1OFX0VlZaUwYwY6ltMHkEsuWQIvvrSS zDDjsw311qn08cP+2p+9/9OJZSu0p37zNNx4w/VQN3o0vPzyKglzCMpUYSASBTCCr7tlTc7mDUDi Gvo3ECCam1tg565dsHHjZrL+9ttuJZ0IEUg2bPRn8+cVDJjPZGWumLtTAja6tS3dpdBg9yX4IOu7 ZmAIlDMZbAwET5pXzsR+v/iYjyzvhSOn/Y50XlXeuIP/UDSsifXhD30QHnvsCdUTGIOhBP0gixYt hA/cenNi8Gix2MahQ40WwE6HBQvmEY0e5Stm+hgAOZZdiEEEfEAimwQFr23/3xgdho5vfNy2fSd5 ROd6hQUs2HWwzamdVZEnoGnFfBuLAeIjgkdzczNhHKdPt8Gc2bNIDSx8HYHkN8ufVkq4jDIh4wLR AGQnRlar8sXfuuvPoQ9EJmH1HIexY8fVbdq4gW1tO+hs0DKQXz/6q7cv+usvwgh4UwwgZX1UPSyT y0DyOWNKi7Wgtbe356yPx7x586wLfA03fj8QiRWRZfB+76KFF8FHPvzBxN97z569JBeipLgEFlw9 n4DH1q3bfJ/JBwe+REVv58oVQSAwQq4h/2sIGAgSbRYDaWw8TEJeDzU2kfVYmsTdV0lxERSXFMOE 8RPgTMVIaGtrI3ks+Hg3VUq9re0MWTcafRkKyYQHDx4ipWEwQqvYOk5ukcqGgwehs7MLVr/6Gmza ZDMN3O7yy5cS8EAgWbXqVa8hlNJ9k5IDPebMNCfMKHDNGzQlsR/OdYR0qTXJxKEEgk50rGZimINI 0xuMDMQDESWsobLRWQZiRh34HH1pIDAW9IFcf/2yHLGQEvjSl/4H/PjHPyFF8HiDryIxAZkfBAvz YV/tRRGS1ESGg6gdtVUMM2ZOh5/97CE4c6aN+d5BoAiyIlPoLA8CCUCUSD58f5c1SD/0y0dh+vSp xLGOBQbvu/cewj5Mh20gkJDfZDGQvXv3wbG971msqomwK6x9heVYcGN8T0vLMVLK5Jj16Br6KhB8 MIO/tc1mMSjluY7zzVu2ElmqxVoQOEj7AwtIcMHffPnll8HlS5cSBrJz525YvvwZwe/MzziXizJA Uccn9lrw+oJQ9bDoUF5TOv3thKIiLoAMOhYyaBkIYGdCs/yc9TicM/EgVlvRQwXsOv9MEJbdHkgm C+V1mcdS6ybPnZRVAg888FX453/+kQ0iRjS2ITMc6FEOueLydL4/zpxxIHUr9j788K8JoAQH+yBQ qDrLeUDC3z93IuyZW4MLgeHej91NnOnYnyQbZmsSNoISFiYHTrQeL1mymLxyjMhzTUSiQ8DAHJmD BxuZQTWsN4hJgGLmzJkkbPfa666Beou94DFEMEHQ2LVrD7xlfU/V2yPKLL8/HehJQ3i9fVjnvNY6 N0TOsxikQTERt0/6qTPDoHpEj1DCGjVqVC0MgcZSg9YHgiDSfqF0j2mAsDUbFlQEpqx7Ni2dP8Ng ZaakA38ukgnHjx8Pzz33PNx+e3XOzw+CyLp16+Glla948oWIbsiOGc5+58yZQxgHNiSiE9CSMo9W a5k4caI1sB6Chx9ZQQZDVqbyf7cwEAFu6C5vwhPl8iXSVZtdTPEjH76TMIwVK14MzOaRWSDA4PKG 8wFuG1t8RKkKgx3Qrr4KCANBAHWr/LoDJUZd4bFA2QpZBwIFZvXjq8iEkIXs3rWb+LtcAOPfj+oD bhzfRawKEDEd6NbATSZHuDlOxPbs2WPfUxZQo1yIldYnWPcXhsifOHHCAvIJsHHjJme/JvT19UGv tTQfbbZb8jI9QWw2Yh1fp6iicEJhX0a8XBADALSElQcG0gc2mAhv6KJhfb4s9GzuByVtQf9LUlEi sVz2gU7ifBkOVrjgDYPlKY4cPWrdQEdJdVWRHwQjqqqqKmHKlCkwpr6e/E07yDG6J6nhoIlJcghO L730MpUkaChUGAiCiJ9R8KOuVJznokEVo65QrsJBHYs5vrLq1QB4cJPxrNeRfeCCfh7ezB/BBTP2 6cH4NXON9zoCxO7du+HV115nanlFA4io8lUU/0dSBzoWrCyhwMGebI2DzZu3kL/xnpkxcwbsdY5h Y2MjYWLu5yFoNG5qhJfb273vYZpvZp+7ANLTC93d3cxABtkuhdZ10dUtzwUZWQY1HAYCg42FDGof SAdmo5eNXjKs7xh329rKHn8dLA9E6NssPtin6RRXtZkz7bpQ1dXVeT9X8+bNJYtr6GTvcMJ9sSFV GuG3cqmqk3wGMg7sD/LOO++S49/m+Dqy14eYYchAhGYs/mvDEEhZ0a4dBI0f/+RnwkFYBB68z2MH W2RiuLDbyNmCivQWFp4cX75SvcfGjRtrnfdS8ld1VbV17Vd59wA2BkNwWLv2Hdj73nvkMxBI0LDq 8Z4975GPQ+DdjWzjWb6EFSWElx7lsznodIY6wKlzw/4fe18aHMd15/fvwX0PCIAkJFIERR2WbcmQ j92VfAhaJ9mKU7YkZ49UpWKDyQc7n0xXJbXZ5IPIfI9Jf/cuKVcqtVvrFMn1ZmuPeAn5kuV4RUqy RFEWBfAGiGtwDo6Z7vT/9evp16+v18cMZoD/T2rOoKenp4/X7/d+/+vB4aFN7zf4bjtatlp9CKTh zFiNqEAqBKKX9WUd2iIboGG4ctIFNWJEPmTVsMOmIZ3HHn3UfDBuV4hkJzE8PFyT38GwUowaQgK5 cfOmOaJ823l0NU1SDhBppopHIv5EkkSBhI3e05BH1P78zFBxzVOxzFcKQDOS3X7wmTj28LHK+0eO HavUecNZN3Gumg8+uG4uH7AtfmO+x8NeWPhlpZyPaMJ6y1Qccckt9eC24lAHJy/EiGwfckFF8oFU W4GAlY3OeKBcLi/p0B4hFctQ3GoRIncFkxbEmxu91pFYMsmgHEfieO0Xr8Mf/P6/ht0IJIv33rsG 0yZhXLv2Pivs15fvYzZ7NL84s/n5E4QfOYidahwS8RJTnPBdNZOPZ9Y6RfLw22+Y4zyZ+khmvnr4 6EjFjNmOpiRzcyztjkAFiWrVLtp5/UPrFQljYcHysf34xz+1pmu2E4FlAktADEEO9DR9lGb7PAQH ur2sFcNzQbSt2/D00586evnyP90kBbJDCmR+fu7q9r790Fb+jUciVgikAwlEVhzuirxKxJEBAaRx pKNM//rX/h288v3/ybK1dwtss5RDIAX427+zHMsvvvgV9vmrr/6EEUvlQY2oniyTgzvTPJpExN8I jrhKYfo0ojqpaPIIm+gqqNMLmrMlWF1Yf1shvvnK5/34d38/W9fPfVl4D5Ew8H5hePJiYREeMP/G yaTWTTJAoqhUenaZjtInEKbJQI/9HUPFrmUlEyoct5yNTgRSAwViR2LpKtnohquheueWFEN6sy7r nug7Po70Z575HRYN8p3vnIE/+MPfZ1FYu4E47k1PM3MeOuPfu3qNKY98fx+Mjj7FHM0XL/7Q5+n0 5nVEK4zg7HIviQAE+zyCyCQZaYQRhxp5GMoKJYgcDh44wHJGkAwwSuvgwYPW+oMHGCnY9wk3x1c7 Wgsj8jCggm1T3IAFFqFnwOLCok/Hnix8N1H+R4IZO+P6P5zvaN4f4lFYoEUMMcpL6M/pB/KB7JwC mZm+d6v8yIHQB/XQ4BZMFzrAKYlluCed8lMMMbKss1QsIjC5rrOjk3VU6ADESJJvfvMbdeH7iIPv /elZpio++sRHWOezaCqJDRZCOs3NHUdh5OgRODh8gC0YWjo5eUPI4wguPxJmyvIjmjAScf9WOJHE 7aDSEEcS8sB12LFblXbbKpNMjRw54goewb8ReM2RvBkxmPcK1R6GruLrh5OT0m/7KwbPMStEX9Ui Qz1r/6b7+huBImSm0BJ+bqVl6Ms/2gdeH0hDZaM3qgJhX52Y+Meb/+zz3wA9yp4rVON154KkTyZM kjcifwfNU48//jiL50elgbHq/+M734HiehE6Ozvhi1/8XbZUq3RJEIrc9ICJhPfMpb+/3zoG8zQf GB5m7zc2iiwSC23c+LmtLjDUF8nhX33pX7LZ6jC8Es0dLHzX/D4r1mi+TplkgTH1V9973zW692aD u+tnqeZ1uL/vzu+Q/Rzee5jOeR7d1o3QbYL8IwcODLFyLdhebHzmM59mZIHkjK8YqYZhvbaJEHNB pqZuVO4P+pj+/J47/8P9e4byc6pcSDKL7QLyP1SUDCTwe4i/41lniLShuVgEn2896jS8MxOSAqml AgGfciZyG0EnuhiJZZOIAYZnZKd8LBk60j/72Wfh+PFx5jDGpKYf/ehHsG4SxzPPPAOPP/ZYJmU+ /IBOyzt37prkcJe9OpnQGhx75GFGGh9e/xCKJkFoQsQTksanPv0pRhC4HokBy3HY5GHbw/vz/fDu u1fZdKf4GRLGG5OXmRq5d2/GXRZC00LMVD4XPmSbtFFX/oojjfNczYhu79MmBcxCx9wOLEGCpIDv 7VIkiAJXaHa5kh/+8P8wpfHetd+wiDXcFhdxbhcx5yPcNBS1PsJ8BMnnmw8yX2U5EE1fEkWY0VS+ p5oT0ru2kYOudt3/lm/PwsDgM0PgTSYkAqmBArG/pK9sDb7RZwRno/d0lF0TEBquSdLV5rZOEnKr mpH+la98Gc6ePcfeP/vss6bS+CIr1x4HGMqIhIDhvagabt+5w8Ie8f3AvgF46qknrfcD+5hDEwkD DwWVA/4Whk3iQWF8vZ1fguteeOHLbIIpGx+aagS/gyGYGJePrz/92c+ZoxQVCOaFWOpjmpGH3RF7 Q22j6lG5VYZfTaogM1UaEpHViP8gx6+t+LeJhx5yfFVY48outdLb18sIgakJkyAwM90uiojlSfAV o86QON5669eVbHvbrBdktnrv2vuVY8T7wCKZItSM93ND+RmNfm7UzVfq5fCjfzBWbkocm6Qr+Mau sWe45IQw6S3Mr3ZCZ9uq/770TWhtbW0D79S2DZWN3vgKxCcb3bexyiVNFOcEqXa4Lpqr0Gz17LPP MHNVFJAkbpkL+kRwsSazkTpoodN+8NADLNkKSUQGEgnrZPj37pp/f3D9euUBKP66aJLBXedvkzxw t2JtLHt2NviR8+BIbOHT8csmp6hZAYNNWUEKJQ6JiO3QL3zXj0xE81EbKy3ySUYG9t82GDEsL1UI AoGZ0EgUm2ymwPsKHbxqPkgQAUCI38RQiAoLVh9BU9cGfh71zGVsvspyQOtKPBQSkkWruCGMJzZL 2A7WAk+ptVlvCzBhNYwKaWgfCBKIiWU91wc5fcl328HeUoU8xJkJXXOCSI07riM9SXKg/R0sp4BF 7X7+89cYgRSLWKa9kxEKmrQwexlJAx3pWGpB07wd9FNPPWWSkJN9+9bbb1eO4a233oa3zVEswtq/ QxiaJiXjifMc+CToiWQV1tn73d8oc1QcM5WKP0SdRNyKCOtM7edOZ8QRkyhQOVQUAy88aJOBTRBY 4NAucohl1zFfJWwe8rD+Mih/Iw55BIXsqpCEdxsj9nOroj5qYb5KUkAxyP+BC5YyMQzdfHUUiBiO LIrS5tYec7uFwN/p6ywNSCashjNjNaoCAVuBFNfXr5U6ep9vMZZ9G25rs6M8QJgb3UUcsHP1sLDT QT8IEgnWKsJO/vbtN+HcK9+3CJAplEMslNe+XjhfA/omHnv0MZhfWGCkg7PDITmIKkSGaNIIffI1 LXp2wYACihXilb4YtD9/0lUxZamRCCqFDoxIOmhF6x05cpj5DbDjxwTFPDcroWqwyQFrTtnFCVEh 3Lh5q3K8eJ/SDZhUOkG1qKwk5BHsCI72EQRGXimqj6BrEb1ddcxXcQa5hi6SiMFIhBGJWNnbZdIC aO9BlXojavfkRK+1AgEnG123XoMLlxngFFX0KBC5TlYcP4iCI13FD/Lnf/4XrJObm5tnoZMWCWgV nwiqDlze5OUZRAXy2vwvXA5uVYUUNPhXUV1B5xulQvyPT8UpHjxz4MGD+5kvBvMX0JmPOQ12UqIV wuquzYXksLm5wUxHTDmYRILRScvme9HHIB6TyqAi+Lzjtn/1qCwVE1fUZ35RVyqqJHoEn/xZD1Qn VTBfqeR/iMrDWspsKZe5CuGKRDZroRWhvWUbjFJIu3EIpGGTCRtZgTAVUlgqXC11DplX/1Zgex/q LcH95VZBgRhii9xRbxXOLHjy5H/3mJMQP3/tNVd3FjQ/SFCnH6WqokxunjIh8m9lrEIQmPWMEVx5 nu3MRnLtbSwEGAnBTnCzCGGD5SpscHMRhqYikBQ8jymAq+S5fLppwndjJzPHDOcNH1mH+UeCPsvw 92OqD1XnuWqkVBLzVaTaEBbdsIgDFYheRuKwyaMskAr/XPje4OAg6NuF0ITCpbWmRU4Y5AOpsQKp zAuytbm5ZGjtoTELbkeX25FuhHWsMXI80vhBsrqOrs45QBIolVUJkxMJVAiWdcdQXjzXow+PVM4Z VQOWesfPxfLudu4CJhviekx0wyxoVA5ovkO1UCiIisEhCpfPxnUwblURFHWVJHxXfU70+CP7uKoj zGwV17wV6TjPUn0oOM+zMl8501tLFboN2ddhEYihW2qDkUdJIBF8tUmEb2d//9Dhw2ZD/jHoLcHH sbWd2+KkQZnoO6BArJLuG8WCrrWFtjUM5Z1ZMrz5IACuhMJgh69a553EBBa6P4X5QaKIKCq73mNm C9zOX4Vg548lth8+dpQVyetot0KQxWqrIjAvAXNBsHwJJhBOTk3B1au8XAa/9vfM9fgq5qaInb1/ Dok3OivMuR5FJOFkAh7TWwyDiVLnGlb3qprkEUeVpFUfQYohUpWAmiNcVCCeCCr7+z7k4SIQpjSM itkKyaNUKpmvJfZeZ4ujRJBIMBS+pbkFOpsWg/u91iGYm5tdFEhDVB+kQGqlQP7q4vl3PvPkNyAs t4nlgoBTyVP0hcgzFGZFAnHIRXX7oGluQ0dmMckQEwUffPBBdlrt7P0DjDCwbI+YE3Ls2MOVnJAP WUVVjRPEIiOJDyc/ZKqjwBPZiqZ6wDwRTQsrw64FkINEYoHzlquQCCgRSTiZqAyLk7V7VeJITx4Q sl1wtFeYwzuu+lBynvvkaxlCDoZ7ojiRIMTqvd6IqUp9roqpyqj4Mmzfhm6bsDhBMMLQuQrRuRLR rYURiblNU64JPjE6CuXlX5vvy4HDCK3tkKms7y01GmHsOh8IX6TMUB8TlmF4SpqIjnTVZMJERBPD 9BU2ftWUf9fdESIp4IKJhJhYiCMk/BxfcengRGEDHfmstLZdcsTEnbt34f9dv84IAokDS5u47p8v MUx68kLCkgLlz/2TBJORiJ9akTuyICLx6wSTqFRVC07YtLLhZq445GFE+kZUTFeq1XSjtnM6drdS cJL3rPXYobs/N1y5LK79+OVtiBPKGUbF7KTb7/msg5ZPQ+fqQ3CgowqxyYOZs0oVIsFtPvbkk2yb Tv0qGCEFebX2Q3D58l/eArGyKxFI7RUItqktveNeJ8Bw0IM5vG8bLn8oJRS6KvPGN/2k8WkkMWOF KQYM80XgXM52MiLOHbLPJAt8tYHZ6hj2q4GVhX7nzh22DifoceY00FgyodzxB+WFRBGtn0PdL3nP L8EwCxKRzVNBaiSISJz2lk27DRutRxFHbcjDiCY0BdOVEVCy3fDLxxA6/QpR6LqLPGTTs6UW2IbO QNClMJzn2/UZEoFLmTg5HY4CcZOKm0R0bs6SFx0+/uRTcHB4GIozr0Jr82bwzc+1wc37TdOrq6sb fABcll5pTvRa+UDwom+Vu+6Z93o4bEu3/AWXAhFlsrJySBHOq0IwDz30EHR1dZoEcBg6u5wM9cdZ NV6NqQlUClg3C187OjtgYX6hUtYEw36RIOzez5UsKF97zetXkMkwMoLKE3Hlw3sBUVl+WisbEgFF NRLs0/CbF8SPUJIQRjgRxSeOOOTh/53gMFa3WcnwqAqXiUnXQ1SFTB66y6TkWnROAGKEEzidPVYr FJ/nijkKdOGZt0xSUCEdgxU5tMkEbEe58JuGuI7/NpIGvi+71IhFHq1tbfD005+Ent5eWJn5JfQ3 fxDaFnI9T8NvfnltmhPGNl9KAnkQgdRQgRisnEnAnCC4QXeH7n1QPBJYPetVlQRE0kBlgKSAX8VX WylgDoj9Hkua2O8xYQ3JAbPQMdQXa1jdvnUb3r/2PtuHVfdqw9Ob+ZY2AXVnehw/SlRYr6/j3bON HzGlIxE/c1V01JU74irKdJVUgMSNzFLJ3fDfzlDa3mn77k5e3EbXddcBGCCP7MH3WdK5Sci1Xz6y t4lBnKtHt3p2hyx0Z31FIYA7qc9VHFWXlYxISJJCETLJ/QnEUSS2OcuwlQj3i7S2tcLDxx6BIyMj jEgYeWhXwhuAqT7WtUeKP/vZmSlOGkgemwKJlIlAaucDYSpkdXXlV/2thz/VtO2fJdzToXumxHRH YqmZsYI62aHBQRgcGmKd0xNPPMG2xTjwoaFB9jm+x8UGZp8jKSBJsPdF8/3N2+yz27ct4vDkhVQU hE8UUmDIbrKQ3iCyUcnjiDRlhZBsUhIRO8c4asSfSILJJAvTlQppBPobEqgOv/lDvH4G3Zl4TXZG G/JzYhMAeDtm36gmvm/dEH5D3E53TFK64SEIV4cOumsdSA5xj6lLUCWG77Z6RYlUIrN0yzTGfC18 W1QYne2d7H1Xd7dVbbp/H/T09LDrsLa6CqXF12CgbTLybqP6+MeJn7zHyQLDeDc4gdgkQgRSIwUC tgnL7JiMyNqInoZkeEhEnJlwyCSE/ebS1d0FI0dGKrsZGTliqoSuClnYuHHjBiOFGzdvsterV6/C T34yz7Zb5/N6YKkStz9BMCF58hSiTWJxVVKWKkRWFyqmrCB/SLBTPYpEIBM1EmS28u/gtaoQRtiz EDYFrT95CAUSpYgkeZFH6W4fg7sTdm0r7k93Ol+XYgCrM3aUhrVf67HT3c+iH3m4EvocteAmKfez q7usCyCZvdxKqbOrC5qacubSzJ5z3B7JoY0lqhqQz/cH3itUHMuF+6CvX4de7X2TZDaj+6zWIZhZ f2jx8ht/fU8gj3W+bAgEohOB1MYHwl7Nm7lktPdalz8A+3pLsFJscb7JCefJJ5+Ez33+c/DCC1+B d955xyQIiyymTEKwjwzfr6+tM2L4m7/52wopIGmIJGCfj5+fQSxrrmQOCvAxBPrdAzLTM1MhAVnn cUxZQaQU7FSPIhGINGlFqRE/n0Y1w3ejlIN4efxnHzS8PgfDXZ7HSZA1pM8M7+jbkM08uk/nrAsF SQUykDp7kE0/AeYjl/owAqKkAhdd+k3393PNTdBlDvDwg7a2dlbjDH+zr89KVMW/5RI3ftja2mLK gr0vzkNb8yYjDdg2B4XGFjTrM7CvdUW9B821Qal7rHT+lR+8I5DHGl/WBQXSMOTR0ApE8IPoCwvz 7z7Y0+v/aPOVrc2Ga350+2F486034V1TLfzZn52FJrPxYYeRy+V8lYJYdyoJGQSZbgJrU6VwzGep QrIwZYX5Q/y+n4ZEgkxaYT6PWoTv+uVSGL6mJ2nOCQ9JiOt1ly8CxPUALp+CY++XiCJo9M/XgeQM 14Xt3QqG+wvACDZrWTuQVEEI4fClra2Vdfz4vre3j702NZlkYaoI3Ce+NjdHd2cYcILEwMigNA/N uRJsbaxCW27FUhab99k6RF/rivNFe3DalKyvahr4F/CDixNvz87eX+EEgqSBDLXMXzf4+jIRSG19 IIaWy+lRg0NWUNHXduuWtYmz0GNEY0URT5QpKa4KCTNFhZ2D5zgSmrJC/SEBTvU0JCKrkXAiCVYl KoQS+LdoGvV7lRzLjmKAijwWCUB89TiMdWF/ICXM6ZKZSHJG64bX3yDvx3F8Q6BqAW7C0n1Vg6ie dNd3sMYZIwOz8+/u7mKfdXd3M3IQCaJyrLr7vGxz0oZJDDiE39pcqZABUw5NW0xNtGlzlgIx/25t EsxNZYkU2rPv45A8/uHH71+99t7VWa401jhxFAQCKXK/iN4o86HvGgXy5pU33v3oyG8F1LXiJqye MtyZ95ZedicWqY3uk5BBJDmp5IQkVCGBJdT9iCamQ13FlOXcZ83rD8mcRMCjRoLMWvIgxu7UvL6H YD9GEGHIisHd+brNU7JDGEAeiTsOXV02/YgqALwmHS+ROL4NsXaTXJa80kEHOapFNVGJgrKICZVA X18P20ev+drc1MzWDw7sY7/TwWeztKJodSes1hBJzexl19ZgdWWF2XQ212ahJbfJimG2whw7rvJW AZq1dXYVu5vXnczvstS7te1Q55Zrg6ahL8M/TLx99bXXfnaH6xgkCmS4JU4gS5xQtjiBNFRCYaMr EPa0Xb36bsH46hfC67HJMengTjgKC+VNUlxR1XyVmBwy8oUEnVMgQRjgURayoxwM4b6qONUzIJEw 85SdBxA0eaVfyZCgRDrROV2RwIbsowiITvIjC9/3Xhu/Lpt5dMM3FDfUFAR6JTrJMUPp/s51KXIJ /+nv74WWlhYWynrgwKDliO7sgC5zwfdDgwM8Z8JRLbroZOfHU1hcYqoAqxzkyjNs/cb6ktkZLbM6 U/rmrEkGJchpZehoXmPnaGdCdYMwRmir344VM81L3c+VfnD+7982lce8YLZCxYGzTM3z12W+fqvR /B+7RoHgUjaaVg2hfVW6V7777nbdG9YnP+SQsmRJhBkrTYXe4CindL6QMFNW4LYhpizf74Q41eOQ iGNSkkfx0l3XpMq5lZJKRiBJiPu0L7N4coZrezliyfA6mQOWSv4DgK+pCaRSG3qIj0IuAipGK4VF XNkjf3v9A8ND7LWnuxO6uzvY7wzs64Pm1hZoNQkDicMW7e7jcf5eN8lgsbDE9rO6sghN+hJsb2/D 1vqMSQQlKK4tQZNhVU9GJdGS2wCxUG23eCvaoHGBqqP/Obhxv33uL1/53tX1tbVNSXkgaczxZZGv syOwGsp8tWt8IHjhN8v599sN7ZNBGyKBAEiJRp7sViNRVnpSn0aUM73aKiTKlMXWy2ojJCor0B8S YVaTScSAqKlw3QQQZWpyVRsAn4RScEc4ifPGGPJMli4zE3hMPOAJPdV9OnVvzSbDJ5w8yKEcrDic pLq+nk7o7eli6/YP5aEVycBchgby7HgGzVdUEy7HuEhY/P3S0iosLBRMxbANxdVpU4Fuw/LyikkQ c+yCrBSmoVnbsCZRaipUrrw9lG7lrz1NsKuBIbqY4zFdaC+8+sPXJk3VUeDGtC1OHkucNO7zZZab sNYaVX3sKgWC9onoKQe8pRTc5gB3LkgiM1aGzvSqqpAoh3oMX0fYNq6ieZLJyVEUfpangPk3BIcz iGUsfElD0B2yycmQnM5guJNMZdOUAd5tPDNceiOSPGYiSXlAAEF4cxisZXh/P7S1tbDl4P59bF1f b5e5dLNtjxw6wM1IDgHqotnKfLO5uW2qhWX2fm2tCKXiXfb54vwdyJmDYQxRL29YxTJz5sC4RVt1 D7KFW9XdDHsSSBjQ1MtMVdtNh0pTN+fmLk+8cY8Thy6QxzpXGWiywhnPpjmB2OarhnSe7yYfCHOb mXL5jtHU+ymtvOy7wcH+kqs+jth56FLce6QJJ5avQs2ZXm0VkqVDveLr0L2RVthJuYoXCqHPlefD mwcoSAkvycihruCbBOolCllRuHIoAjpvkNSIU/Yf3A5uFxFAoNkoWDk4v91uksGhYYsM+vu6YV9/ N7uOx0aG2bp8vgvyfd0WKeju6ZhFp/PK6jrM3F9g37k/c9vs6IuwahLE5uoM66OWCvNgbC+y3282 +zQNSoGdQrO2R4mh3SpMqpnkAM29Dlnk2mBrWystLFtsen9mZnWpUNi4fv1XhZs3//eKILzK4GSZ iz6PWU4e01yJLHHyYMmDjUgeu0GB2DdN39rcvGvgTQ8gkEqnF2KnRucg5oAol1hP8bkq8WShQqLC et0kApwEHB+SzgSe5vIzOP2/5lfBSXI+uKfgBcO7pW1ac0/yBVLoqxGiBgzXbJOGYLMSCaPSDiL8 YLJJy1v+wxttBVLWNBLBgLnguseOWWTQ0d7KyAK599DwALSbf+v8PETVYCsHXH93eg7uFTdhZaUI 6yumMjBKsLgwD9ub87C1ZRLDwm3zCluJCs3GQv0+7DtFCs0CGbRYZIALIwbs3U1SQHLA97cmbzI7 XKGwuLGweJ0Vm7t169Lq+tpayUcn28UP7Wkl7NpWG5wclrmfQzRd2b4PJKJNaLC8j93qAzHQnGWP X4M4qatdh82Su9PQKyWddVfxNEOLNmOpqojYpqaYiYWGZyDvk4shREeJKqEyutY07+PhIl75vjm+ BeuQ+XmB22FtiGWPNbfPwluHTDYZCT4RyU/lUhCyGhGnLQZZpbgVhRgiK5e9CIqQ+uij1twpHR0t cOTQIPvsoQcHGDl0dLSa7wcFn4IzhSov/sr+Xl5Zh8XCCvt7bm4WtjbmmWlpfg79DEWTLNZhfdmq j6YZ62xdEFr2KjFwZQCaQwaVdTjUn88xMlheXtpYWlpiZHBv+u5qsVgsFdfXSzdv3lgF/1Yvz9Fh SIsfcYj+Dps8CuA4ze2oqyVOHpWw3UZVHw2vQEQ/yMzM9OuDDx3+j/rm7cBtu9vLsLEiZ77a8wE4 df81yf6eVU5IWvOXL0FIJh45tNVtr7L/1FzPjOFLy3KHb4BD0JLpynUMIJmZgIePgsuR7XTsbrXg KfrH1+lyfoSvCcuZYdJjohKVjI/pqdPs+I+YJIBrR0xS6OqwSmB87HFrPpX9Az0wZC6G5Ix3Ksxa 6+7PLcGtO7OwsbEFs7PTYJTXGVksL1qFPu/cuQWabuUuaLrZxxjB9Xdye5EVBGVQUQuCaWm1qG2s rmsbthlpc2OztLFRLN29d52Rwfz86xtzs7MbPk07jBRENSETRNBrWVi2OSHYSYJinsciXwrgJAxu 7gby2C0+ECcbPXhaA8mGbScwiQrEmTQmh6N0bMtNOc8xZuVMDyIFUYUYUsKaSGyOL8L9o5WavS71 IVxv0DxmJkO0KolmJMN1BO5QWJc5yN3/eycTcpfZkMNqDQMk05ZkQhJLdhvSlKYeleH2Yxx6YAA6 TWWAfz3xyANs3eC+Htg/aJk0PvbYA+wy2eG/8rzr+C8qg/tzBbh5ewOWTDIozN9kn926fc/sBpZg Az+fuWmRAS4hZtQ9SQqSMsDpXGXTkm1G2tzcKN2/c3/VMSPdZmRw7b2/LvjYSFXUgioplCVy0KWl LL0vCyarLcFsZRPIMl9sxSEXTGzYWQh3pQIpFteXmA8kbHfNGM++WSEPFh3jmmmMzzZmdh5NzNTD fSKhxfUUfBD2aN4ImwDJZ9+a3OlHM2lgaXrRf1E5HHHE7p50SzQBuSKTRN+CxBxiwJU3SslwkYt8 /w2BDEQCcIXTCr6KRx4eZusGmJ+hh53QYSQLUzl0MjPSAK9ZZvFoTgPnb36t0cGMagHf375zD7Ty EmxulSpkcH92DjbX563jMZUEcOVAEJqootN5ueCYkT6cvF6w1MJclFqQHGqVUFeZACCAGPQIIvCb DbAsLfK6krTYymOTE8g6uIsk2iatLWEf0OjKYzcpEHY//uri+Xee/pNvclXgv1FvpwazC0LJBN2Z whIXrKljVdO1XnOgVaa/tAssqpKi5hOG6qrSa4sUyTkNfiRi+O3fIwa8Dmqf4/Am2MkRR+Dp0F0d u0cpSL8tVoUFqQ6SFA0lKh47Aimft1LKHji4z/IptLfBg8PWHO7odO4wCSInEANeU3ZrGElY6+/e m4c75oKJbPOzt1i00fz8EmwVp1k+w9zstEMGpXliAfmZjHA6i2akmE7nrMxIccihHEIOMjH4kYS8 riy9bksmrE3wzvFRklWH5hPSTgSygwrEHonoIek4GDf/wa3bQlloveLzQOWBr4xEKlagJshhJ8xV iF2FV/OZItYzx4dk+BFJJDhJLog3DMEs5Tc/hGAS8iS+SR21pFLkmkxe9SCrDceprRnuaU3dUVKO /+GAed3b21qt3IUDA+zc+k2i6O/rYR3+wyPDbF0up7mIgCmFnPV+e7tkdlJLUMDEtsVl0DdnGBks zE+b96gIK2vrsLZ027obpnpg/gWCvxlJdDoLZGE7nZkZ6ZZlRgpwOsc1I4WpBNmMJL8PMiFFEUI5 hBBKPqQgk0jUb+jSd7YlQhH3Zewm1bErfSB4Q9fL/b/pBHg0aMOO5lUYHByCxcUFwefhEIermqu5 NOXMbUzy0HKWKcufQIR/fc9FmM2NsYLAAJrgq/atYCukRrhs+xr4Z0eDa5Tv5gq/bdwKwx3KKpul 3ASCWc2Dg9YcC5jx3GeqB/zg8OEDjADyvagmeirXKmcrBv4eyQL/Kywts9wFVAvLi1j2osiS2zZY 7gL6Fsx1hhVmnzOWWSY0+RfEkxbIQDQjcdPSVrmttFDYruQueJ3Oc0mdzqrOZtGvYEQoBVVyKIW8 Bn0WRQTlCBOXH8EZAd+3P3dd0yBfKBHIzioQe2RTNnTjrqG1PWoOT3237czNwCOPPA+vv/4Ls6NC 8kDiQAWiV0xXrtF4k6lAUKE0aWxbTRNIxNUgtFD1YI/GNQBXnoPH2SEQjeA2qexDM3x8EIb0W4ak DiR14iIcSYngf91dnaysNm4zPLzfqllnqgcsfWHN1NjP1ETOvg45jb1n6gEckliYX4TZ2QVWI2m7 eN/s3EswP3cfmmCFkcVq4U4lkS0sd2HPhqiKZqRYTufrWTud/cxHRoTpKMjpHFcx+JFDKcZ+gpRL EDlEkaBsZvNbdqXS2BMKZHl5+VedbYeeM4rX/RVIyzo0b62bHeMwzMxMg8ZIQefqQ9gZm6zGMnPl kDR0a/hsd5pQMbHIBGJI78GTiOb1P4B3H4b81LvnbjcMf0e2izDEkh/m/0NDA+wvVA79/ZZy2Lev D9paWxlBDOzLV8igYkbKgUMU5rqN4iasrqzB2uoaFBbmoDW3CqVyCdaW51g9pKWlFdBK99n3m2DD XCh3wdPeuTLwy11wOZ2XvU7nkNwFVadzlBkpyK/gN9KW/y4FkEWYuagUQymUA/waYSSm+5Ce36t8 rcKUl3ztU/VppEDqQ4GwBnDjxtQvDz51DIz164Hbd5WvwJNPfQmKr6/DyorZ4Wllz/EYRo4tltkq Vxlp26PrCnVoTia2JlRAkTMsgkjELvUh+0lcUVKG5EsRnNvNLS3Q29vDVvf19bHiePi9oaFBtoPu ri5TTViFsJkJKacJhGCpBnxdKizB4mLBJIMyizpqMclgZXUVmnVrTvflRSyYV2Rn15JbYWpCBq5p 84qxvWdGUnQ6i2akGjmdDYVOV9XhXFZQB2HkIPoPgohJlRxUIrJAem/4EG8kMexGAkg9INrpC5CB AsEdYNHPPnPZ/1//5I//b27mTw+EfeHO5qeh/+CT8NOf/NgkkWWzI7VmP0PCqCxIHKzDzblUB4jK Q3xv+KTmCZ2/ZzpTkS2kltvd3VOZnrN/Xz/7jY7ODujs6GDHMjg4wH0JjjrQ2DFbB4XEgKrKHLEy FYGKoU1bYNutLC9Ae9Oa2YFtgrE9z0pt49KWWwWC1LDiOJ3vu53OlhnpalIzUhyns6HY6cY1IfmR QFwTUhQx+K1T8an4mo6SqIVGH0CTAskmCst+mEq3786eP9L70W8aa+8Gtp4DLZdhbq4DPvf5L8Ab //QrZs6yFEITD+s1mI/EUh25SietkpdhGG4CEU1M+f5+9qbdJAKclY2RRU8PtJhkgYSB7yv7twlC Mivh1J0ryyvs8+LqInS0rLHJeXLlRTYj29qKSRB8Eh5x3gW7R+oUX/dicaQop7NUMA+dzqIZqY6c znEVQxwTUknRfFQGdaez6is0EjGQAml8BWJ3hZhAMPTgg4ceH//aH/4FzHy/M+wLZb0J5oxnYWD4 CVaL6Np778HCwgIf2QtmK7D9HjKBWNeto6PTXKwZ2Xp6e00yaGFk0MNNSz09vRU1EYa1VUsBIBk0 GwVGBhsbRehsKjA1gdN34lzO+MtdrRSi6mlHPk7nwIJ5t8TchYWNlGohyukcJ3chjAx0iM5biIpI iqsUyhH+kKRO54ZUC0RAdUggGREQ9tA4pN9nLg987ev//j8d6f3gqzpXIWEkMrP5MejZ/wlGAuvr 6zB97x46MKFYtGz+6HTu7e1j5NGJZNFpKYd9+wYijw3JYHtri73H/XU2L1bIoK1pq7IO0YTTd7ZQ prPn/oY4nUUzUkync5hCAEjndI7Kco4ToqqS3NbwTmciACKQnVYgmALQbi4YXnTQXI78lz/+z99r mv9f+4JCekWsbvXARsuTkGs/DL19fZHbY8evIxHYZNC8yda1aivQnEPfQwE6ORl0NK8zNUEIMCNF FcybFXMX7nKn882dcjrHyXLWIThvIU5yW9T+VZ3ORsDf0OhmJCIgUiBpCch2pKMNA3umQ099YvQL L37pd/5beeYHyvvaKrfBymaP2Z/thy2jx1QfrbC1scrIANVEk1EwCcLqt7pbV6j1y/ciqmDeavvq 1uZWqQpO5ywK5lXL6RzHhBTH6ayau7CrnM5EAEQg1VAgGjdjYQYceqqHzeXo7/3el77620/lv1qe /3tq6RmYkSKdzrNVdTpDxEg6TcE81WznIBNSKYYaiVI1cSKRyIxEBEQKJCMCagIrFYGF85rLYXMZ GR//D994aKj4cSIR6brFmaXNx+lcIzNS3IJ5YQRRguj6SEmS2sJMSXH9CwDRTmcgYiACIALJVoGI ZiyMvmLOdHN5CJc/+jf/9o8eP2x8Yi+QyA7P0gaQTcG8uGUw4uQtxC2Yl8bpTGYkAimQBlEgmqBC bF/Ig5xEDj839ruff/Yzjz/TtPR3LUapwcJgUzqdU5iRkszSFuV0VslfKEH8bOckikHF6bzrchcI RACkQMJVCMbaYkTWAYFEHnj42CMf+edfHHtmf9f0oL5yGVQitGqiFkChYN59sWBe5rkLWc7SlqbE dlqncxYF80gtEIiA9qACsQkkx1VIFzdl2SSCPTSG+A587nNf+Phv/9YnP9ppfNCBGetZKxLlWdqW d9UsbSompLhqQYUcDKDcBQIRACmQDFUImrIwL6SHkwgSB/pEhjmh4Lqez3728488+uhjww8Nt+w3 Nm6DsWkuW7O+yiTWLG2N43SuxixtcUprRymcOE5nCDApAREDgQiIFIgqAdlFR5o5ifRywtjPiQSX Qb4Oy590dpl47LGPDB0cHu7dP7S/p62t3VN7RMHpHNeMtNtmaYuaeyEo9JaczgQiACKQulEgoinL LnHSzQljkBPJfv6+jxMMRm618qWJf1cDVwWsQFMSzdJGTmcCYU8S0G6ZDwR8Onl7kpuisM6euxht VOucVNa4qauTK5YWfl1yApHIHZqKKWmvz9JGpEAgAtjl2A0zEgbeW4lE7M4RqxtucOJA89MyVyLd nETaBCXSJKgQ2fwURQw0SxuBsNtNOCn7L1Ig9alA/EhEfL/FFQgSSIGbsXDp4iavNn5tbHOWvD+V HIY9O0sbgUAKZI8Q6C71gXh+Bhy/SAtXGO1ccXQJS6dAIKIpy49Awqqn0ixtBAJh1xPQbozCiiKS HFcWzZxI2jiZ2K+2M71FMGHJBBIUDkuztBEIRACkQHaZApFJBAQiEcnEVh2i+UpWIH7OcpqljUAg kALZ5QrEj0g0gSiaJOKQQ3nDfArkdCYQiABIgexyBRJGJiKhyOvljp+czgQCgRTIHlUgBAKBQAok BZrpBhIIBAIhCXJ0CQgEAoFABEIgEAgEIhACgUAgEIEQCAQCgQiEQCAQCAQiEAKBQCAQgRAIBAKB CIRAIBAIRCAEAoFAIAIhEAgEAoEIhEAgEAhEIAQCgUAgAiEQCAQCEQiBQCAQiEAIBAKBQCACIRAI BAIRCIFAIBCIQAgEAoFABEIgEAgEIhACgUAgEELQTJdAGWMRn0/QJYrECF+CMMUXuqcE6k/c237L XPL874K5nDKXKzt9EpphGHQr1RB1oTS6RJE4aS4vh3x+im9D95RA/YlDHqf5s1EQBlrnzeXbOz3I qQcFMlal/RbqgaEJBAIhBZA8nueEMcJVyBRfd8lcnt7rBHKpyvu/wpeL5nKB2iOBQGgQjPC+y1Ye qDbe5KRSgNqae+uWQKqNUb6M84v+XXM5I9wUAoFAqEfkpX5qnL+e4a873ofl9uANQRv8pLm8SO2T QCDUMVB9jAl/n+IqZFQYHJMC2SEiQZvicXM5R+2UQCDUKdD0fhYsh3mBq49R3n+9QgSyszjLX4lE CARCPeIkWD4PXF7l617gxHKGCGTncZrLwim6FAQCoQ6B6iMPjsmqbny4lInu+EUIBAKhXlHgA90J qKMAoHonELxYWoLlKFj+DdU8kHFwsjwJBAKBsIcVyBRYfo2nufxTwRg1BwKBQCACEXFGkURGqTkQ CASCOvaKEx1JBIuRjdTZcY1x4joSQWCoqG6AYwOtJkb5cT3H3/tdsyv8mDAq5ALsfACCinrMsrQN 5hC9AE6SqnyvrtTw2ozw43mOvx/dwfs1KrSZ5yLuxZv8uCYgmU0/H/HMhN1vv/sXpw7biLSPvM/1 3hvVL7CY4g4vYbiU4e+cjPitkymO01A8hry5jJvLeSM5Fs3lrLmMZHwf8LguJzymS/z71b4HfstZ xWs2msE9xXOcjHltzgf8diPcL5XlRX4PFlO0afz+WMzfHUvQd4yF3L+Tir95Kea5TQZc6yz6kx1f KAqrdiNkzDlZ5K9psuBxtDMOVjb9yYyObZIf12jK87tUY1PgWXDKO4SNRJ9PqT7y/NzOJlCxeK8v gxUunq/D+zWW4Psj/HywPZ+H9EEo4/xYzkP1gllO898YSXj/zye8XiP8Wl+uQwtIahCBuDuaauFb Ch1dErzMG2bSh+5kiocqqGO6VKVz3SnyGOXXeCzl8Z7I4FqfrtL9OpmgPZ+oQmdvk+1oFdrKiZT3 P23po9EqnRsRSI3wQsTnE1X87YtV3PcoJKtofBaqk/+S5/s+WcVzPllD5XE+ww47aSeS5987UaXr +TK/Z6qEUM0SGiO8PWdFTidSDGhGMybs/A6odCKQjEY2UU7qas4dUm1H2igfnWY5es+iU6oGiYwr EF8W5AEZdx4yweZjbF+LTmeck6UKbKd8tZCPcSxZPhfVJDL5fhKBNAjGwKl5FYRTVT6GQg1I5IRi Z3caamNiqsY5jyvcy6zIAxQ67UJC5TqqcB4i2Y/W0bNSCxViH0vadno6xXfjkLxsyYgyh++apOXd TCD2Qxo1isCO5lwNjudiSCeLBHacd3z28hLEn/f4ZYWH8kSMBwGPoR/cWf52cmbUCPQ4ZKvqak0e YdflOL8u/fz37OoHKtdFVMVRdvWToG57P5fyfonX+UXF3wu6Pqf4bz4vLadiDipeTvn8j6UYjKl+ d4q3h6P8ej8vtI3jsMNTzlYb9TAnuhFxc+KMdPrAie1WYfkCf8CmUh4nQPT82Xg8i/y3LvDzUu3o RnjnqdKow45jUkGlTMVo+Cf4Q573IY9zAR1ikjnRxxRl/9MxySNO4y/wDlrlukSdp3itj4bc88kY hDaV4n75netRhZG0HVl0AeLlPNj1506kuKeqbSLs2uO1uyEQ4hQ/tknFa4TtVaUi7osJFI0GjYA6 zwOpJi7HjM/PIm47bT6ASs7DiyF5AyrXJB/zmEalfITxjPNARhVzDMar2PaSXJdxxX2Pp7jXZxOc s+r1VMmLGElwXeJeo5MJ80DCrtloymNaTPAsj8bMlWmIPJC9SiCnEzT8erjheYVEtqAHblLhocin OK7LCp1OXAKpJnmotr3FFEmbJxQTDf065iTfy7IzW0xJDqpLVFLtpYwIZFExWVElOXOsitedEgnr HChTlxr02G3ZHIZPBEjoKNPVS5A8F8Y2BZ7M2IelEgVT7VklVc1DfjijYPJ60eccv6VwvY+nOKcr Ct/PQ22mfY5qzyMZPTfPK9yLEYgOWDiXwq+B1/27u6kz3YsEMsLtr+iPyCo7uJaYUHjwZajkwNST s88O49xp8rgC6SPJVCL8xnxIJQzfhfSJrxcU7vkLNbjXVyLOJQsCUQ2sGMvofkb5x6Zgl2Cvz0h4 gj+sL0F1I3dUGq3s+J8QRk9XJAWV9DeC8Eod3RM7Tj6q46jFfPZZjBYn+D0biVBbF4QOM+rcs5rK 9JWItjGWYJ92O5bPwyYKvyKHV6B60ynEiWT8hALpZtH5X4DqJYUSgeyAIrlcow7J/j0kra9HyOWX fToiu8prkt+MatD1gD5QS5o7V6N7dSHD/ZxQ7Lii7tUEZFd2B6/h2QgyH4noNG1T1wsQz+QlVqyt lhWgEJNso9rdqxkd10UikNoAG9i3E353jHdIKvZ/xGmhUVdrZJ0miW8M4uVxqI4io0wItVaEKhjn o+eJKh7LVIbX5U2FtqF6v17N+DwnIn4ziEDy/H59KyEB2OH241W8hxcybttXMrzmuwL1TiCFFBfb /t63eUN9OWKEZHfwz1fhPPABrWal0bTXuBGBI+enq3j8U3W6r0IdnKedpFvvNZ3i1qAbqXGbGIEG x15xouPIAf0cUZEnY5C9LRZJqxo1dfY6RqA6xSAboS1niRsJyKNRCgJOJGhTjTioIAKpEc5BtF37 6xl3cmcTNKwJ2OUlEDLCCahNqGk9IeuOuy+B8oszGCrsUHsuJFBrUwrPc5Z9AxFIAyIqsiZLBaJa NgIdfWiOsWsq2bWDxHpGtpO/AIQ0HdpOPOBZ7ivrc41DSCcVtz/HFT+23X6f9nyUf36miiPxJEqN CIQIJLWsHcmwgYwrNHK7CN+ViO3OgVPE70qGD9JYHd8rFcWYT6DyVO9fVp11VHhoIcb9eq7GBDIV Q51fEQY7FyL2eYG3+6OQXVhyo6g/mg+EEIkXFR7M5xMqikLMbQspj3WnyOM4X1SOf3wH7mFW+3kz xih4LENiiyo6WhCOZzRicGUXm0wy8q+XyhBREW5ZJVZ+HXYJ9momei0QNeo8BcnNUXE7kCjV9a06 u0c2eYgdUxROV+HeZnFdxhSO64r0PqpdnKjR+U3EUKppkuyO1Em7m8rgXtZyYEIEsgMYr9HvjMR4 OKstgS8qPBhjdXJ/RPIQr1WUmaMapqzRDB52lUixCZ/OOKrjH8mgfY7HaDf5lG0sy/ZcLag8k6dT /sZJ2CX+j71IICMKo66pGh1LUvWRhABVEqrSOqPxuC6n3EdYkT+VkhRjkH2Gb5rrMq44cpfvTVRp mSzI8rxC+zxXg/Y8UkcEMqXQxtKYS0frUO0TgcS4eSr5GBM1Op4kI/48JMt9wIf7uwoPctJ8lZPg JJalyXm5GHEOKhVoT2fcIeUTntO4Yid/MaANTii0n6QkopIEGLcOWFL/wOk66ye+W6U2lvbZIALZ Adh1es6CM3tamk4s7mgmygyR5GFLKn/PKIwSR/l1UiU3m3RertGDcgXUqqFWw5Q1GeO6nFA8hqmQ Ub7KeY7HaNf2/bqsMIL2qyFVUDiWuPf8JNSfP+CcwrOb59dRVe3u2mTieicQuzNKsizy5XwMyTkF 2RXQi6p/NBbDPDKq+OBHdQqnFDuZS/zYXgx5IM6GdKrVJJGTCmaGUch2bhJRiVwC/zk8RniHMhlj VP3tCCV8RrFtTEL4lMfi/VIZOftFvk0oXp+84rU8D/VbSUC1ZPtpfk3HfUg8z9dfgvotY5Qa9T4n eq0RNulM3DnRR0BtTuspLpsnpI7RLjYXt8rpBITX8zqfYNRnRwblY0p3Oy9A7PyTzIkeNJLOp7if WbQ9uzT5WILv4kAlKrrM7pRHa3S/bKUaRGyTCmrH9p1clK79iNCe4w6EtIAB2KUUz0EULiW8rxMQ HR6d9JzrDlTO3d15TWS4P9s8EfWwjEBt7cDHIb7jMqlPoVqzr03x+xV13dIWXCxEdAT5hJ3MFKj5 c+wQ5rjBCUnv17kIVXQKok1zdpXeRi9X/hInzLhEoNIeJqC+E3iVQYmE8Ua+cfFtyL70SCGD76vO 0JaWqM5Vcf9nINrcOJLSTPJSFY7bJgXV+zjF79dUle/XOQVSO1eldjNVh32C/Zxk/fxeqVK7IgLZ AUzxm3myQRphAbIpN2/v50IVz/lcDe6fSpZ6moKLE5Burni/ziMJedumwIkqXcdToD7HepaDD5tM p+q0f7iSMXlfqRIpEYHsAHGc4g/lhQZphNh5HK3Cw3s8wwZ9gR/jRI3uo2pob5pcjgsZdZpnUu7H JuYsVa1NTCcTHMdERs/FhTrvK65k1E9c2G3ksdcIZAKcqrdH+UNTqHEjTFK+ZIp3ktVqfOf49TiV guQm+PG9tAMPyAWofpZ6mvt3IeOO/0xG9+s4P6ckhGaTyPEEx1AQBm9XGqTvsAdbSYjTtnLsxLNR ddRDFNZYDdTGVA2OU7Vh2bkpWFXVjrTy2xc+XK8EPGRjEY09zYMpHttYyDW152ePUwNpBMKjeJLe K9Voo4kM7ql4/8Z8zsee/yLutanH+5XVMYjzn/uN5KOiliYS3PO0z0FUO7bngfc79qjzzbI/2fME QiAQCIQGBEVhEQgEAoEIhEAgEAhEIAQCgUAgAiEQCAQCEQiBQCAQCEQgBAKBQCACIRAIBAIRCIFA IBCIQAgEAoFABEIgEAgEAhEIgUAgEIhACAQCgUAEQiAQCAQiEAKBQCAQgRAIBAKBQARCIBAIBCIQ AoFAIBCBEAgEAoEIhEAgEAhEIAQCgUAgEIEQCAQCgQiEQCAQCEQgBAKBQCACIRAIBAIRCIFAIBAI RCAEAoFAIAIhEAgEAhEIgUAgEIhACAQCgUAEQiAQCAQCEQiBQCAQiEAIBAKBQARCIBAIBCIQAoFA IBCBEAgEAoFABEIgEAgEIhACgUAgEIEQCAQCgQiEQCAQCAQiEAKBQCAQgRAIBAKBCIRAIBAI9Y// L8AAm9Yzc5MH3JEAAAAASUVORK5CYIIAbh7wGYUAABhEYr97vp5AsYX++zeOGXf/iVBORw0KGgoA AAANSUhEUgAABakAAAFOCAYAAACMtJHjAAAABGdBTUEAANbY1E9YMgAAABl0RVh0U29mdHdhcmUA QWRvYmUgSW1hZ2VSZWFkeXHJZTwAAISaSURBVHja7N2/bhvH9sDxyQ/pr4I8QFaw4dZUo5bkE1hq 05jqjWvLUGNcAZIABW4ISwrci27SSn4CLls1ptsggZkHCK7uE+S3hzy0aZki98/M7szu9wPw2jcW V7sz+2f27Nkz3/3zzz8GAAA0y3fffUcjACHr32wk/9tJPq3kc5t8YnOwPa7Dph2OulHyx1Hy2Uk+ G/qfZRuvk8/JaXs4YQcA8uH+HwDg7T0qFykAABo4ACBIDYSrf3NsZkHcuyRIvRdysPpw1JWg+9B8 CU7fJcHq7ml7OGZHALLj/h8A4O09KhcpAAAaOAAgSA2EqX9zZWYZxqt0zcF2HNqmaQb1B3N/gHpO AtWbp+3hLTsEkA33/wAAX/0fTQAAAAAEYJZBvZPiJ6+0HEhoJDs8zXpvmOWZ5AAAAAgUQWoAAAAg DM9T/pwEcXsBbt+Oo58FAACA5whSAwAAAL7r30it5izZ0U9D2rzDUXcn4/ZF7BQAAAD1QZAaAAAA 8F/W8h0tDWyH4gldDAAA0FwEqQEAAIB6CiKb+nDUzVOeZEL3AgAA1AdBagAAAMB3B9txjm/1Atm6 PPWlr9kpAAAA6oMgNQAAABCGQcaf3zD9mxAmGMyT8X3B7gAAAFAfBKkBAACAMLzP8R2vaz0fjrpR 8kcn49fGp+3hhN0BAACgPghSAwAAACE42JYSF5OM3+qZ/s2Gx1uVJ9P7HTsDAABAvRCkBgAAAMKR pxazzyU/npbUBgAAAPAYQWoAAAAgHHlqMT/3cUMOR91W8kcr49euKfUBAABQPwSpAQAAgFAcbE+S /x1n/FbL9G8iD7cmTxb1e3YCAACA+iFIDQAAAIQlT01mH7Op85QhodQHAABADRGkBgAAAMIyyPEd r+pSH466neSPKOt2n7aHt3Q/AABA/RCkBgAAAEJysC2B2qwZxZHp33Q82gpKfQAAAOAzgtQAAABA ePKU/Hjq0fpnzey+PW0PKfUBAABQUwSpAQAAgNAcbEvANmvpix3Tv9moetUPR10JUGddjwGdDgAA UF8EqQEAAIAwZc0slsCwD7Wp82R0v6O7AQAA6osgNQAAABCmixzfqbTkx+GomydQPjltD8d0NwAA QH0RpAYAAABCdLAtgdtJxm91TP8mqnCt82Ryk0UNAABQcwSpAQAAgHDlyaausuRHnkzuAd0MAABQ bwSpAQAAgHBd5/jO8ypW9HDUjYxkcmczPm0PJ3QzAABAvRGkBgAAAEJ1sD0x2QPVkenftCpYW0p9 AAAAYCmC1AAAAEDY3uf4ThXZ1Hl+54DuBQAAqD+C1AAAAEDYJJP6NuN3Sq1LfTjqSuZ2lHW7TtvD W7oXAACg/ghSAwAAACE72JZAbtaSHxumf1NmoDrPhInv6VwAAIBmIEgNAAAAhC9P7eanJa5f1oB4 nsA7AAAAAkWQGgAAAAjdwXac/O8k47d2TP9mw/WqHY66EqCOMn6NUh8AAAANQpAaAAAAqIc82dS9 EtbrSY7vUOoDAACgQQhSAwAAAPUwyPGdMkp+ZC31MTltDyn1AQAA0CAEqQEAAIA6ONieJP87zvit lunftFyt0uGo2zMySWM2BKgBAAAahiA1AAAAUB8XOb7jMps6T6mPd3QjAABAs3z3zz//0AoAADRt APDddzQCUEeziRD/m/FbE3OwvWl7VQ5H3VzrctoebobW7H//1pJs9MWyJtc//jwes0PCN9z/AwB8 RSY1AAAAUBcH27cme23qyPRvdhysTZ5lXoTU3BKcTj7D5K8fks/RwueD/HcNXgMAAGCN72kCAAAA YBpw7JhZeYp5YHGSfN7/+PM4tBrJ75NPL+N3ZLttb+fzHN+5DmRfkSxxCUa/WPFjsj9JoLpLVjUA AMBqlPsAAKCJAwDKfQBf+fu31qW5P7ArAcb9H38ex8FsUP9GymxknbDwB83ELuxw1I2SPz5l/Nr4 tD3cCmBfkcD0UYb2jZN9p8tRBh9w/w8A8BXlPgAAANBoawLUQjKrJSP2KvlEgWzWIMd3bJb86OX4 zoXn+0kn+UhZjzOT7QFAh7IfAAAAqxGkBgAAQGNpiY9eyh+XIO6n5DvHWu7BZ+9yfOe5xd//NMd3 rj3dRyJ5QJH8VWpP5w0273C0AQAA3I8gNQAAAJosT2BWSj1IsLrn7VYdbEuJkqx1kFumfxMV/dWH o64EcrMu5/q0Pbz1qQnlQYQ8kDCzSREJMgMAADhEkBoAAABNljczVjKpL6X8g2Zj+yhPNnXPwu/N k0X93qeGS/pUgtISnM5SexoAAAA5EaQGAABAk0UFv+9zvepBju88tfB7exl//va0PRz40GBSOzr5 SFmPKwv7xqJrDjUAAID7EaQGAABAk8WWluNfveqDbSmfkTU4Gpn+TSfvrzwcdaUdsm5/5QFcLe0h EyJK9nTH8uLHP/48HnOoAQAA3I8gNQAAAJpsZHl5vtWrzlNGo0g29ZMc33lXZQMlffVC+iz5vHCw eHlQsMdhBgAAsNp3//zzD60AAEDTBgDffUcjAGaWQWtmAUoX2c+SPbv/48/juNKN7N/8N+P23ZqD 7R+y/prDUTdPW05O28PNivq+k/wh2dMtR79C+n+PLGr4hPt/AICvyKQGAABAY/3481gyXbtmlvFq my/1qrOW09gw/Ztejt8TRKkP6QvpE+kb4yZAPc2eTvatLQLUAAAA6RCkBgAAQKNpIFEC1bGjX1F1 veqLHN95UtJ3Siv1oXWnj82s7vSOo19znnw2k31qwJEFAACQHuU+AABo4gCAch/AUn//1pLgpZSA iBz9Csmy3S89iNm/+ZRjmzbNwfYkzQ9qqY//Zlz++LQ93KpJv8Zmlj094SiCz7j/BwD4ikxqAAAA QP348/g6+UiN5BPjpgSIBHMv//6t9UFrIpclTzZ1lmzjXo7lO8+iTtq4lXykrIeU94gc/IpJ8tlN 9pkuAWoAAID8CFIDAAAAd/z48/jYSCaxMQNHv6LsetV5aj8/z/CzT0tap1S0tIdkTktpj46DXyEP ME7kgYY82OCIAQAAKIZyHwAANHEAQLkPIDXJxjWzUhEdh79GMrfPdSJHN/o3wxzbsGUOtldO/nc4 6kbJH58yLjc+bQ+7jvrrRfLHkck+iWNaEpTeJ3MaIeL+HwDgKzKpAQAAgBVkYkUp55D8ddfMyju4 IEFVmVyx53BT8pTXSJMh/bykdVlJyqdIGRUze6DgIkA9nWAz2Rd2CVADAADYRZAaAAAASKEG9aqv c6x3L8XP7ORcFyukXIqUTUn+KpniLQftNp/sciv5xBwJAAAA9lHuAwCAJg4AKPcBFCI1j80sY7fn 8NfYLyvRv7nMsc675mB7aVD5cNSVoPCHrNt12h7uWuoDKe0hmdyuSnucm1nt6Vv2etQB9/8AAF+R SQ0AAABkJEHL5LNnpGazMbGjXyMZylIC5EwDsja8z/GdVSU/Kin1kbSHtI0Ex13VnpY+lczpfQLU AAAA7pFG5Zlf+r/OJ+a5z/g/B//ep6Vyt29vzY3Wu6R9ByWuj/T1qtdS95P1GdNz4HgBAL9p0FSu 65GjXyGBUsnoPS+8pP7Npxzr+YM52P4mWHs46v7XZAsS3562hz8UaGfXk1hOzCx7/Zq9GnVEJjUA wFff0wTe2TBuZ45vumhN+45KXp/WmvXZoMvA8QIA/tOg5vXfv7WOjZvyE9PyIsnyZdl7BWsjy7q+ yPidnpmVvvjscNTdybGduYK/mkl+lGO905IA/IVsI5nTAAAA5at9kDpFpmpRkuX6MfnE/zn494Rd CgAAoLl+/Hl8/PdvLQnmuqpXHSWfYfI7YjMLVucZf0owNmuwV96suZvF/STn784k2daetqerh/f2 a38DAAAgkyZkUq/LVC3q87J/6f8qA1upsXf+n4N/k4EBAADQQJqJu/f3by0JyLoqTSHL/KQB8WwT +x1sT0z/ZmyyJXK0ku9E0++aaRa1BIx7Gdd5ctoepi5jlmxbR9vPVcKJrMt+wax0AAAAWMDEiXZF ZvYa4qdf+r8e0xwAAADN9ePP43Hy6SZ/3TWzWscuSEa0BKuzZkZf5Phdi5Mk7uT4fqpSH8m2RMnn Mvnr0LgJUEtAX4LTWwSoAQAA/ECQ2o1pzbxf+r9+SD7UFAYAAGgwqVedfDaTv56YWYDUxdhT6lV/ 0uzjNPLUhl4MTDsp9aE1vT8YN6VShGSeb1qZgBIAAADWEKR2SzI/hgSqAQAAIPWqkz8kWD1w9Csi M6tXLZ9o5U8ebEuw/Drz8vs388zmTsbvjk/bw8l9/5is744E2c3srUQXY+c4+Ujm9D4TIwIAAPiH ILV7MpC/ohkAAAAgAdLks5f8dcvMAqcudMysBIhkV68K+L7LseyNO3+mtfR3aWmPoY6XIwdtMUk+ u1J2RcqvsAcCAAD4iSB1OTq/9H/doRkAAAAgvKhXfbAtmdR5s4qzBny/ytqW4LkE0WX9jJuJJWW7 pLyKZE9fs8cBAAD47XuaYPq65V85vtfOOKA+Mvlq/wEAAKCmNIB6rbWYZWJC26Uu5vWqZdl7SyYK lLFwlkkX58FpWU7aSQ2vF0t9JOvSk3Uybsp6GB1zS1mPCXsYAABAGAhSG/PuPwf/jvN8UWtNyyA7 Te28VvLzUfK7GCwDAADgK1Kv+u/fWjKZ35lxM2lgZGb1qmXcu7cQwJXJDNMGqQday1qc6HqmCTRP J0xMfrcEtS9N+uB2VhJA318SiAcAAIDnKPdRwH8O/n2bfORmQl7VTPOqZIdWAwAAwDKV1Ks+2J6Y WcB5HRnr7s//z2l7eJtyDLyX/Gys2dMfjJsA9XTdkrbbIkANAAAQJjKpLfjPwb/Hv/R/lXqCwzU/ Gvm03sk6y03Cxj3bFFe4XpG2VWfJDYhkyEzISP+qrVp3bvjm7TSWByme9eFEP5Wsm779cN/NcWXt teL4nPev7PMDy30RcywBgJ90gr/u37+15Nx96WgMKdnTveR3dH/8efvY9G/kvx3dd41MPnsLWdRT p+3h+HDU7er3dpZ8Z18D1LL+Z46aSxJGTiTAz54DAAAQLoLUlkhQ95f+rxPjWSB6Llk3ucmRj9TS vjc4vfDz8odsT5x83ifbd13C+j3VG5yNFD8v6ybrJOVaxhW37YbeQK5bb8m837X0+15oe0Vrflba Rl6xvXYdgNXJQZ9k6MOx7l8XLgKlGpxd3OdbKb5j5vu8ttkk5+9urbkZl4D4/j3rfLSkDWWdBhm3 /bku57595GihH97J8n0K0gMApsFqOf9v6sSHacrLZSXLu0qWv6WBarnW9PTaOR8LjszB9r3XIAlU J3/sHo66iw+CJ4s1qB2tu7TNvgb0AQAAEDiC1HbJIDnyZWU0UDYPVOW5MYj0RqWXLEuCVxJMPLa8 jrJuZznaTX5ebtheJMuQm5STKrK/NWA8NOsDoPNXYov+vmOTbVKlee3Hs+S71vtP16mnN59Z+3Ae OLbWh9ofO9pGeV8n7ujnTNdrP8eDkA2TsbyP9u2Rhe3PWst03g9HyfdPtIQRAMAjP/48Pv/7t9ZA rxMvLC9+PqY61tIfucYKWv7jvuv4jsX1lXXc1wknAQAAUBMEqe3yIgtRsyivjN2afxL8kiCWZMru Fc1e1nWU4GnHwrrJMjrJMqeve5aVDZo1QF2kzfR3XRVoL6v9p+tkc/Kjwn2YI4Cfdr0+aPD2uOL9 aN1ydky6jP5V+4gE5tu6j5BVDQAe0XIW+3//1rqwOIaak/HBscPVt3VtltrZ55T2AAAAqB8mTrRr XZCprNcRb427WdNluUMNUOaipT0+GPsTSb7QdYtKauczU16AemipvQr3n67TC+Nm8qPpcnOu37+M /VeJ5yTAf+lo2TYC1D0ze4hhY/t3dB/ZMAAA7/z483iSfOTtLPlMShrDVk2ypjeT7T4mQA0AAFBP BKktWZjAbpW4jHXRDEiXr0BOg6Z5gsEaTBsad8FE6YMPRYOwKbZDApa9NT9WOECtCgcx7+m/VoFt P3PYvFHO9Xvn+NCSsjdnlvejM2MnQH3p4DiS/e5fnN0BwE9Srzr5bCZ/3TeevM23Qt6x0ETGUsl2 7kpwnl4HAACoL4LU9qwLEl2X/Pr8e8fL3zAZA2OaQX1ZwrbPS2M4UXKAunAQc0UbZX7QoEHVXkl9 mClQrW3t+gb2he7HNvYjWc6LgsvYcXhMtYz9uqcAAMukXnXyhwSri8wp4Pptv4uMPz8tbSJBeJ08 EgAAADVHkLogeSU++aSpFXxS8qqVMZlMR4NkadopMtkDx3JTMtC2k79PMtzY7Drq7zID1GJVkHai /Xyin2uTLUib6UGDZuxmCVreFujD+fpdZSw7UcZ+f+TDcrRdsgaoxwv9Me8TXpsGgMBJCYzkIxnV mybfm3vvHK/fwKQPhMvPbmrwHQAAAA3BxIk5aHBIgodPzax+67og2omlgGVqkrWdrOe1+Xo29bHe uIySz2TZOml25xP9XpTiV8lEdWkCg2kndJtoew3uaXtZp565f4I8mwHiu7+7Z8oNUN8n1jaK71lP 6UMJgHZSLEseNPTua+877X6WYf0ukmVer1jWkUmXkR3pvpP2oYPcZL+40x/zfX68rM10fRb3+zRt 1rmv/VNqmeIlb84yLGOg+8xkxb59lPKYBwB4SktidP/+rdXR62ea8/r8AaZrUkN7VWKHXFcle3pM TwIAADQPQWpjzn7p/5o2k3AenM5i8J+Dfx9XtG3vdX3lFcvr+wJUizTwFidtIlmWErRalzkrAbto 1bI127qTsq321qyf/J7jZJkDs3xme5cB6nVZq64D1LL8vfuCv0v6UPouTWD5KMXNaZqAaNr1kz7c S9bvQtt03TG1kzYoLG2f/OxEb3Tfr1uXhfWR7R9ogD/NBIRPTbEa8xtr2lHWe/4wKV6yP0rQoZdy n1m7T+pDCtn+Y2MvUxwAUBEtkbH592+tF3pev++6I9eHbhmTEervmAfQ5Toa6T/Jdfh98u/X9BwA AEBzEaR2O5v5+X8O/r1f1YbNA085vzutBfhL/1f5v2sD1Wt+T5pA6X7yO88zrJ/c0HTvlN/Yq3mA OtPypT31Acy6dY/kQcKKzGfp3x0H6ycBZcmqSjMxpNxgxymXu1ngmJHg/lby1w9mdSC546iPL/S8 sS5Y8Dzl8jaz1MKXB2oa5L80AIDgScmMv39rDXQstxgYluu1vH00KCNAfWedYlPSZOIAAAAIBzWp 3ZhmpVQZoLZFt2Gy5sce3/cPmkUdrfn+dZYA9Z31k8xr+e7eupIVeaQMUIt9xyU+cgXgtU3S1EN/ mvPf5nZzrt80uG3W16nsZJlEseA+L/v7umM3cnTOOE4ZVE5TlqSbZ7LWIg+3AAD+0XrVxzoJ4Xf6 2ZIAdtkB6m/0bzrJ5yz5DPVznHx60/8OAACARiGT2g0Jpj2XLOSCdWt9IdmdZ2u29z5P1ix7WiKi yMq5ehigQdE0WeBOAuQLrtOUrVjRPpIdu5g9tczOPW0g2cS9Nb/ivMh+rvXTZR/4sOZHnxfdVzKs k5S+WFnixEJd6rmJyRBQ1v0yStEnRR6ayDHVMdSoBoDgHY66ncVx12l7WH3N5/7NdHJk8+2bSZ2F n5lfI+UznVti+veDbWpWAwAA1BBBanck6Ce1dGPjPsvWtXHBdljlIk+2p2saCJQyFOtqE7sOUAsb QXjJpr5cs83Lgq47KZddiJb+kHbsrfixTgX7fRm/czfjMZBmnS4K9set1gw/MwCAIByOupGZPVyU 68Rj/Xtryc9NZPxy2h7GlazoLECdptSX0W2IzLfB61nA2piPhuA1AABALRCkdk8G1R8kU7SEYOZK mhXbWhjo/2S+ZEqOFn50OtifB9a1Tm+e3ye/a12Qd+Bbh3kWoB6nmfAyBcnEXle2RLb77g3r43XL tfiQQWpj9lbdqK6bpHNFfy5mH7f1T1nOX/r3W93vxwvbMzLug9R5Mp7bKfrExj4j+zZBagDwkGZH R3qdnl/nNlJ+Xb43TJYhgeoqxmEvTPE5Yebb/OVh+pfg9Viv77GZBa8n7DEAAAD+I0hdnkst/1Hq zcBCuYana24IOku+K39IcHNU4AZiFVsBWJvkZu95ihu9SUl9+d7GQjQzNjarg64bOfrwva0N1Ych t2vaPjLra6TPJ3t8qjevGxmPmbHe2EYl9G+ejOd12/OxxH0GAOBQ2uzovGPTZPnjCsp/PHW47NZC +xxN/3cWvI7Nl4fT8vexOdi+ZQ8DAADwB0HqWS3YOOuXNAhmFm4a0pRFkED1pKw61cnvOjbpAq6r 7KTctmWiNf8ee7g/pN1WyeqVSe6OHa+PzTZaV76ifc/N3ioTy9u7bh07q9pkoY54x9INrkt5M54j j/YZAIAlBbOj8yptvoepWamPqILmXbyWzYPXn9+iMrPg9ezvBK8BAAAqQZA6p4VA8/RPKUNgZsGx dUFOKbmw6XLdNHs6ba2/Kv0v8N3gSDJNA5ocM097b6Q8DmzJXWIj6YueWV/SxCd5s9AjjlEACJfj 7OisZNy6V+Lv82lsuqF98PW440vwWsYkEzMrGRKz5wIAALhFkNoSzYjc/aX/q9TZW1XHVTJwe65K RQQUoK4LyY7f8nHyxyYJMEBtTLEJSQEAAagoOzqLctdFgr2z8hs++zZ4PVvniX4IXgMAADhAkNqy /xz8+/yX/q9PzOpsUPn3gaNVODLZAtQSKLsbYPXtBspnkbb5fhM3Xh6KVB2g17cYsgSo5xlSd29I WyWfKwhSA0BNeJYd7bvYhFlKarGPZ75M1jgxszkhZn8/2OYaDwAAkBFBajcu1gy+ndy0aJ3sFylv Di7+c/Dv6xXLmgftJKC+Y9yUGHhck/5+kbTXaFV7FrwhsuWnNf9+e89/21izL8cW17GdYx3TBKhv 9bgcrKoDrTWtF/d7V4oE9sdrziEbJe4zANA4AWRHZ72mlO3E1Gu+g/k+8GXc8G3wOjaz4PWEIwgA AGA5gtTVDPgjR783zWzpe2lKjWh2bKyf/V/6v/6TY33WDcRDyDCStpLJdI7W/Nyl1qe2nVVsM5C/ rr0/3rMvr7qR7Bi7QepWlmNLs6g7Kb7TTdM3mt0sn4FOPHpU0TlilXXbIYF+Ww9M6hREAIBMGpId fVH6b5yV/Dg36RIrQrYYvJ5P1mjMPGA9G1/O/k7wGgAAgCC1I1WVP1iX+Xniqhb2PdYG6yVz1eOy B5J1O51MSEu4rMtelYzeXQd9WriUiAZz191YT+7pw86K70i7HNvYUM1i3si4T+2kOBa7NasZvq5P bO4zEadzAE1Qs+zotOLT9nBQyW8+2N43/Rup7XzWwGvN4jV8HryOp9duyoQAAIAGI0jtRulZNhpQ WnczdV7mOknwOVmvdeUinptyZ5VP63OAWknw+cOabdlxMCmmBPJ3LJQS6aX4mWU3RnIDuSrTqSVl ZpL1iy1s6/N167ck2Lwu0/yihpNafkyxz9jokyMDADWj2dHzIHSTa0dflzn+Stp9sRyGXJevT9vb 19P16N8s9kdTHhDc1ZmOM/s3e+Zge8CRCgAAmoggtRtPK/id0Zp/z12KQgPgRW6Ceiv+vZcs/8Kz bOq7AWoJuE+S9ZQaimdrvnumZT8mFtfnzBQo36D1xdcFgG/v6YM45fptFdlAzaLurfmxd3n2+wKr 5Ws95jTbdFRk2/WY7xkAqAkNksr1qtPQJphPGiyfd6ft4eya37/p3bmWXtvM5tV2lzfN7j4IOEv+ bRooP21vz9fri/7NfG6Ull6PmxK8PptmVVP+AwAANND/0QR2pQy2hTbw7BX47rsUP3OpgdS8bS6B 7g9FlrF4c3Y3QD2X/Pdzsz5YPC/7YZNkxp4V+P5lipu663u2WW5qB2u+2yqyftpvadpsUOJxLOu0 4+PBqA9A1gUQOlpTO++2X3E2B1AXh6OujGPkbahOQzZ5rNd1ebjeTT6bp+3hD8mnm3z2pwHq/s1O 8vmk19+jhY9k8w41SFy03WVMPDT3Z6rLdXaY/Ny3v+tg+3Zau/pg+3xaGuRgu5t8fkj+5QfdphMd F8Q167sNw5tMAACgoQhSWyRlGXQwvk4VA+pWzm1Kk4V7Ly05EKdYt2GeIHPynRfmS4bO0EKgel0p BQlgr8tIzx0gXOGFbmvW9rk06YKtqyZOOkm5fr2c+9cwxf45yPkmQN5XuF8Yv7O10kx0dZS1T7Q/ zkwzX30HUENa3uOspps3n+T6XMcnEoT+LvlsJZ/d5HOcfKTu9OSrb0mAevYwMrpvHGNmweqi18Gr FNfSVsqx88yX4PVx8tnT4PV3yb9smq+D1yHXdu5w5AIAgCYiSF2QvBavmbzDlINx8d7BqqwbjG9k DXIuBBCL3qSkCXLOg8ytDO1+defGU777Ke0y8tBAaZoajkcO1kNKiVylCcTLz2j79FIsN15VbkUz dwcpliMZ8amz4rV90gSob1fsQ5M1332e9cGFBna9zmLSuue3KfvkLOU+M++PngGA+jgy9SgRsS47 eiAB6bVLmdV/TvP2UmQKBPc1ez1K+eOt5OeLvYUm5TG+Dl5vafBaypHtartdmzCC1xGHLQAAaCJq Us8Cf3knVuvk+M7EwiR435DgabIdkzUD2+m2ppnYTyZe05uYyMK6xcnyZJvXZfTKjZOU7ZD1e7+s nTSQJpndvXuWMQ2sJz/XdVXnWtZL17G35kcvTcFazUtIG3b097+7u43aPk913dLelKd5iLCvv3vd MuX37ty3frqOspwnJn0w9GRFje/RmuVEC/vD7Zp9fv6K7YtAzl37KQMNL7RPpPTO4G5b5ugPAAhJ J7D1XawdLW93TVIFn9OYZUanTaiYXdP7NyfL6iP//Vvrc7v++PN42fo9zrh2vcNR92OyrXYn+T74 XO/6+k5bzGtcyzihrX9GHC4AAADVIUhd/mvtLmdSlwH4ugCbZFZKEFPKBXw1maIGOOdBzo6D7W6l vAHomdmEivL3OMeN5jxQvWV5AsNF+7o+q7ZnWqs5WYd9y797Q/v5hbbRuMC+fK4lWVbShyCSiTTM sX7xwn/Puo4DrQW+ap+/THGMS4a97PPXi4FzDUx39Aa1ZwLKtpOHTXospzkuZD+d1htd6BNuyAE0 gc/nObkeyTjlo56XJ9+U5rBrmKM9Il1HCUzPr+/PF6+XyX+fz19x8uPP49sCYxKZTPFWssKdt/zB kskaRf+ms3B9rCp4HXPYAgCAJiJIXa79NAHBAi5MuizQjn6MBqycuxPkzBII7OT8ldcOA9Tz7dkz 64O2Eqh9X6Dfxylu9PI+aBlnCaBrRrxsc9ZXcjsFtn0/RT/IzWxvzbLmWdJHZe3zJZFj6pPJHlxP 0yfzWqc7BgBQhLvs6LT6N5cFxgvzAPV9JbrmwetO8nNdDVTnHYNJoHo8ndyxClIy5Nu2mz9kl89P C3939WD7HYcMAABoImpSl+dkTUZoYRqUPXGw6LGl9ZPldE26WrpFSPbtnusO1cBzmva+LDCh44lx Uz9x3hdZt3lg3L4N8NX6pZwscd/RPnXr+0lF28fVMSXt+tEAQNjikn+fXL8G5kvt6B9y1Y62qX8j AeRewaWkmVR3sd71KOfvmQbDD0ddf95s+jJZ43ny2dfJGn+QvtU+3tc+j63srwfbAw5bAADQRASp 3ZPg0e5/Dv59XMYv099jc3CbK5i5Yv3my3OVIbNXRoD6Tnuv25bI5J986NZBe2UJAC/bZtm/do27 IK6UINlKu36OArV7JozJlRaPqYnl44ibZAB14Cordf62yYleM7ZO28Pvko/8uZd8jiUYnXyqfeDZ v9kpMAaZjhn+/q0l45heyp/f0Z+/LnBd9i9QvczXwes9DV7LZI2bel0+MdmC19c6vgIAAGgkgtTu 3OrgdNPFRImraJDWRta2rHfuYOaK9ZsH1Wxmlk/kBrGiwNpeihuxnk5Ql6e9ZLLLLUvtlSkAvGKd ZN/YMncnIireh908NbwtBmrnD5UGIZ1sdPtt9Met9kFQ2w8A99H6xnHBxazKjj7W7Gj/HmzOJge8 LLCE82kgNnvZpx0NzhcJuBZd9+rIRJOz4PXxkuD1ru5H17pfxrpvyc/sansDAAA0EjWp7ZroYPN9 2YHpuyTQJ7WQzawObyfHduy73AYNku7rZHayjr0CbX5SZVBNAoTJdsgNx7pMJSn7ERfIYJ73aZpX bu+61j6dWNxuWdZusk6yfz03+WsXW+lD7QcJ1H4zqVNKA22jIG8Qdb3n/ZHnuA96+wFgBQkMXqa4 Ts1rR4/02jT2MvicxqyO8pXJXzdZtnte0izrMqY/L5nkh6Nunrks5naS759JmZRa7IUSvJ7tV9cc kgAAAN9qQpD6nclfFy+NWP7H4oSIE7O6zvEk7YJ0nWSyOwloPjWzoFVrxc2IfO4LsFtZpyXrKN/d S9ZxX28en+h6bqy5cZJtG+UIpMcF//2+7TjXCfnW3ci17vyOdfvnZEmfbmkgct6n0YptkaC260kk 5/tZpH3YTtGHsfbjO80CtrUuEmA4TtblPMX+NA9GSBsNlgRnM/WNq+O4QH+kOe7X7SNOjhcAKNM8 q/dw1J1fO6OFc/Ff82tS5aU57BquGB+sM8uCtpDVK1nmSbvLuKCXcxEvku9/1Ix4AAAA1Nh3NEHz aDDx8w2aywBmwfXs3PlP3q6rB221OMv82IdsWJ0ssuVLHy7uTxYfKoV63I/JmAaAmurfSOZyr8AS tszB9ucHyH//1jo2szd00jr58efx8eJ/OBx1Jat7p8A6dUufcBKoqX/++YdGAAB4iSA1AAAAUAf9 Gyl5VWSiRKmhPFj8D5aC1NPJEE32cmVz0zkTgi2/AniEIDUAwFdMnAgAAACErn8jmcpFAtTndwPU tixMpJj3LZ5pjW0NdgMAAKCGCFIDAAAAIevfSIbyZYElXJuDbacTFJ62h5Pkj67JH6iOzCwbGwAA ADVEkBoAAAAIVf9GsoslQJ03y1hKaOyVsaparqNIMLx1OOpe0ukAAAD1Q5AaAAAACJdMSlik1vOu OdgubTLd0/ZwYIoFqnuHo+4x3Q4AAFAvBKkBAACAEPVvJKu4U2AJEqCelL3ap+3hefLHoMAijg5H 3R47AAAAQH0QpAYAAABC07/pJf/bK7CEPXOwHVe1+qftoZQYGRdYxNnhqNtiRwAAAKgHgtQAAABA SPo3HVNsosSBOdgeeLAlMpFi3kC11OAeHo66ETsEAABA+AhSAwAAAKHo30j28FWBJcTmYHvPh005 bQ+lFrasS96a2BKovjocdTfYMQAAAMJGkBoAAAAIQf9GgrGSQZ03KCtZy7s+bdJpe1h0nVqmWFY5 AAAAPECQGgAAAAiDZFDnrcM8y1o+2L71baNO28PYzDKq89o5HHUJVAMAAASMIDUAAADgu/6NBGE7 BZawaw62xyWs6eM8XzptDwfJH+cFfm/vcNTtsaMAAACEiSA1ACA4jx487CWfD8nnn+QzpEUA1Fr/ ppf8b6/AEiSDOi5pbXPXhz5tD/eTP64L/O7Lw1F3hx0GAAAgPASpAQDB0OD0JzOrPzp/5b2T/LeI 1gFQS/2bjilWc3lgDrYHAW2xlP0okvEtgeoWOw4AAEBYCFIDALx3JzgdLfmRiFYCUDv9Gwm2XhVY QmwOtvdC2uTT9lBqZnfNrIZ2HpLJfXU46m6wAwEAAISDIDUAwEuPHjzcSD4v1gSnAaCe+jcbeu7L G2yVbOTdEDfdQqBarhdDAtUAAADhIEgNAPCKlO5IPsfJXyU4fWYITgNoJsmgzlu2QoK7Uof6NtSN P20Px2ZW+iOvll5DAAAAEACC1AAALzx68LCVfCRrUILTR6bA5FsAELT+jZwLOwWWsGsOtsehN8Np eyiTKO4XWETvcNQ9ZocCAADwH0FqAECltN70MPnrh+TTo0UANFr/plfwXCgZ1HFdmuO0PTw3Mvlj fkeHoy7XFgAAAM8RpAYAlE5Lepwln/+aWc3VDq0CoPH6Nx09J+Y1MAfbg7o1y2l7KGU/4gKLuDwc dVvsYAAAAP4iSA0AKM1C1rSU9HhhKOkBADP9m8jM6lDnFZuD7b0at5BMAlmkhIlMpBixowEAAPiJ IDUAwKl5rWmypgHgHv0beWAnAeq8D+4keLtb5yY6bQ9nk0HOJoXMY9rGh6MuD0cBAAA8RJAaAGDd owcPN5LPi+QjdabntaYJDADAcvIAL285ilnw9mD7tu6NdNoeSjC+W2AR0sZX7G4AAAD+IUgNALBG y3lIAECyps9M/qALADRD/0bOlTsFliAB6nFTmksD1UXKmnQOR91LdjwAAAC/EKQGABT26MHDneQj dablxn+HFgGAFPo3PTOrz5/XvjnYvm5as522h4Pkj5MCi+gdjro9dkAAAAB/EKQGABQiAWoze306 ojUAIKX+jbxpUiSjd2AOts+b2nyn7eHxtA3yuzwcdXmoCgAA4AmC1ACAop7TBACQQf8mSv53WGAJ Y3OwvVfS2k48bsl9M5s0Mi8JVFOWCgAAwAMEqQEAAICy9G9kEll5+yTvZLITU2zywDy/z0un7eGt tkXedZQ+GB6OukzsCwAAUDGC1ACAokY0AQCkJiU+8mbvSlB21xxs39KMMxqo3tW2yYNANQAAgAcI UgMACvn9zz+OzWwCqwmtAQAr9G/OTLHJZffMwfaYhvzaaXs4nrZNfvLQ4IyWBAAAqA5BagBAYRKo Tj6byV/lIxltErSOTf7MNgCol/5NL/nfFwWWsG8Otq9pyOVO20NpmyKB6t7hqEugGgAAoCLfNXXD Hz14KBkT09f6fv/zj5hdAQCcnW+j5I9O8mmbWQahi1equ5zLAXirfyPjzg8FljAocaLEr/z9W0vO 31kmeYx//HncraqpD0ddKafSK7CIvdP2cMBOiyZ7/eZtK8147dXLZ4y9AADWNC5I/ejBww0daC/W ApxOuvL7n3/w+iQAuD8HSybhkeVFE6QG4Kf+TWRmAeq8D+jG5mB7q6rVDy1ILQ5HXVnfToFFbGkJ EaC2Xr95G+k9sXwe6zkq73Ez0Y8cN/8zs7fpxq9ePuONOgBAak0MUn8wyyerkQvo5u9//sGFFADc n4uLZhXeRZAagH/6N8uSI7KYJJ+tKidKDDRIXbTdpwksBKpRJ5odLcdzW/8sY7JQOYfJcfRRzg1k XgMAVmlUkPrRg4c9M5tR/T77v//5xzm7BQCUck4+NvYyqglSA/BP/+bK5J8ocRoorXqixBCD1OJw 1I1M0Qz2WaCaBBYESwPTT/U8FHmyWjJee29mQWseBAEAPvu+Ydv7ZM2/ywWcIDUAlGNg7Jf9AAA/ 9G9kEr6dAkvYqzpAHbLT9nByOOpKsFwC7HkC1RLck4cMXVoTIdEyHj29t408XMWOfmRdJ8kfMunp OwLWaPgxK+OFx3eO2ZGZlc1h0mQ0RmMyqbUO6n9T/KiU/JiwawBAKefmfywtikxqAP7o3/TM6rf3 1tk3B9teJE6Emkk9dzjqFu2Lk9P28JidGr7TrOnnptjEoVWSe3AJxl28evmM+3E04ZiNzCxhp5fi 2DhJjosBrYa6+78GbWvH8s8BAIqLaQIAtdK/kUDRWYElDHwJUNfBaXsoN/UnBRZxpDWuAS+9fvO2 k3zkQZKUt+kFvCmRmU2u/Um2R7aL3kWNj9udDMesHBuXelxwPUKtNSlInXbilDa7BQAAAHKSAHX+ OsgH23s0oV2aCT0osIgOrQjfSBZm8pGSNMMa7qOyPUOC1ajpsdszs3JSGzmPCwLVqK0m1aROG3yW J1rcHAAAACCb/k1k8geLZhMlwonT9nDvcNSVpJVWjq/Ld6gJCi9ogEoyjm3M6yF1oOPk85f+3bx6 +Sxe+F3z85mc2x7r+a1V4ubK75NMcTn+9pJ1YyJThH78yrFU5G2r+dtaxKxQS00KUqe9mG48evCw 9fuffzBxAwAAALKIcn5vFqA+2CYA45Y8BPhg/JxMDlhLg8aXBffhOPm8Sz7X64K+iwHrhXWQILkk dj035QWs5fdJsLrLBIsInBy/RTOhe8mx8G7Z8QmErhFB6kcPHkYZTwRy8efiBwAAgDLIRImMPR07 bQ9vD0fdXTMrj5Dl3oBAACqlgWHJnH5RYDEDM5t8bVJkXTSwLcsaaND8yJRTbkTaQEokbLJHINDj uGPxWDni2oQ6akpN6qwngifsGgAAAMhokuM7J+Zge0DTleO0PZSHAbtZ+jT5DoEAVOb1m7eSrSwP VvIGqOX8svnq5bO9ogHquySTM/nIGwrdnOe/rCKdcA4I0XOLy+rouQGolaYEqbNOhth59OAhxegB AACQ3sH2xGQL1AyS7xzTcOXSoHPaep7U/URlNCArAeo8wSh5ILPlIjh9l5Yd2Eo+5yU0C4E5hHgs z8vk2MQDG9ROU4LUeS5kHXYPAAAAZJQ2qCkBpH2aqxqn7eFgTV9JSYM9sqhRlddv3krmtJS3yJM8 df7q5bOtMus3SxmQ5LNv3D/YeczegQB1HCyzTbOibmofpNaM6DxBakp+AAAAIJuD7disD9JI4IiJ EiumgWqpbyvZn/HCRwJtm/rvQOlev3krk6ud5fjq9OGKBosrkfxuOW62dF1c4I1nhMjFGwAdmhV1 04SJEzsc8AAAACiN1Jju30zMrP7k4uu48t/eGQmKEqD2wml7KH1CRju8oQHqXo6vyjmlW2b29H1k HZLtkDrVWScpBerKSdZzcpxFrsv5AGVqQpA6b0Z09OjBw+j3P//ggAcAAEA2s4zqmIYAkFYdAtRz C4HqD5YXTU1q4IvIlDNpaVXnRDne5UHXWEoK0d3114Sa1J0C36UQPQAAAADAqToFqOd0nWzXqCYz GyHi4Uq+c6I85JI3Mj5J1jitUn+1DlJLJrSZPVnKi0L0AAAAAABnXr952zP5AtRiz8cA9ZzWqD6n l9FwPFzJdk7s3DknbhQ4RyIgdc+k7hT8PpnUAAAAAAAnNBhzmfPrJ69ePrv2fRt1IscxvQ0gpaMl /40k0gaoe5C68E786MFDAtUAAAAAAKv09fWrnF+PX718dhzQ5u6aWWkSAFh1XuyY5QmnEa1Tf2RS r8fTGgAAAACAbRKgzlMGQIK9eyFt6KuXzybJHyd0ORpqQhOkdnTPf49omvqrbZDaQj3quQ67CQAA AADAltdv3h6b/JOpXWjQNyjJOkttasp+oIkmNEGq82LHEINrtDpnUtvasVsa8AYAAAAAoJDXb95K cPoo59cnJuyJCPfZA9BArkrd1O2hzxG7SrPVOUhts0xHh10FAAAAAGDBWYHvymSJwdZ2TtY9Tv4Y sAugYT46WOZtyOeCu8iihiCTOp0n7CoAAAAAgCJev3nbK3CvKkGpQQ2agdrUaJo4kGVW6ZLdBLUM UlusRz3XYVcBAAAAABRU5HX2QR0aQOtpD9gV0BT6BoHtrOf3dWkffXgXsaegrpnUHcvL23j04GGL 3QUAAAAAkIeFQMy7GjUH2dRommvPl1clalFjqq5B6raDZe6wuwAAAAAAcioSiJm8evmsNpOkkU2N BrL5YGZQl3rUr9+8PTZkUUORSZ0edakBAADQNLc0AVCchSzq6xo2C9nUaAx9MHNu6bpci2MnOS9u JH88Z+/AXO2C1A7qUc+1kmVvsMsAAACgKX78eTw22QLVE1oNWOppwe+P6tYgGrSL2TXQIBJcLvpG xL4eO3Ugb5cQZ8Nndcyk7jhcNiU/AAAA0DQXGX72Hc0FfO31m7eRhfvUmPMLEDYt0bFn8r+lJGU+ BjU6L75gr8CiOgap24EuGwAAAPCRvJ6cJvPr/MefxzHNBXyjaLLTbV3qz96VbJeUMZmwi6AptLb8 psn24Gka3E6+u1ejprhkb8BdZFL7s2wAAADAOz/+PJab4+6aG+qT5Of2aS1gqaKlPsY1bx/ewECj yEOn5CPX1b0119aJmZUI2axLBrV4/eatPLjrsCfgru/rtDEO61HPRcnvaP3+5x9jdh0AAAA0xTxQ /fdvLbmplAnFW/pPUid3kPz7hFYCvqUTg7VoiZUGZlabFmgUDTwP7jlPTGpUe/ruOfGM3scy39ds ezol/Q6C1AAAAGgcLecR0xJAajbmNar1/acE4l6/eSvbSDAfjaTlfJpybZU61BG9jmXqVu6jjJrR T9htAAAAAAApPLawjP81oJ0o+QHUnE6WyFsTuFfdgtSdMn7HowcPN9h1AAAAAAAe3KPWwYAmAGqP yRKxUm2C1CXUo2agAQAAAADIwkYJi8d1b6SGlTsAGofJEpFGnTKpy9zZ2+w6AAAAAID7vH7z1laN 5aa8yfuevQao5blQzmFkUWOtOgWpywwc77DrAAAAAABWoExkNtc0AVBLR5wPkQaZ1PlEWl4EAAAA AICl942WltOI4M6rl88myR9jdhugPl6/edtJ/nhBSyCNWgSpS65HPUc2NQAAAADgPrbuUVsNarOY 3QaoB8p8IKu6ZFJ3Kvid1KUGAAAAADinwZ4moC41UB9S5iOiGZBWXYLUVQSMO+w+AAAAAIASNCKb +tXLZzFdDYSPMh/Ig0zq/DYePXjYYRcCAAAAADhGyQ8AQaDMB/IKPkhdUT3quSfsQgAAAAAAxx43 aFtHdDcQNAlQRzQDsqpDJnWnob8bAAAAANAMTbr3nNDdQJhev3nbS/7YoSWQRx2C1GnqUY+Tz17y 2U8+txZ/d0szuQEAAAAAcCV6/eZtU+49x3Q3EB49R53REsirCZnUEpTu/v7nH4Pkcy5/N3YD1R12 IwAAAADAkntRmxqRnfjq5bNxiW0KwJ6r5LNBMyCvoIPUKetRX/z+5x+fL2TJ3+WCd2FxNdrsRgAA AACAO2xnBD+l7ciyBnz0+s1byaBu0RIoIvRM6jRPkgdL/tt5yesAAAAAAEARrQaV/IjpbiAMyXlJ 4mIvaAkUFXqQel0W8+T3P/+Y3P2Pmll9bWkdNh49eMjTIgAAAADAIhdZv72GtN1FiW0KIKfXb95K POyypN9FKZGa+z7w9e+s+fd4xb+9N/ayoHe4WPpDHxqsPHn9/ucfMS3lfz/JcbVYrgel9Iv0SYv+ qE1/3nedXPoQF/cfE1w3gGzXd46Z0s7njG899urls9vXb97eGrs1WqXkx3ED2m6StN2e+Tr4JW15 wZ6FJkqOB7kO3K6p2V72Om3oMVpW8FjGGFzr8vVVZO4pl5zsU9606XeBD4A/rPmx3WSwdn3P96Vz PllanTj5PV12+9L7X07SP+mJ6t4DLoWxDngmyecvPekRwLHTR5H2z2O9cKUJTK/rp5H2VUwfFeqf DT2GpE/aGY+hiX5G2g9xgfUYGjsT0HabenOu17NWzr681WNLPh85rr5p256ZzVC+wbUeSHUuulw4 p8uDzS1aJlMbzq/LNse38uf/dHzLw+ZqAgO2xjqL9l69fDZoSPstHgcTCV6zV6Fh55B5pvI8kWiQ HAd7nqybTJRYZgnc82Tb99kr1u4vcs15bL7EY9LGYMZ6nz+9L6wieB1ykPqF3jiu8sOqgViyjE8F Bn6ZfhcK93dLT35tB4O8+0x0QC+BuGv6N9WNVaeCPnonF2oCa6mPo6fmS3Dalls9Vt7d92BwxToR pM7Xl/Pz4Y7F69jicXWt/Tlu8PEiNwO9O/95y4c2WZg4OlrS//Og1LQvm3ZuXMg2je45NuaBu9sm 798O2r1nvjzQaey5ObDxrbxVGjO+LSVgIMeG7Vqt41cvn/EQCKj/+eM4+eNoyT9tVv3AJlm3ZWNl 1+SatcXDqq/6YUPHEk90LGE7q13uCyUmJg9HnI8ZQg5Sr3tiszZ7454b0Lx2swZnkGrg/tS4CcLk PTjfJ/08oHc+B0kWA2VVk37Z52brm37a0PPc85KOIxkwyIOD8zR9QZA68zH3XPuzrFfqpD/ltdpB U44tPWYu7zmvnSTtcFzR9bBIIEuOjXm2fG0eut55OJr3TZ3xnbbhpif78XK2YjxdyTETwH47H9/6 UFtTxk/veJjgNIDQM27qtTYmm7qifov03NbO+FW5jvy15L//y6xPEpHr0UkZgaCCbTM/j0UF22Qu axtLwOzc93Yq2MZyfbhaMe7rVlmiweF5Le3+tJ9sf6Pjb9oHT0y5sRhp8wuX+17IQer/rhnYSYBk f80ybB5YcgO/Z2DjZkcOsufGbqan7ZPiSROD1QH0jwxUdrnR+hzQPDLVTa5zq8fJ+Zr1JEidLqBx ZMrLsruvPy9MyocPgR83VyvOb6UF3BYeSrh4UCvHijxMCipgXdLD0YnhTYIs56bLNfsnQWpTyQPj vPv+HmMoJ4EE6fNPLvrs1ctnm7Swkz5zkf2eZcy16WsAtqLs2aVjmaSNujXd/3bM+jrPlQWp9SHF 0JN7/3HB73/Uv1/7VOt7Rdtv6Lnpuan2Qbfseycu9sEgg9RF61HfudmxNWCQV2oZJBQbvPtwsDGY v/9G9KkJZzbxvaZmvKfIaiubXOz37ztOCFKvPe6qDk4vG8zt1/H40va+WnMNch5wK7nfg3j4oOVt 5pmnZZ+/LniDaul15sikC+A0Oki98MDYl6zp1DeeBKutBxZslpn86hh79fLZMS1sta+OzfLyCmXy sl81eHrl0SpthRBYzNC+kd7HpRnvVBKk1iDpp4CuaVlMks+uj/uUR8HpZWOGPZvlV/4v0J2nk7Kx VtJXOm01ZqTBc2S80Uk+x3qiOwrsZCcXkaEE2fQmpI7900s+8kBIAom9gFb9cqEuaZOOp/mx5FNf tfQ4OdPABlIENTR472KipaI29Piq1XlPj51hldcgOWdV0O/zYOMnnevDt/HBC50/pOxJeRbPX7K/ /1f3Ec5Ps7cQP5nqMgxDGt9eLlyTQ7r+dfS6fcl12/qNvAvPNbAFe556sA5PaJvU56ta0IcjH4wf ZTRX3mebegaoRWT8eggz3zfmYy8f42VyDH7S/deKUIPU62oWZZm5OrbcQch+oxNacHpZv3/QTK/a 9I0GBhZnEQ7NVVNuruQBmT5M8PlYeqHHCQ/zVvflsZ4Xfb+ezM97vcDbO1o4dqpch6ofSkzfwJC2 8OHhw8JxcGb8KI0wDebLdbFO1/qMfTJ/iFLnm1Pb+28v8E2ZjtO5blvz3uH56ZLmtcqH646vx90G 62OXlM7QNy28j4kk6zmfI6XWx7+WM/GivZNPKGOvI1lXzfgu5PtAd5x1O02cYVkji4NICZ6fc11f O3hv6Y1np0abNZ3YINm2rZBrWOrNt42ggByD0g5/mfvrREn/P3Z4oZtnCO7X/Hh6oX1mw1j7Tmpz Te4ZMP+kfZdn8Cz7lQTBFl//5ub3y3nRxkOhdX0Y6XHXsfC75lnV7RDnZNBjp7IbgoUyV0ceNUtL j9G9KiaDtngNchm4kGu9tM1eEyYT9WB+g5DaqmPW1+gOcXw71PHthF7OTyb4Sm7ebx1dcyTIdUzZ D2smPhzHkiFv8xV6i23jk59C3ck0EOpbWb91mvKgfsOD/cPGPf7twn3hWP//N9ePhXvDotsty5Cs 6m6RkinBBan1Rn5d440yLDLmoC21/449uyG3TV4P2Qz0uCr64GCQfN5nCGzE+rtdBmp6GhC9reGx NM+cKXrekcGmTKA2SHEDGt/5/fM6sVn3G8lIfKq/u/EZeZqNfFagLaQdpa7wdZYgwsIkdEUn8urp /hBE0E63+7LKmwLPg1nzh66l1fb3oU9yjPfkDZbduk6uSHA68/U4bY3uUG/W5fjs0tuFXTs8piSL La5qIrWauTD2EkCKiIx/QeF3nl0XotB2rkCD03O3DTkH3Fa4f0zH4cZCXEYejqb42Xjhd8v49knB Y1zW/0OyLKlTnes+IsRyH2k6K/UNg+W61Kapr4GmudnR10RtByJjHfCdLHwG+t+rOLkEVZtcaybK IOxDzhPhrbb5D5JJmSfzToJamlW75aDP5oHUuh1P0zrPBbdNznvSZ5vS/lkzpLTfJLAtN62betxl HVR2TMNpzdK8r3DJta6rfXieow8n+j3pv72C10LZF4c+l9i5MwdCp8J1ONPj1/cbq8syyrloRvuH AM8H0n/Bl7xZ0h+dO7WUke56bDNAfXvP+Pa6wvFth/rUVlw4Xv6VjVetm+7Vy2fyZvRulphCg9om pm3y0bIevs45k1ZMTzrdR1oFx8RyP76ZHKd7KQPUd4/va/luznv7b+4jtJZ2Zt8FOBhcd1BP9IY7 yzLPLA4u5YZ/n0Ps6xseM3saZGPQJBdEeYIbp8lespgpmMW+BH4C6ZcimXwD3dZbi+s0v9mzOcCW 7NLdGt4QF2mjEz1X3TrYp+R8WsWDGgnWxgH144b2Y562mj4csn2esZQNOA+c33rW3j3dtqLXgcVS NXmO3RDr/O+6KP0RYPb0KqVlnTs8H83HSrb3z9zHTADt1jPF3oL5aqxiZjWL4zQPHPV8Mn+bqazx bVDXWY+DEB8cXwem1+FXL5/d0tpW+mtD+0uuVf9a6Lsyrl1d3zPjNai2oZ952zxe+P+uH5rI2wNd z/efnqNYRCX7R7JNNmNnvvqh7HOoBnTzjilkP9izXR5Is/6LvvmZOaM6xJrUnRQdlNXI4oHWMVgc RNuqpSM79kWeTEEzqxN+bvlmYpUNz/ukaCDqVm/IrQct5MGDlOcwdl+xq9OElkUD1BPtOycDGl3u luUHf3U8LxYJUMvN566L2qAaWN5P1u9jgXPlvHTQnidt3TEevFKp159QJ7aSjOqJzbIW+tZZnSbg kzYyoQWq9fh4qtdJsi+ztZ2N65yccyWzNvNDYz0e5XNcYn39jiGLzoYLx9cDuQ5LchDlWSzQQFW8 bN+XmtHmy8OiVkPbZ3FscH1PG82vNY2Jk1gqm+Brn+8n2yfnseie849ci/5l7Mx/U4WTigLUea8L +/r2h4u+jpN12zLFSoxKRvUkywOVoDKpdTA9XPNjmbNZNGDwX4urusnkIp9fYy96YpYDzlpN4YLB obS8zdy1kMnnLEB2Zz1tvwa1FXrdUAsB6lIzXCsIygWR4aX9eGXyPZEelDVBoYX9rdK3ihwGpzNn hdbkoc042e4tS31T54dY3mdUawZ7z5SXgVurTGpL80HkDk47HN81ri+rlNywfyrh+Bvoa9sop09t TmT+eWxbpxrjmpVp6+3qOW8yqTUg/1yvsWU8+A0h0z7SPg8hWD29Npc9AW2BAPWt7gPjktazSGwv 07qGVpM6zc1m5gNVB4jjktez1iwEqKU/JLBotZyELqtr3NbR2vC0T6Q/igTo50HOSQmr+87y8lqB H09FA4YS3NwqswSDBmq4Ofo2uJG3FvF+WQFq7b+xnivz7jMvqpijQevpelHvT+tPy8A8T0BW2l+O oRPth/nnB/3M//+e/ozrm5SW1vMu2h55avfOs9hOdHs/t0eyn0qyxeadNpqWMzLV1Mu89HVeCp0b ZF5r2kbpmyafw4uc22Id3x5bHt+OSxjfwp6TEn5HT4MKKIFmMjLuXd1G0/Ofqdnke1pr+kqvry8M byYt9vnE4bVpbL685ZD3Mx9rS4LhZkAB6mm7lhWg1r7cM/nrVE8f8KedMyG0TGrr9agXlm0zs6dW NXBzDuCL3KQ5z8BznFEd62RyPvWLjYcGpdaZTdb5vxYv8sFm/1gKUO9VuP55L75ZeZ1JXfCcU1l2 ZsH+k/PFVhkPtkos65HqXKLZqlkyR6SNpjVpi+zH+mBgXr7BhVxvpeR4g0DaYqTjqUnBfWP+ym1Z JS1kv9/0pS67nnvOTHWvHNci+9bSuNH5nCV67vngaF8nk9pucMJ1berP40AyqkvtV5sPyWuVSb3Q RjbvDSrLpNYs4Srn1ghm/7Dc56VmEHvYJjIu3qpq3oGC57hU16O6ZVIXOUhHJa5nLVkYwM9rHTt/ RVxvHvdMzZ7kLusTfbhT5OZ0eiGo4IbbZs3rfwV+TOW92YyrDFDrsTYwDc8sKXhuPKmyfID+7rxB lQ3j+AGFBCCTzyfj0UzpGpBNE3yYz7cggd9NfXMoLthf84fkm5bPoXNnefrIpHuDQAbdks0ibSFl pc5tPODQNpGxxQ96Lpo43gWc7/cZ98VPpoY1MQMc326VMam2HjO79FoQyiqJJRnVH9JmsKGwdzRB qfd4ldCa0x8Mb9CnZXPsdVKDAPWOyV/iY7fiiXF3Tf4YWk+3faVggtSaJbVO7kCz5UngNlKub90U qYU3D4QOylpZzQa7aMBNVdF9sVtRRpjNB0etgPuvSA1qL25U9bi+Ns11lnMfHPiQtaYPDvMOBjua jW37+GjpA7i89b1dHbc9sz6LUc6n82Dsnot6+RKo0mB1kZIthftTf3Zd/Um5cdnTQP2xy8x7ORfp G3f7xu1D6h1PxoF1mpyy6mtx0fFtaTfU+rDrnN7zm2ZAljU2mr6Vp5mfcCumCdbu+7c1aCeur9nP d7aEHqCezyGRR+UZ5Hr8FokxnK17aBpSJnWawX7RnT8ueX3rNIgvMolM6QP4hYH8sXGfVVVFf7SM nXIm+xVOONj0uopnpvhbCT69KVD7NxfuORblHNPLuf/ve9Z/ufdlDfTYPr9VcZ39acV6na0ZdC4G p4/LOD41WLVp+Xyaqj91XLBuEC7tsVX22wKa0brp+CbZh2zqoOdj8ERQAeo7x9Yt3ee9MsdG07d8 NEACR7QGL9KdH0NGgLq6YywOdd01OJt38tA9XzLItQ/yjt0js6bMckhB6idr/n1iIftmVOL61kaB IEzVA/jFgXyd+sNWgDou49XUFUGExgapNfuwV2ARe761nwbk9hvWjx0zq5Oc57y469NDBt2f8g5G Noy9OR+MKfaGQVHRkn6WCek+rNlGyZbbKis4veTYszlpzcr+TFlmalxVeyy2i84f4eo6F7l4iyCj gUGRc7iNNwTHVe3fpsZvC9aFZqSVWRJNzt8ftBYqUKWPga9/TBcih0uT7w3Q6+R64duYrsjD8KNV b/YEEaTWjJ11g0QbJwqbr1y1bGaOedw3Msg5KrCI/aqDaZrBNalJfxSdZG+RD3WEGxeo1j48K7CI a8vli2wfa3FD+nH+pDzXRb+MyQZzDkbyOtIJvWzdZFclutPPEqxdVX96/sBht8o+dRCoPtJz1bLz 17oajVJyY8uXB2lazsbV9e55xZu3z4107nP4sSn2sLjrwT5+bsim9t6rl8+uTfkl0S5fv3l7SZ1q Zzjv1l+RUnhooOR8K/cMeSoPlP0wM+21S+5rijwMvzeGGEomdSfFzxTOgtbBpM3B3E6dDzQLwbRK JwS7uy416I/5ZE02BpznngTJmnhzVaQPvbyI1e1Yc9yPlb7BsOYaKeeEIufsI0urUuVNgWTHSrmL Y52w8WxFP8+zha896T/bEwZfLj6M14D9ugkS96uezPWetpH92sVx16qyNvVCtviW3lDLdk4M1o2n dgqer7x4m4ls6qDsVXBs9sysTjXlP4CMpOxC8pFra1fvba4NDwVxDz3P5o2b7VU8UeIqRcbOvfuy qUMJUrfT3Nhb+l1xyesd6gC+SD2daTv7MCHYnRvUSeD9YaPEhzFf6qb6oFFPqDVzq0gf7ntWh3rZ sRabmgdJNFiX9yGl7yVRigQ8diy9YTQv0RBXdEMg/SsBrGjNuavrW0a8Bs5snd+nWdMasB+a1QH7 6SDb1wcw2jauso6f+tDv0vY6UafU4pbPnmn2hLb3nb/luC5ST3zgUQLG/AaSwInnFiaiKruv5nWq X9ALQK5jN04+x8lnN/n8YL48FCbLGovyjitifdvG52tXkTHP0oSAumRSTyzeCL4vcb1DP9CinN8t OiOoKyFnm1wZexMkXXgU6Pxfg26MW6ZY5lbs2Y3xKic17seNAv048L0Wu65f3nW0Uptas0PlgYwE gX9IPt/JJ/knuTnomi9ZLXI8TCpopnmA+tbTPjy3ePMU6f7eSbFvh3B+chEk2vFwH5Bxs/TJrh43 TLL39Xgq78O0ifHsQaOeh3gYEQCdEKuq/efs9Zu3w1U1QgGkO46Tz7lmWW9yfUVyXj02+eM0ewFs YpEYWm9Z2Snvg9Ql1qN2saxoWc3G0Gkd6iI3XXue3rwPAu2PM2PvgYj0y7lBJTcIBb8fUuC3zjfM ect8hDSx5LsC33WWVarB61g/xwtZozZLXKzjdYB6QZn7WuxjiY/79iEHbbNRZcmPlMfNsd5MBzkO sjieKnIj6fP4lpIfgdCJsaoaC8h5iqxqwN7xPJEsazPLro5pkebRB3955ycZaN1n3/dzufcpsp69 u/8hhEzqNAP7ka1fphnZk5LXP6QBvBxoRYJpsceTuhV9XaGK/pCD2uZgchBAcKWON8a9gueKWMto BKGumV0aiMr7AO8ioGOvSN9FWu+1zP1NzutlvL0jY4cQAtTzsjtlnDN8fXNq3f5i+6agE8B23+rD hKDGQRbP30XfZjr39Tpc8A0YlH/Df17hcSgP2cmqBuwe0xKs7hreammidaXwVmlKAto3QfwQgtRP UvxM7FEj51n/kBSdmM/3bKp3oXSEhYkrl/Et22Ziak7fFmlSFvXc+xp2Z5F+HISykfowt0jA40kF 6xwb90HZ3cAe8pVxvt8L9MGn7XNqO6Dju4oJ3HwZ3+bl01weoYzvsMKrl8+qfmDUMWRVA9bHRIbS H42RnD/lPJo3MSeILGpL9/XR3Ql865BJPXEwMdGoxPUPhma/FdmeE98mkVpycxYHdHNW9IHBXdce 9k8TbpRfFOzHoLKoF/e3OnWiZsPnfU184Pu50fJgpKoavSOHy973vZ74kuvdteNzrLdvTqVom4Hl G8nQSr/Vdt6Ae87fx6bmkxbrNZfgSEA8CFTPs6o/3A0gAMh1TAf31jYKKfJ21kVg+3ZccIzxVTlI r4PUWloiWncT5OLGyvJ27IR+hGm2Z9Esk1BqHb8LoD+K3lAFud01vDGW89vzgosJMjtKb+jr9Prx UcP6sMh1cqOi62Lsark6GWGIXAaRQw902ryR3GC/qO11eBLCpKBMoBgmDwLVRu83JFB9tmyCKwCZ vKcJ6i85V/ZM/uTOWOs8h6bIOn91X+h7JnWajrWeGaUDOZs3s+0aHGtFsz1Dqrfq9c2GhbqJy9yG mvEWuKOCx9Uk8H6rRZBas6ijvG0QWgaupb6rUyms/YDX3dXDyVDf8HDWNj5PnnjPOHjSkOtwkXqR 4oTjHS55Eqie3wtKsHqHXgFyH88xrdCYe/ymXauLxGWjxXkQfA9Spwnuxh428l1BX8w1y6TIgRZS FvW83uq1J/vOfTdUtg0Mqjiueg2/4fzIQCTMPrQQxOrUpO8HgT5kmPfj2LgpARB8/VuHbROKSd03 sOBkt9M2CiGLemGfjk0z640HTwPVPjwQkbHrFRMrAsBymkVd5PwYagJa0fuhz+Ox0DOpJw7reNrc OSINSIWqaNbuRYATJ3n5Ko5mbHYcLJrsmvL1LCxjEHgbBJ9JXTCLOuSByPQa3ODr4lwdavfGlpdX pzdzYoM6O2rg8V9kvDdhl6nOq5fPjo0/E9DLvcin12/eHlMCBGje/Q9Welrk3l5rlzdxv/6coOxt kFpLGqy7gXV28+AggybIbGpL2Z6DADe9yAQzt476YsPYL/MxvekIORMw0ONK+rJoLeo4wMn2SjlW SlakH8eB92HRt0Y6gff9dQ2OQRv9uOz6WRc23/Zg4jG/rsNFJwO/DSmL2tKYfMKeU61XL59J/215 NH6S+xJKgADNu//BEsm5sFNwbDEKdduT61PRMcLndvM5k7rjQSfavNEKtS510dISgxBv4gtOMOMq 4Cu14CIHy425pJSuZ4pPpBV89nvoD0f0VfFWg/uw6CD7ceDbX5c3UGwfhyNTHzavj2Qb1mt8G+qk xRNDFl/QdEKtLY/6Ue5NKAECAMWyqEXoiR5Frksb82uIz0HqKutRu7jR6oS2h2kWddEn4yHfxPtW 8uN5Q7azCWz0JRNdhj8QiQPf/qI3yCFnltappIXtQEdco2N8wmmufiyUaRKDgJsg19i8BpOh1oZm rHU92w/lXndaAoQeAtA0GmDtFRk/B1zq4/P9kY17w5AzqSclZOjavAHdCGlmd1W0tMQk5AGtBiDy HGjWMxv0hmrD4XaivJvjHQs3x+MA67y7uphV1Y8bBQcit5TZCbrcR1yXTrB9LqlJCZTabQu+UvgB Y+D7xoBdIHwSzNAJFfc8G0sdvX7z9pO+9g4ATVE0ubMObyLWN0it9ajXBeSc39zrjZvN3/MklL3L Ui3qOgQ/Bzn3G9tcZVEToA7v5ljUaaLLUAO1RQcicQ36bmLpWhOij6Ze4oYfz2gITRjpNPkanLOk Hce2p7ROddezPpJru5T/OGNiRQANUXi+qRq0QdH7o2kpSF8zqdPc/Jf1pMHmztJp0EEmLmpwoGW9 EXGRRS0PbVy9Fk+pj3JvjiNjZxLVmNYM/hwZ/NNyS5mEUaCbzzG4XB0nA6KvOXffVYcH/O85tutD 61RLoPrcs1WT+XQ+MbEigDpLznGtovc0yXmc8aa2oa9Bah/qUecdxK3S0lfEQ9Ar+P1JHV6T1dfx s2yHi0H8U4ebSCZ1uWwM0ikTUTF92FD0wRF9qNfFQNe7bgGbCbsiGnLuLnodvq5Dua1kGwYZz2Nc szyn5T/2k7/uenaNkntfmVjxiqxqADXV9HmKrN4X+hqk7qy7OSwrSKM1lW1e6L1/kmyp/nGdgp9Z MsJd7Jeu9plBjeoaN+UCxkXMD4WPSSag+urmNTg1fFD0F7siGqBnYRl1egMty1idc0QgXr18Jv26 6eG9mIydyKoGwL3htyY04RfeBalTTi5Y9s29zd/XDmC/sBFIq9MgfpDhZz9aPh4i4+51+DrVNfae xbItI1oz+HMkA5EvfqIJAAQ0vo1r1B4XDd3u2tOsasmo9jWr+pKsagB1YKPUh6nfXDdF2rPjYyZ1 mskFyw7S2Ay4ev30WIOinYKLua1TlqBmGw/SbLexn7Xg6lX4mEzOIG+OuVH04xxZ9Lic0JKfRTQB gBLO3TsWzjfjOpSyWxjfjlOOKSaUGQuTx1nVveTzQYM7AND0e3yusQt8DFJ3UvxMXPI62fx9G5pR 6aueZ+3lC6nxti4T4cJB+QxX+8oJpz8vz21pbyoRdj+SDQ8A5XpiYRl1Hd8yZqyxO1nVE49WLTKz QPUxvQQgYDaSUCc04xdeBal1UsF1QbnSJw3TrImxZzuyKzaeBNUuAKPBZ5k1+74g9HnyMy4GWY8d LPOaLOrSz22RsfPAgX6r3hOaAAAaeRNZx/Gt3N/srfiRE51kEYHTrOotuWfxbNWOXr95O6T8B4DQ JOctucePLJyfJ7TmZ96V++ik+Jm4onWz+Xu9rEutGd6RZ23l20BeBneSdXKiHxnYbyb/tu/o19oe sN2adFkz8O/mWJBFHcZ1qhHnSH2w7EN7AsCqc9WOpfFUXce3AzMrCXGyZHx7zB5UH5pVLfcBkngz 8Wxs9YnyHwAaeF94SzN+7XvP1sfHetRzUpf6ha2dWW7uHZSGKMpKzdw6lyPQrPrzgDdhv071FANi 68HUXzRldfRBHpk+X3AzCSAENt6AGXs4brc9vj1mV2mGVy+fxa/fvJXEmyOL97dFyfhKyn/sJes3 oJcANOQev06xMytVAMikTj94k997W/K2+tj+XvYPUhkE+MpmXQKCZFLXg63zNk/MASCsazDXX9TK Qlb1lmf79+XrN28v6SEADbo3rAsrsRtvgtRaszVad2NfcZZubHFZXtU1tVgzl0G8nyRAvRfgegef qZkcWzYvXhxf1bKSEV+jt00YmAEI4Rps46bpI62JOnr18tk4+Uig2qcJMnuv37y9ok41AF/Zqkdt 6pW8ZCV241MmdZqb3bjidXxf45t7W+vDIN4uG+VtzgMNUNeFrWPrts6vGjesL+viMU0AwHO2kkJ4 SIxae/Xy2bHxK6ta3oBgQkUAdb8vrEX8TIP29cqkNn7Xo56LLS4r0uzlug3iJ5yvrLou2Be7Did1 LEO7Bn1oaxu4Qa6Qnq+5UXIzOAMA389TXINRe3eyqn1IjJCsPALVAHxEso6j+0IyqTPQSUVsDlJ3 6rZTae1u2NvnZH8bZPzarQ4ut5LvXwfeBHWYmM3WNkw4ItgXffHowcOeIWgPwO/z1IalczdvMqFR FrKqfbivI1ANgHtD/z21tSAvgtTJILKV5mbXkzqeNi/W7ZDaP4UJx6Z9WqpjXUaDtP3AzDKnf0g+ x6HfUNUhCGbx2BJ/cTQwEPHIc5oAgOc6lpZDFjUa59XLZ5Pk003+um+qz6omUA2grmOM4CXn5o6p YSZ1mozi2JN1fV/ydod0gE04RN3QoPMPZpbV0L3zkaD0pgSza5A5vagOQTCbgU2yuKrVpglmHj14 eGwI2gNoznmb8S0a69XLZ+fGj6xqAtUAvJCch7gP+tIWck6+tLlMX4LUaQaRIx9WVMtZWAsWJTf7 PgSqbdXTYRDvfv8byz5451O74GVyXLww9QiC2axVRSZXtSKa4POxeURLAAiArXEEbzKh0TzKqiZQ DYD7Qk/ouXhouz18CVJ3UvxM7FF/2FyXdiDtzyAepdASGXUJgvGUlcHIfft4aMflTvKRQcgZuwKA QNga305oSsCbrOoWYxEANbrHD+5tXQlOJ5/j5K+fjIN4x/c+3Pim+TnPJuSTkh+2MqA7Fbe/PP2I LC2OcgQouj9OMyRMfSZks3nSJpO6uv3S9nl6x/f+1GOxpQOnHcMkiQCae96e0KLAjGRVJ390X795 K29WVRUs7iW//y+d4BEAymbzbelOcj6L9NzqrYW6023jOIb5vQfbm+bJQexZH9lcn1YykI5+//OP qnZKgmjw5YayVgFqfQBkbVvqWNYlILb3yaNk/7hN+vTcg310Prmn/PmTmT207NDlAAIX0QSAO5JV /frNW7knvqroeDtKfv84WY9regNA4PeGV8n5bC85n1UaT9Na2/MkVvk81nvEUs/xPgSp09wMj3za IyWgnNzcTyx2lrTBoKLNoRwBKqcZT1emXtmaHFv05SpnyX4vZW3k5uqj+fKQb5LloeVCoPnuwGnx v/3rzv9vGTKjAdSbtSwnz97mBLwhAZXXb95K+Q+ZNKuKeZYuNVA9oTcAlKjj4F7zg5zPzKxqw0Q/ cp7NNAZZCDQviszXscufFv7/hvEsblFpkFoyiFM2iI+DQ1mnnqVlPTHVBaltvqpApifynAeqfF3Q pcjisnhLoVo/OVruxrLrSHJMNKltY3YvAA7woBgowauXz+T+b7ei8h8yjpIAeZeeAFCTsctX45fk 3Nq4Rqh64sROmh/yNINhVHY7OBLZWlDSTwTSkJpkgCafK1PfyU8ii8viAVB9+hIAUM6NHoCS6KSK 3QrGrB0NkAOAc1qbGe6Mqw5Sh1iP+nPjWVzWhtbjZRCPRtD9XWaD3anxZj6mp2uD0hgA0MzzNg+J gZT0tfQtU/4bgFKfOqIHACB4t1UHqdMEqEY+tpyDrOGqgnUEX1CqRw8e9pI/PjRg3+PYqg8e5rkz oQkAWB5ndCwujrcEgQy0PnS35GNHxtxHtD4A7guDV12QWjMp0wRxfB4c2ly3J4EP4oF1+5u8MSB1 4y4bsskRvQ6s9RdNAMAyHhIDFZI61clHMqoHJf7aHq/hA2CMEfz1o9JyH2kvIj4HqW2+AtiSIB67 JepIH0pJ9nSvQZsdWVwWmVzV7bsRreDUNU0AwDKynAAPvHr5bM+UG6gmmxoAwjWNeVQZpE6bORz5 2HoaULY9CO6UvBkdjgOUcKzIZCYfMhzL8vAnNtSBXPQ/mqAyEU3gbiDChLsAANRXyYHqDtnUABxj 3il3LuR/vq9wBdJeQIaPHjyUC5u8Ehx70HASmP7JzDJCbWc+S+CerDLUgj7IucpwrMtx/u73P/+I F76fJbjt07ZH7AHASpPks0czAHCgTRMA/pBA9es3b40p543KI09iBgDqieoHbgySa8VA/lJJkPrR g4dZJwnsLVx06qxT8u/7iWMBDo/xy5QncRlInsyD03PJ/79NlvMu0OM+Yi9ASpJJfKt/NiVjXjKo eSALAEBDlBiolmzqltQ1pdUBBOZ24d7wY4O2OV48Z1eVSU2Gw3KR1O4t8fXniCaHTZr9LEHlFylP SBKcPl/zM0CVXNU2PUk+g2T/n9DEAGAVWU6An/Z1XOW6bvxzw9taAMIh94Mn80zipquqJnWHpqdt UC86OeLQpAtQx8lna02AWpAFgaq5CHbsJ/v+MQFqAHCCiRMBD716+UyST7pmFpBxaef1m7c8rALg QmR5eXI+3CJA/UXpQWqt1crg8X5PaAKEJjmuj82sfvS6Y1sGpxKg6xKgQ0ONUzycAQAAqB0NVO86 /jUSoN6htQE4EFle3omeF6GqyKTu0OzetA99gULkoVPykezpNHWjJSu625AAXcTegXu8pwkAAEBT ae3Rfce/hsQvACFgnp47qghSc8FYI8fEkkBV+6lkT3dS/Pj573/+sVVivfWqRewhuAdPygEAQKO9 evlMklZcBmco+QEghHMh94Z3kEntJyaWhLdkcsTkc5n89cqsr9c7faXv9z//2KflgCnqrAOAuzEK JQWBcOwZtw/vOzQxAITl+woGjlmeaA7M7NVoX58uyIXvqbGfNSkZqgT14OvN31XKfV6CcbvUnga+ EtEEAOCM7czJDk0KuCEZhK/fvN3TewsX5A1uXqUHgIB8X/LvS1vGYp59GXvefrJ+x5pV2rO4XKnz GxHcg090csSjlD9+TvY0sPz8ThMAAABMA9XXr9+8lXvqjoPFd2hhAAhL2eU+0tajPgkgQP1Zsq7y BNj2+gZ3UZUyEBxS9ZNxckR5wLRHgBoAAABACq7uGyLqUgNAWEoLUmsAM02duPj3P/84D7At9ywv L8QJJqkDWDMZJ0eUAHU3OX4HtJz1EkXUqQcAAEDtvHr5TEoEurp/4P4UAAJSZiZ12lIfFyE2pJbm sHlx7bB7oioZJ0cUMrjcTI4DJoX70h4AAKAGYyJaAXDuxNFyuacGgICUGaROkwk4+f3PP0Ke3MBm gF2ChFxUUcXNmGQcSHmPXsqvDMwsg/qW1gMAADVDJibg2KuXzybGTTb1T7QuAISjzCB1J8XPBD37 rmaR2sygDK3kR8QhFbZHDx72zCxAnfaGbCA12QlQAwAAACjAxRvV3J8C8NbrN295EH5HKUFqzcxM c4F4V4M2tbkNncC2nUFAoBbKe8gn7WutJzppKID0qC8OAABwh9amtl0yjwAQAJtsJ+dRUuyOsjKp Oyl+ZlKTerY2s8Fb1MGDaznKewjJnj6m9QAAgEdc3EsQ5ALKYztpjXtpAL6PM7Dg+5J+T5qyFdd1 aFCZQPHRg4cTYy+rWCacHASy+dT8CoyW9zjLOICTAPWA1itVhyaoTJx8jmgGAAhiHH6bjG1sL5Yg Fwp5/eat3Bf2Fv7T5NXLZ4yllxvovYnV9tea1wDgG8YYdzjPpNZM4E6KHx3VqF1tBtxdvhpu+1WF iEMqHDnKewgC1OnwhBX3ISMPAMLyL5oAeWmA+oOZPfCefy6T//6B1vnWq5fP5P405h4VAPeGzVRG uY9Omh/6/c8/rmvUrjYD7jsO19N2II2nQAHQ+tMyMO5l/CoB6pSYSBKcJwGAG0gg8fyea3/r9Zu3 OzTPUu9pAgCe4j7fsTKC1GlKfcR1alTLAfcNrRnMIB6F6b70KUdfEaCuvu8iWqESE/oSAADk1Fnx b0ym3IDYAIBa+Wh5eY9p0q/5kkk9qmHbxiW3oReY6NHrvumZ2euGWfuIAHU+lNOpAZlnwMFi6UsA CGMMHtQ4HF5q5fy3xnr18tnYkK0IoBmIn93hNEitWZtpbsbjGratzdeUnjhaR2ZAb4iF+tNZEaD2 6/hCPUQ0AQAENY7iJhKZaT3qVTq0EuNoAEGZWF4e8bM7XGdSp7rw/v7nH3EN29bmNnUcDY7/52CZ DOI9u6lKPlcme/1pcU6A2isRTVCL8zl9CQBuucjA5CYSTq73r9+8Zd9abkQTAPDQxPLyiJ/d4TpI 3bh61HO///mH7deUOgzikYU+2BiafJNvXif78D6t6NUFLKJJa4PaYwDgzkcHy+QaDFe4dypnHA0A Xp6bXr9526FZv3AWpNYAWZrGrvNT0tjislyU/HDxGhXBFw9oqZ0POQe+sl/s0YqF/WV5ef+iSStj +zoV0aQAEBTO28gjzb0wkycuN6EJAPjm1ctnLs5NjDEWuMyk7qT8ubjG7TuqoD2zuOUAqx8NUA9z 9oXsE1KHmslK/Du+yLShLwEA1dxbEEiEK4wJlqMmNYCmnJ8imvQLl0HqVJm/Na1H7WKQHD168NDq zqslSRho1chCgDpvbaN9R/sFFy/Ql98eqwAA+0jCQEhar9+8pSbpHa9ePiNhBkBTxhk8CF9QdSZ1 XOfG1WDfxOIidxys5sT2Agm+VMNCgPqaiRK9PrY6NGlleKAHAGGNv22LHE1iDjDGc4+ANwCbbJeC 5L5wgZMgtQbLogo610exxWW5eMIycbBMDrKSWQhQT8t80JJWb5InDvqZG+Rq+vLWwQ0O9fsBwB3G t/BB2ms9WXTLWXng9OrlM95uBODzGGPj9Zu3Ec064yqTulPmhcdzNgPxLjKpmTwxcFoGpkiAWuxT h9rfwTU3yLXsyw5NCgDB3EBy3kYeG+xbhXBvAqAJ94VcBxa4ClI/TflzcQPa2Oo2Pnrw0PbO+5ED LFyaWXtligWox5T5COYmmSB1dXitCwCae84WJGHAFepSu0MWNQCrHL2dwRhDWQ9Sa9Aszc33uAmZ m/rKv82d+InlVXRSa5WyBKW5MsWDXfs0ozO2HwL9RJPW5ybHwUNHAIC78S3nbLjE/uUG2dgAXIi5 BrjhIpN6p6JObcoO/P/sXUFyG7nOpv8LRHOC9NR79bYjn8DtE9g+QeR9qqxkl5Xs1ezGdtXsLZ/A ygncOYGVE7jnBNGcIH9DQTttRVKT3QAJsvFVqZxXo6dugiAIfABBUuVlulxGF5kH/O8//70kkHNR 6UCh0owmSNbq23TmEnCiYlUoFIpobPYIW6wpFBxQnyAeW6BQKBTkcb72pf4BDpLa9uKHLwOSM+VY xwwOchFQD5IDXGIIBHL1mTA+I6/+zAh+6krNICtK6s1LRRoGeCqGej5zlaxCoVCw2WyOCsrTocq0 4d+eqoaxQH2CX0ER8/6jYlQoFAzg4DN1HzBaSe0LhXDl1SORdA48tDmBSwyBQL6r/vc10zPuCH6q 1Cpq9iCZem1pFVdatnys86lQKBTR2GzAIIswGpd0g3/7gKf5FLTI/vzrby1G2JCJ0DhXoVAo1Mdg AilJDRl2Y3eB2yD6UdfAsUruS82RBRoq+XK9sQamDP25Z0RO262awCg3MA1gwkEz5gqFQhEP9HJw Otxt+LcXql4sUJ+AGJ8+vi9UCgqFgsG2UHN8AD2pZOgrqd9Zfm+IGc3Pgh0Yrs17UI4WkvKTLf9p TPyMKdHPLSIQawoXcFITm5phDQcOW6k9KBUKhYIHHH7OaGjtLrDFXL5FDnpJOj3eqQh+gKg3q1ZR KxSKmGLDUWX7Bk9UU5PUueX3vqgC93aQyYhPhkrvGkMjX2YRPWOJ/RqlI4WqYb08MREw9aU+HVqg D+OtPo/V5zv8Vc1SKBRMNhv2X46Tm0NLFs/UH/Hn9+rFWS+gkEOhYlQoFIzg4DUHV8BU7XuT6vMN PxMykhorPG2dlcFtGAy9f6kzLBxzMhjyBcc5YX5GRviMz0bhC9RrK1eRBgVHZd5kYDKcNfQ410u4 FApFRHswhw8u2b8d7/I79F4TNuie+AMZwW98UTEqFAoufPr4HuJC6mT4oPaAP//6G3i0umUufGaU ldS55ffKSCo4OUBJblBnWLhIy6EssqmHZ1BWascSWLyJXTE4TiooqRcU9wy/OZjjvZjQ27SXWo2n UCi4wOHfZgPah7X3tH9oyw9cZwOKd4YIbV+oSAXUdgZafkwGJD+IC5uFrRklSX0SaBJjAmU2d0xZ pYzVEBxHIofi3O4bJxVBeUo83zEgFfKKWt7q2AUCHh8vqfWcsoWTcExUixQKRcT7r2vcEy2IT/Ap HHwCbflB4usu8WIzhUxoT3tFKuBIhg8pWfnLWClJalsC7euAFZjaUaau4uA4xj5GJzdlJ36yb6PF Stq+zzgl3MxjukQkFeLus/C1rwhvK4eS0NMKMYVC4Q14epPD75kMoKXdJBFfMkaon9c/BrhXGcgE Hu/XU3QKjQt3Ix9CsrIaI9iBX8ZJQlI7HnkrBuwoU1fgUVdTcrX8SJ18mXlw4innuoxBqFhZOkpk 7YPdo6zmyFJP/ggHR+CTPOHheHeFQqFQSLbZa7udsL0etfjvpaoVKwbdZgXJmb4+0SIBUaTqF+a6 xBWpAE9szBl+ejYA8W3d66gqqW2PvK2QqB0yCqkGvpobjsbvayc+VfIFEzTZnq8sBc51LKcZ3una 3wutsgkEppYfgGniolOdVSgUIcBFVqVMJE7MfoLsq6oVKzKsMBsq+sY90OqjTEAObxOd3xNd4orE wFHsOcFTB4OLDalIatuNRI+G0falzhj6mHI48tsuykoFbQEKlRM/REc1NUKLevPStglhccthTxKv pt5lLwtVJ4VCwQVs+cHh32bY8m2I/q3GdOHnIGX0PUF6m4gcMo3xFAr5+PTxPfgYJcNPJ1vA9Odf f+9qZ1v2JqmRJLU1oF9UhcmD8Zz497g29eTIl2o8uYX8C6LnUGIVgWwnCTpm1AHykC7bk4g5w28m m9Br8RVKVSeFQsEMrpZ2yR3HtfTBClUpdgyhim4X+pCYK5NGqw+OOD84Kp2eGL00UZEmOFqLXSS8 D+w6UVFSVFJrP2oHMFzgckL8fkvDUx2RIvly3eYkEbW3oTZMMVS/zBJc+xz9qlKoph7rfL52RhKt pn7Xsi8qFAoFp80Ge82RpE+qmhr3nzb/dklxKbjCCtOhDXhPdZ0tFtgjNhV55IlN8UyXtSKStTdy vLzwhuE1bPbkKGVrdt/r8YWCpLYmSfHyMAVxX2oGQkOrqdudeFhUbeQaVRafmsQbCZftpYmgirp6 z2n1ecSP7RxRV3Kl0O895ve/UmfEaq3sc0TUL1AoFL7A5d+mRLpMLfblz6pK3jDE1m59C7CuBIyB kiTPU5lYrKLOdFkrItBViMW+VZ/n6t/fMHm2F4wXKE4SvKNgnzyXvUjqKvAEI2MrMO1d9hPUbU9I Ny+sNikZxj1KwZG3rDKR7MSPBct2HIOO4IWZ17j24HNnubao+1WNTMR93XAPiRaMfU4nibVy2VcV pW3AFAqFL8yZfjfDBHvs/i3syTZ9kBeqSt6QIbE3CGB1XR+/di7kwkTKi0VPEppbraJWxKCrEONP N+Jt2zsCuJJkqVVT77MFRd9K6tzhu4WqPJssjhje8Z5p7FOGHsshFlVblckKCUmFfXAEMn2I5HU3 SemxQ0XzPYM+xopxYJ1bEwuYdOiKW086lqojonZSoVB4ASYW50w/fxF74hX3nTZfZknUyk4xDD/P FX1bfVwJGQdlJfU4kSpKIP0yXc4KycD2Op3bLGGSjMPPyKt3myYk4122YAkV6X1JapfM3ldV+xcn GTaugnhDp8aN4btg7zrWFgVIsNsYiLngYbwR+l6PjM7LiFAHJjt+z9aBpNaNmPthHgVcy6BrTxj8 PXStgsM2VgXDK44Tqcyb7FnXpZIdCoXCM7hILPALok0uYrI2t/jqvaqQdwypmroPIS+lihpA7dtc xDypSEppFbUiBlDs41x+xsyxR3aMdn7tY3QmqZFkdCFHNRB9Dcojzhl19QYS6VwVglG0dNih87aG 61bwUMYCZXvH/F6Uv/2u59oCB3ouyKkPiZCtSjYrxvoEAOdcm3jMJ0/QZmoVtUKhEAPmamq4Jya6 SieMIWz825WRXYQhEVTxb/IEX0t1nY1uSqmihmrKgvgnJ7GSU9jmgzOBlxuFgkZXL/fYoJXD+ufy M6JOhqOMJy1rdh0b/p8vg6DVUr+AevOKrZp6GmH157Wl81RgECQVokhqJKij0AUM5CicIeokRnT9 MLHnchbo2fmWeRx17QPNTHo8RHw5ZtvRTq3IUygUIcBJZl1HeKfAg7E7cbbAIhaFPf6l8vMGUE3d h4i/FVRFXWMpSD6h7Qurv49EuELRV4f2FSy5doX4YHh4tBx7Zscq433vvqzteB+S2qXVR6Gq/xp4 RJwSRwzvuMIFNnhHHitjbJ3DK+HDGUmQOxBvPglqoorUfcmglcPaWjLYxdj6YYY8urirGr6Pk8vl jMA7Pca2x1lcgqqtPhQKRSgfvGT21R5j2Y8dT7JdqfYExXWqZFw1Ltt2M1v9iU8f318KHBa1nz/B avOY5vXO+Kl0Hqt5UPTEtCUOdFrP0FfZ8J2sn0aatGy79+JFXn1IapfK3VL1nn3zYtkAKkd+bvha tYzQkRe9sWDFt23GqmBIQHDgXWCZ1sSbTwNLsUYu9qwV13VyxbCeojgChMH7JKVnY1KPK4AfI5Fg Iplfm0tQb41CEQc0+E0TnKcF1zZQ+ikYxwKMufBTgkNAWwutmNGnMvBc6Ji+MPzmXQyJCnjH6uMz zjtR86Dooa+ZaS+ecubDMHnGxaPdxXShKpLqbcV+L20gO5HUSCq6GMh/VP3ZN68RY+9Szmpq0UQ1 EtQu5BAHSVUw/OZpQJnCRvDYEviX6HSeERr3k57vDesro5ojTGbMicUbSz/MkIQrWwV3Nac3hu/k 0CQiorrtElTta6qICXqMOEF4OC04Rv9WpP44FmCI6vc7cExjIiYsyYtL070dxA1D/2cSVO+1MPSJ sMwIL0hBwg/8wNzjY08jU/vcKProGLX8Zi2+3hIro7uA0894jGE/wHdss1uLpoy7VlK7VmHqkV4/ cmHJIiKZdsMcAIojqjsQ1PNIqqjXTk6InuA4x09mP0ENMjyEKv7qAw4eVYXEuGsix+LSzK4JJ46g 71ryZXtIonO8X245j9x6f274qvPEE9WWR8dvta+pOBypCLbqc6ZSSBd4WpDTb6uJ6kyYXl87+re3 WkXdGRxyu0tFOEhedK0OB+Log/AhclwQfYptNCTOZ24R59WxHqXtzTDZMTTElkQvhersxEJfOwGT aDeM8y+aqMZ3s2lb+YoT6UpSu2arNBglVniieXHBFbNhqYnqiYSJQaLlzlHHWRwlRuJ75rPCB+f2 qWVDBWL6uElgYRsNqoTOdY//X0bthDL2xXyQeDoByfOQlz209RujWK9cc1oDiGpxx8ixx/yDhaO3 MrxJz33I1e1QOILSjr4ZaPArfdycicVah54kJI8bdtrlxBXcH3CppqAzOGKncawXZ22QF33a1MGa PYtgmFytzSaSiGps7wE6+diyd0A8d/jp4/tj+BD7y7MBEtWxnaqgsoc5ld5a2qDPfZ6DyTTO9rlP EntUNwjqNn9yvnnxrTNJjdUAmfocJGTGitgxzriIKXxX7p5fa0MBBHEoAgbkV32ASHVd6OfMlYEc hg3W8cyDTEeWpD8Q1Lt07J5qM3epRLW83LHvBXA3DEGMuNMJ+C4PAZ/fdmszpb2EOV0wPuJU0vw2 WvjYJEpDVlHHRhJqoBMeRwOW8XgI48bEInc1Zr0nXwa00xDUPxn3gpZzNQMiMcXLBmPGdQ/7cLZJ akhE9Y4cF6XXAKL6IXSP6kb1dFvyC4ioQ5RJDWpfGYjqZyDMYX3Au0nr4U38PrH5tVRr9g8qfTHt vOaKqKUQd0L8TlLyEknztuJEY3YUenappI59Q5QGavKRs98qLFAfPelAqZ99VlUjGXlt7I4obWKB bSli0pMXJ5dTzo2gqO0Z+whq6vFDJWrr8dtG5Xfbu9/2XFdcCSAxRHX1DmtS1fBWMb+1cER8Oqrn hrfVVX2MfCpgbm3tZuiKvDHhuJPpU4y2kGo8qfVvPpWofz58IsKfy6SPF9t+zD08Ck6wPfusqob1 jcn2xw5zcRNRGzup4CYlokwwIoHRNf44l9qHegc4Y+e1D8bQo9dmDsd4OaKNbflQzdkvsc4GYU25 54Bv/IDv9q16z+9IXkNrhMvACZ6x0N/yAap76k77kv1og2xiKBLfAHWdO+kLycunkPsCnqqAtWdb FHi7rd93F5L6nVFIxoQzeEaCYeFhHHVV9TMziZohOf1s3I4/1iiNnyqTL4y/fUct4wbpb+O4tBHU HC1PwJkD3YIjuJcbH2il8A2Na9u7k1wAx9j3PXgbHawcezD85FW25x1OLdc3WTDZSD5wBqgg02tM uuSe5xVOJTw6zu15QD0cGdp2HylVHqtctutMbmgJ1pHUS6KZdSKLpLc353Hczb3qkdtuo42+Q/+2 iw+wrPaxD0ZBQUywxkrSKkUtSIyJ6d7mAy5KnEemA+DjF4yPWNsUaP+BlxZyz1+O5PST5V4BSYUb AVOR4ftC0coDknkh1g6lH5BHtv4p18G0hw672KB7QlsAHNqVB/16wmSMV92onjdFn8M2CQT3Clxu +w9OJDU6mV0W1olR+AzouCvruCsENzeUmqy+pgjwkJieIsFSk9NdF/GZp6Pr3ImBO6pjqEiI2pL+ rQQ108bWXH+zjc+pgz6QtS7AYJBjXdUJnwfPPcjr1jkzT4/Md72HrSPSs23Lrt+DnnsrD2N/xFZJ Y+Z5zZH4sA1OXgLLwBV51FUzmUkHF9RrPxG5cBybjKXQ40SyjnEA9/Iz4+8endpuP6NPSuHfjvG3 nozdSbBdiKXfbyzg7nn+GAtR1ZOgnkdwUeIu+HjvdfyFZPWYeN7gYkKo0oT47tHS/wO9PxScVBgb /svUfeyvMXU5oIyzLrokZRxtUEGdaERS1seamKE9YCWrsXJ6grbh2oFD2XuS/MDR+bnruJjhiO/v 6qP8Ik+YxG9MztAh503cmLB4MmGO9sL4gOz4an4Sl8tNshAd/hF+4N9/4F8qcuEcj4j60hdbp6AP QGc+uLYvQV2eYgBuK98blyodbGsg6aIY0LffKZMUHtYVvOstZ8sFHMPM2F2gVwfBjxxrEiuo7yzl CTbkkEkmfYKyLgC7CJn/BYV+oi0F23PR0X6yydZhDM+GllgG2UZP4jDZVZfko1S5dPV3g/tnQvch 8ePesHfc7an2+WBgv/+p/dttyb1GBXaGnyP0b6ne+ZA6aTtkYNUpt/++TopvOzYtSA59fKH5tnYR kenBpfFXuFHbE4jn4DRu4aob2EIEPifGvahu3drAhuCDVhwBp+VqVyUnkw7khDFPc54PJa/9DRl0 aa1KoWf1JYkupP4xV2shbInhK8GwQltwS0W6Y8ucE+NW3PcqZt+XwLImqdEh6rOobvTYmFfigj2A DuzIh8YHvBwtFX3Z5djAbbbLbUQX2oQxBkfOF/G4EvwYOD+nrgO4rp48bFbQS3tOQRpgkgJ04J2x r644roNgqPIm2qjrcRnjljBh36MCENU1CgxQlriWSwv9q1tjUCT2gpNTjITj7zGQbnvkAmuO6zLT KEkutGWuQUyXoOo44AWibeN/NDyn/MSO2/PakA6vBRhDAF5m5eP+CLFE9dAJ6oYcKAm6LrFdiXry 75b//qbh8/Xx+8DvPLPVw8Ak9bmvSm8kSbn210U1jrNI1gBLcUT1ud9GKGNi4ATjABfOClpRHEaq D21xGXA8X+vYcN9axfes7UIdF+Z956vNpluR1IRkpBLVrwOBJ8N7ZJidSB0oUR2kSgx15jmgrJdo 2Poaps4BEEM1ZGdZcFaGeiY0YV4/o1O5tCEQUBfrTQo2LBdC5xVBHWC8u8BOOAoZ5+Z6NoavwuuX uQ5gN7kI6hdCIAbSbUMmYEMvmEmTFfog80hkUifaXI4q9tWdM0lJjkZrpDHzuM9jSGAIs9e+oAQ1 Dxnh26c7Z+6F7TL2EdrVrvvweWw9qFvkkZlwJ5F94Ma1JUtAktpb8gOJUpu7jvqgwPVSRrAGOIvO VmgHs57yPua+oLVjdTe33Iz52YWARU8ruR63fenAwmmHIIbyaAosnKshO0HMlSreHc6BEdVBjzFj 3+hZpLLrTVgJavnBXiUYMEBublLb0PdI8S82yVP1+D54OxmBJxB8XCQpAWeurYMI99hTtJUZ8+NK 1OlC8kQ0ZHLi2RkG+cDphoXEqnOsmO1zXLGvrQXZ3IRMdDRkMPHpS2EsUApfNy4to2KHEtR8RATs Qz5PAq6ThKHJXeyL3DXxte5XiheNpaYPKcbNnXUuAEld4rsumOfZ9ZQpqV8hvPXPo0eZdIHXynTo I2/C9Ef3DevTPgcBnfZXpebSAzwiZ7euPJx53piuOHvQNsb2YNK6TMq7HC2JhpDV1H2MUu+qMcY+ 7i7wSWhOTFqVXDuD4Gqs3wLptfcTPgOwl16raBuV/XX7oTyALoFtgz7ghQR/BqulQQ5/4F8JlxmC jEA2db/dpW9yFpNEeUNPpKyXdXst7qQO6kUmSAYv/VKlVlcPpBBDCWp+EiIEKQPr64Pvykok5yDW 7XpaR1Q1OJOMUvLv1zFeVz3zSFLD+12ZHwTkimFOsy2+aOj9dX1SVlp1tXD9ry/89G03L028hYi2 dsK6HdVBI8ADZXkXOJCpK/jKkEFMT+f/FIPCJvlAeZlJ3yCoDgZKhvHDGB+M7MxY9A58hMTlAuW3 Ihp/yGyj90r6hIjqvWvI08WgmzbxPESlb+L2kr3FR+OU15Fg+S3Nzwt+lz4IOLQVJyYMSd/X71ui rBbEl9HmDZmMI5FHgb7agiCxO2749mPhelHrQu2nFoL8ex+tUELJ/GwIhUKhEZCU8VZZieQ07M0X PWwNFIFcxXIJHIFO+GoxxYXeFw96IKkh9rinbt3Q6HVM0aPXl28BflbB3cbCUn4h+7PvjVdDnULB ywhTPL21QLla2/WDSCoEQFHEHgvEgLlPv62QAfQ9dfBcycPXBSE+UKIDvxSmcz5vhO3lvFBXn2My KEQ/NwiajwPNd+yVXK1JHo92Q8QR+8a4YX2kkjln7zcb8VqoA4TP1AnPxBIeJFX4SE5z93/0taag Qn/uYq88XQDpK7D5LKFIIFJfP6i9VvxCQIQ84r7CePqWukIQK0gvjPvFZJvx1rkE8syzTsTq08A8 faCodmciqUv09efUCQ9MxsTuc9XFi/eh1hyS/I/C5BL8kla0p3cmnSIm5z71gANBF5HZLKbfhd6G LjUT5LTRUDqqifRdJa0AZgiWngSv3dIw9mkN0JsaxnEWuG9ohmsqNltjdQrBQ8W4KHJ6Y+wpVOl5 sZcR+Sx7nWDKExkRJS1d0Pki00QvvHMi7wOfOBK/Znqut4mJv/pxXa0a26WvsQPJLV93Eu1Dnfwq upKMSDDB54RgPIOpnt6jF7EkFUucqznh+ClJ6pp4XTDOl/R+ys7rrwuJSCRLSYWNVhf6eZTNpel3 KkWC39r5XgEgqb9HNNizUEez9ziruZGXBeqqSMfERHXfnmRBF5U0XdsiX6nZdy/Bj8f2EGKCYxz3 pYmj8rY0DqcQGG1picHYjfSAHJMvMxOXQ+Kt/3RC+62p5HVAJJPM+L2QyxeOuyY5A/a3FyOXyHx7 WxxKqfrFdQfBdWzJodJEcNFryiDo18yxh9ctl/5FHSk3vlO3Cnprfva0p0CBJEapmvFy1P/ayEzE s7WNISCp2U4JbHnXVH2u30IkiYQl7o6lJcpQ32L0NXrb9thIanEXe6QUNBsmMg5lNDNxZB2jqi4R RlQXKLvC09h9bGzeLknsMO/XgtdUp6pa4v2oRH2cm4gQWXJvgWuk9CSbZPZbQpI6JR+kiT4kdYoE rdOelKgMjqWRqxG1lRF7kmiowDYPkv049nhhaK09HHRjgn6gBLtSGqa2GY3xfu/xbmwXIe5Zt08p 7q8B236EJqqd+yUHkFFu4uDS1oVLFCctDiKrODkU2BsYZPds0qjaYa0YFU5Ww2IS2/e8Ra6hWwWU JhAZyNiLtTDELXCYxi+t6qJEuS06joeidVJhPCZLGOcW5rRvj0fWADOEjBOpkl1VsvuNcF9NjaTu 1d4tkZYwvfzgBNrQbQ2ipdp1bAEyE6p30fq3QwCSD7DXnw5guGvfQclpa90AnXgXSDfAbnzmbJvR GOf3Dnp06+Pddrxviqe1fgtJ0gZseROs1UmP/UIil0Z+0uLAsndffRSoxpct31ni9ww6aZuO2hH+ HXV0nEUdud8SJHbtv7wp2/q4VROl+Xn0alO2bxryzHo4yPD7Xi4IRHlJcMjqSwOid94DVV+Ck3Av 5EKjS0PTtwn0/zbC6tsJOrJ5wLXUu0qrRx/VZNbyjrVdz29o0qkwgRMADqdHmnvrtn11c+81jj7K my3fyy11lbQ9Ss910+Z/bPogxvw8+m12+Hl9/JHevkjPE0a2Mmn6vPtksqknffw0az+44zqp5f+P w/eNhQy26YdrLLCsxn4Ygb0+RV8kdABZ78lzJaejIR+yRmyUJTQ0b60YEtaNEerFEdoWDv0o0ccD jmfhk7B0IKlBj65C6xFWut9Z6j7V/tq2p/Txv4JfFtiQra+2hzAX0V7UihX99X4RMmHC1gbooOHM nm5xvktO5wafO2pxbuE9ihhun0bndLxnMdSyXHGOB0mNsWUgsELnvwggrwz1zjf5sr4tHv6mduzR Q7V6ifK7F3qqYYr65LI5rxpjKiKf/7H5WXXhI8gpG4Hwikh/XapCl/j8xRCOMAeY3+aav5VEduzY b0v0W4rA79bcd/PNIJBDjqgb+R4/aunD/9iz12cWwVNBNXc4B7kEn8xST9qC0IXrOzZ8rKZO1PJd SrGZjVhgl79axLY3h/ZvY0u0K7YSEL73ehZdpLxgT/GiH/U+CnvG28a+aqsrNc/zpfZLQhK/LSQ1 GwlGMAeTzb2qlq+Ud0VbMtqjH4uul6cyvnMdz3NcGrjWp2rMlwnZA9DDkz0xAAde4m8uXT8wCoUc hx4WF0eWuDSN7PCAyCyqDFtTdsuIxl8b66MtG9RX1ItlLGPqKINm5QXlxgQ6wZKosKgKraty7lOd OwE2s57jz3rBlkKhUPS21fVePGaw1fCBwotC+02nBySZmnu91DYDday11kXJ/V0HojfNpF8puYq9 etdtLbrgfb32m1aI1GHYO09M/9P3g0iaYTuQvOFvUO0XK/P6pAW7PVGSWiHVqa8313qBNYnGfIej Xm9idTsaWEzLoTvtWJ0Knz/M9mzqqyo7MwACd6B6MG4EyG/N/srG0vysMqyPu3tbT9i+5QTft9bP qBIlAdd6tmWOt1UobmuHoTZToVAoeO10baNrX7bNvy0a//7SsN1qqwcIJK3H6NOPiYkIFywbvlmh rTwUPXQaqmavGzp1r33LFVv0JEd797YR02zavzp+rfmMpRlw0mzj1MWmv7Ft76j5tFd8UIhq+4Pv 37+r1isUCoVCMTAcHGieWqFQKBSK2IEETjMh3Zb8sEGBf0vzo5cuEBWltPYACoVCoUgL/y/AAFtj 4wJ0PXz0AAAAAElFTkSuQmCCAG4e8JfUAQBanMCio4xQzCz8/UHgc4Vo/4lQTkcNChoKAAAADUlI RFIAAAH1AAABKQgGAAAAirS7RQAAAAFzUkdCAK7OHOkAAAAJcEhZcwAADsQAAA7EAZUrDhsAAAAZ dEVYdFNvZnR3YXJlAE1pY3Jvc29mdCBPZmZpY2V/7TVxAAD/kElEQVR4XuxdBYAd1dX+nr+37r6b bNzdhYSQQIIFgrtLlQJVCi0VoLS00B8rVijuEjxAIEBC3Ij7Jll3ff7e/507M7tvlwQCJBBgBjb7 dt7MnTtn7pzv+LFHIpEovmiTI774qC8aRX0fsQAh/tj42SaDRiPa4BYr/7UipF/Kyt887KBs6jpf eANytYN1Rbkn+fm8zcIjtJl9/lEgVb5406n4xQceyPWiB0AvSxRhNZY8yX1tMkaEc7eSqp9PV+3I L97kGBnJLofG3jB3RkkkmY+MdSD0OrD1dQB0kBlFLR3PUb9V43605xvlUVFS6kBm9sV0MI8wKWBS wKTA/iig+OO3uxmwJoxPY9qyR34LCzQ+G3OMBcGuUNH1u45zDyZgHzxqxc4/9rNxH19GxDCO/SKa fB4dvxy9wgqo5Ec9OX3S6vrqT+27A7kH4+kYz96YY1eadFof+yHeF41l3OOBzEtbhQdwJA+hjNO+ GYJFx28Raw5gnIO3tMyRTAqYFPiBUuDAQF3xoxiutS8E0pl5J87WlTtzCKvFojQtpbMYWroxPDmj 6HXynejtSoHvwunV3/tCJmG/Xb7TAObbYKYHBgadQC+WvMaUFQId2Pzbx+qi+u+PXvvar9H6wK4n pFXPiCqzZR/aeofu2lUs2/eb1ul57+P5ytw6AXIXUJc/DT1YW1ufXQ/tS/QAaXrgPEEu1nG08dEi tDQA/8DJeuCXNY80KWBSwKRAFwocGKgrDtkFLRTeaHraPrd9MTF9n8Z8u5o2BcRprrWIOVf/rp07 7ue5fR6jbP/O0Je+6Wd/IKbW/QhKxlTb7+FAECFWVf6S9OoEkPumVxfZSp6+fpEuz7FdAOz6fD+P /h3PW60pZf6PuYR+qiZExBJHn4OsTZ7TcRsamHbaOv19sNeE5gvooJFIILpgF0uGA3mM3/QyNa9n UsCkwPeKAu2gLoxUGKps9LOrzx0MVr7T9lut1KX5h3wOh0P8m35hnmu1akzMGEdjzNS6ud8YLxwO w2bTjlffC4jzfIMbRkRzl2vzGnKdCI+XC2vz0sYzzjXmZzyN2PnLvo6/tXvSLsf7UPPUNhlWuy/t 3mPnHvt31yceOwc1T85ZG69jjM5z0Obz2WO068r5Gg1JC9JAU9A7wK2rrqsdS4jTfwtdxaNsYVyC 8QzlhmPHUSSUuIWYuXaiXTtRZFw1e0Vv9WxIn7Bcy6aBldKalXKqwaxFQFWRVXtO2nOmUGMAWxcw i6VFB520CYRCIX2N6OPKc5NRSReJQpC1ofnxdaGJY4dDjE5QsiBpIN+Lj9tYz+p8AdzOQC/7ZD0Y z09+7+s5yz11VezDYbmePHdt3WvXiiDE/fIMteN1IsmsSQ+Zl6y9iMQZyHPQ10Psuu26Bo31YszL eP8MmnX9Xv423rHPO0a+M9as8T4afxvrqtP6i1m7Xcc15t++7j5DRXOHSQGTAt8kBTpp6rGMJvaz xriEsQoAReH3+9Rvl8up9gkjkd82BfCCAWR27cBvQJIIAXKcBmTCGC08PhyKASjF7MgcgwEyTYcG bPpxhlBhAJlhJlZxfrpQIdcVUHDYHYqGcmVhVnKITUCQ//l9QTiddp3JWxQjlutYbSJoaGcZ83Q4 tHGMzQBz+S3j2u12BIPBdmCQ85xOp3ZN/XuZj4BtrHDTwaTlmhIaaAhTBDQRErhHxRPIxAUb9jEH g6HL9RVDFSAT9wVPVGCjI1GIc5LPGq1lLiJoaYKI3K9cT0dmndHLcxIANywmmkBiCGkK4wUkRRgS gJeJcAiZhwCEAJgChohV0dHu6IzoMk4HcGt0FNqEQuKj144N8wqhYIj0FYDkOBEKjyKwUKiQdWO1 ku483gBiOU/uRQk3AqAWu1qLugdHeXkEUOX+ZeIGcHXcl34ury334XK52tdphLSQexUQDwa5fnmM TQk32gILUaBQz0toqvbZYNNpr8m1+oE8OBDgWuE48pzkORjPTtZZLF3aaUnayHeBQKBdoBYad7Jm yCV14c4Qno01aawRRVNFF01ANgRJ+S1jG/uM5yLrWj6rR6sLjwY/MISAWOFBjjOuvS/hKPYdMj+b FDApcGgp0A7qsZK2vLjy0hrMXwBBwFYYqzBTh9PDz5q2JqBhtzsVhxPmFta1XvJCjRELY5DxyJgd AiyiKSpmx0h3frSRgYR5kAa5BD8BJgKCfCeIJgAt54Q4oACQMFfFYHhOgExW/hYtSPQ4Gdbh1KKx NXwWzZzniAFAtDj+53KSgcpcldYucxOLgAZkct9ypgHWwqi0fdqmCSNazLfQxqCRzEeOkx9jv80m jFFoqM9HF2YMq4Cii4yhBCUtrltoatyHMubSFaEZKTRYNzR6g7HHam4inNgdBDsBArk2/5Z5Cf20 efOuOV5UwITzsvFi6vlqN6ODM48ToLfr9NHBjEMpbV3AV6Yjz0Ixb7UGCNL8207wkedk4bUtYo2R 43UAaieg/iHWuqFTlsfa1fO3K+Dm/JwubS1xr03uQVZIhMIeAV2A3mHnfcg9cb4Ogr8IE/KdErh4 nxHSXQQjebYyzyB/OxxODVjlPoS8ujVE6CkgJvQUQDeetXwvj18JBEIYbgLoQQKh2+OmwKm9I7wy /Jyrg4KosmgY98lzg/6Aoo1Av43zFBCVc+Q6ss6MNWWsM5m/CIYCzIbwKMfIsYY2HWupMT5rc7W1 C5nyt9yTnGesV+N+DWEm1uomwoMB4Ma66hD+NEFM5iy/Zb+MGztO7DW6Pm/zb5MCJgW+OQqoN97Q ng1twdinmTyFiQVhF0ZDPBPg8PnDBEcbvD6v0qgj1LYN8BGGq2kKGsDJj4+MzUmmIUxYtBhhfLAK oxMFUzR8ZTxWWnsk4OPYLoKTgl6mKtnI6GUsMkQBI2HEPDEQ8BPAnQqUhYn6ObkAtTthwC7utysr rAU+L6+tXAZWHkNmTMYkTCsYEIGA1yajdTg0F4Df729nsorZCqjrIG7QRABHGKCMEeJ9CnMXDVD0 Gtnf1tZGpsx9dE0EAyG43W5l2ZD5y7UMjdTtoZWD5/j81AwpaCiQUfchEoiYawXkSCbRUsVkq7s9 DAGitbVVMVYBKNFe7S63Shf089kIsIuQJPMPi6Yr2rwCEjvnp91jPK8pm5fPRugl5yrrCqUpJaiJ ICdCgMhgfF4Cii4Cr/YsCWJcCzYCa4QnBkIBBMVSwHkLgEV5D3K/vBz8pIEYnWM3QxiS5ypz8XF9 2Th/ATwbBTon1xiHgp/jCm0iSoIUgCQ9HVYEIrwfrjsHrQBKsAwq9EaI5zs9cbwn6voUAFwc086F IHfaxuch9+bnGgpxbTn5LMJcDyJ4eL1eeDwe3aWkabQCXvLs5Bm0trZpz48/mrZuRUtzK9efS6Xs RXmfHA4BETDE6qDfrJ/jukkrn79VWUoMl4EBtoY2bICxgKYIfV6fT70vBiALXdQro7sIjP2GRUnW rYxhAL+xRrXxIvD5/MrqIetTrik/cr+yhmSfIchoQgufrT6eocHLMfIjdDKsUQaNZBxDsPBx3qam /s0xb/NKJgX2RYFOmrq87M0tLQqk5CVuamyEJ85DJufE7tKdqK+vR1FRIbKyMlFeXon4uHiBIcXo xa8qmlCEzDUhIZEMo4l/2/nby7/jUd5Ug71796CwoADN/K6VZnAfmWx6VgYqq+rJk0Po06M7UuOd qK2vUlpqlCCyc+cupYUlJsajuLgHtm/frJhI3759Uba3EuUV5UqDLygs5DGJZOwh7NpdjpqaWsTH x6FP755orm+Ct6UZWdlZ2L17D+I88UogEACWsSsqK8n42jhGrmLkoikZ4CmMUn4ME6h8rq+rJ/CF kJSUhPqGBnWObMIkZQ411bVkmgnUIO1o5n07yfx9/ibFmOPi4hQQr17zKaLcX9yzF3bzPioryzmC Bb169SQwUksN+ZR1I8FF5k6Y8JGhCsDI3GTeqSkpaGpqIsgESN8krN9WgvrGFvTpVQwbgSQYiPBa bjTVNCIpMQFNLY1K45dnIwi5et0mMvcABg0ciD3lpaisqKIyHkFx9+6Io3siTPArKSlRxxQUFCIt LR3V1RVqXSQlJaK2oRHbduxERkYmv89CXW0dUlOTUV1RScEpDtVVjQpk+/UqoB5LjVYHHQEMQ4hs 5VoLUODIyslHaVkV55ZAsGzhdXciJycHeXn52Lp5B59lDXKzM9GvIA8VpVVw8R5KK0tRVdvAZxyP 5HgPcjJS4abBaE9JKaIE9jgKW5XVpSjlOpWtqLBIgVl2Fu+joQXUORHvofDIfULT8vJyBXSyhSgl yFpevnwl6ZyBvNw8EZEU4LWS9kEKlElJKXwOTairb0RFsxdtLL6QFE8hgr71xoZa9O5egOTkRIKg Hy4+jwCFVZ+vA0wrKipI0zS1roQecu+LFy9W62PQoEHYs2c3du3YoSwYQ4YOVUArkl8zn/nuXbuU dSU9Ix0Z6Rm8TjJaSEtZFylcFwK48q5u2LAR3boV8X3N4vlR1NbWIp3P0c/5y9qRdVnH47Zt2Syh LOjdp7eai6xrEczlR667g/NI5L7evXurNS20EkuUvF8bNmxQc4rjcxjItSTAb5jqTZZrUsCkwDdP AbsYk5UnU/ymYTKYIJkQmTK9u7j/0ecwaepR6Nu/F55+8RnkxCdhCxnd1KOm48Gnn8SPf3k1li1Z gdbKOuSmpiG7WyaefPY5nHHa2Qq4mpoaUVtXRWbQA+/PX8BL2FBeVsnfYbzz3nwMGDSYDD0H27bt QGZmGko2b8SF55yB1+e+joqqOpx97plYtOAj7Nq1E1OmTsZe/t66dSsnTE3b14i9FfXYSDATZpqz qwQnnTBLzX/xwvmormug9hoHDwWKxqoazH3xZfzpzzfivQ8+5ryacc7Z52Dtuo1oIRBv2rQRuXnZ PN5JwWM3pk4cT00OSivcXbJNAcOQ4aPgUCZTCxYtXYgdO/fg8st/jAcefQhnnH6qYsILF32E3/zq GjzxzPPUWp04/dQ5WLBoGY45egaef/oZMmwPLrrwXLz48ivYsnEzUpPTYY86sHjNGlRSkOnWLR95 RbnIT43Hxws+Ibh7MGroMIJWMp587ClYOb8LLrkIt95+B6YdOQ1F+fmo3FtGrc6JDxYthoPChZ3A LAw+k4y8uLgYK5ctw5FHTsXCBR+ivLIav7r6Srz86ttYt2Y1EgkAAl7rN27lcylDXg4BmuAZn5qF 5atWYd7b8zhONioJqhMnHoH/PPhfzJo5EwMHDMRbr7+J5sZ6BSBjJ4xRwk2//v2wcvkaPh8H6VGm VnPEMgZDBvYlHXeiqmwPhYgBpEM8BQ8PPvh4MVasXodf/+pqPP/koxxnEjZt2Yma+lqCciKmTZ2C N155jZp2GJ/SqmI/+ST1zHp074W33ngH6amZBLVkNDU3E5CKKRB1x9w3Xsfs2bOQ6Pbg5QULUMZ1 lJ+fw/vk3y+8gDNOOUmZ+GsJZqPHjuZzps+6rRUfzX8fx8w8hsJFOSoIftX1DRQuSpFA2h8zfRry SRsr1+3mXdvwKuf0uz/8EU88/Rzvz6LWdH1DE8ZNHIcdu3YrYWEv1+PpJx+PsLcVq5YsRSHnnJxV oCxGIvzdcMMNuPXWW/H+++8roaVnr15Y8sknsIaa0dQwC9tKm7Bs+XKkUmBrI51Tk9xopMWgrN6L TwnWPQrykZhAq4TXhzPOOANvvfUW36FMzJgxg4DegMcefxRtvha8M68JV1/5c3hbg/jbv27H9X+/ CcvXrkAG1+LUsePx3ty5+Jg0LepWCE9KOu6/916ce+7ZyMpIQ1npXqxfv54CXwVfuZAa+6jp03HT X/4PI0aNxtFHH4Mnn36WwlceqijI+imkDx8ySAkq5mZSwKTAt0MBBep2zXZOpkWzJM3ZopFs2LIH 8WkFKK33I47g3HfEYFx60snYuGAttqzfisS0TKzeuRO7qQX3yywAWryqflhOfgFWrtlAQCmi5hNP 4YD+OIJwfEoqEuJSlfY1fsJgahpOHHfccZhPcE+n5lfE/aWlZSjZW0HzaZSaQQZamvy49JIr8PHH H2LChNF4b/67uPyKy8g02vD222+iwetEdkEfeGjZDIdaaLqnKVuCf8ik8/Pz0MJxSiurUEtLQPf+ Q7F681bFWLftWY6VG7bCb3XBGw1wXy4yCnohPoPa3J5y5ecW86yFZt6c7AwsWrwEi5avwqlnnInC wmykpKfDt203Nm3fjZA1AXWtQGlNC1I49noRUIp6YOWKrVi+cTdcyTnYuqcSFncKrDS5r9qwBa00 /V90+eVYvmAZGkm/oMWD1LxuSCejTkhL4f23UkMjiTgHJ4F6105q8Y5E2MnEt1JTze01gPeyg+Zv MvXWCFobq8jYz0LJHrGmNOsuEy1/XMzYVZW1aG2mdp+Rg0/W7EAbzdiXXHQhVq5dj4pqatS2OKTm dEP34lwkJadwQdjJoEN8xhTUcgv42YJNW3chM7uIVo1W0qeEYJ+DKy87RwFaY0sr1lHz37ajFHNO O43PcA8qSZT8AgoIGVnw8ZmkEnBWLl+CtatXYs6cU5CeUwAHATPqSsTajdvoVrFiy5Yd6FbcE1dc fBbmLdpIwWIj+vcbiFNPno4Nq9ZhHWnbzOPaaKKOo1adn5OFPj17ILcoC0+9OBeL163H0dOORFoy zc4MQBTaJRCosvOLuS67ISExDRvXbVbnheOoq1OgCZMWoTDdOwyukyC3KNdli2CSKwEpud2V4BDP td7K4+JoCRD3jQh3m7bTgtDix6QpkzF9ahwqKQwMGjkCD/z3KSSnpovfhMKrBYnxCXBTq/7ffx/G pBmzMHbcBKWN5+bmKg1YNGqxFFTSwnHD9dfB7q/EE8+/Cr+7EFf+8nr0yknDu089CFcbrVWiZVOl LqKw1pMWsylHTMZ7772HO+64A0OGDMGUKVOUZr1xI9+/7sVcE6dwXjuQEnbjgw+WY0Cf/li7eRN8 dFtELBJUSHcHtfFMrv+cot7IyC1Ej379sXTFSgwbNFDFUWTSGnDJhefDRnq+M+9tLKHgmkPrWoCm 9hpaZ5wuPofCbmihC6Sp1d/uJvp22Jl5VZMCJgU6R7+THhK4Jn6x5UuX0iy3A1t27EFS9onkZmK2 pW/S4oLf7kFSThF27KmBxZUEeGj+aw4gkUbNrG49kJGai1ff+gDHHncU2sTh6ElBv+FjaE7ciWUU CHJ7FqOBTLKisRVBalAt9Ne+/t5HOPXUk1DV7MeHy9fSpO5EIoWFYcMGoSlI02FbAM1BGnIdcZQf KEC4khHyRtFa14w1O7bhknNmKwYT8NEfG41DQ30APfv1Jijn4+nn36Lf1c+5ONGD15541NFYtGwV zZ8ZSrvxElijHgtaeU2/Ixm2hDSCKJlUcxMJ4kGY4Gl1MwJZXALwUDNOhseZTq1yL90RdANUNOCT T9bSXNlGX7QLRT36YfLRRRRGVlCIyUV9W1AJET5fM7E5VQG8jxfg9LFmzXZYUpKU7zVKP3qYro6A BBESxC3OOMS7CXY0zy/7dAtCtBI4UrORTuabQjP/K2+8i0kjxyBAUA5KJD4DFleRoWdn5yCjqBiO JBFaqInvKMMSClpRjhf0pCGOx3t5rxZ3PFau3AgXwY7eDXgpBgQIbsEwo8ftSdQCJa7BjhEjR+ON 197D2k+3YueOSoLHkfSOuJXvuDlkRWmDD9vLqins5GBPdR0y6WLpTt/9Ngo93uCnKMybStCmz5mA I+b2Nj6/LPHrU1uMp4tg6/ZdBNBuvN94NPPaMm5QgtfsCQRwzR/vk3XHL8Tn7GDMQgs1VNHQW6iN ehKK0G9AP6xavwnFvfvSVdFIIY8aOJ8db5/Pj2ZrAnWPAUORQY33tbfmYQa1aEZ+cEwrzcgJqKcA aIlLRsDaiCb65AcOHYzN23di87YyJKVlY/Sw7hQmeX1nMhIovK3auBOpBP0In1MVwb2J41Q2co1w bp7UJJSXVhL02yg8uBHkWg3y2WqBg1qEfT6tLFu2bFEALz5toYkWeKq5scR1EaZlQAJHRfAWLVg8 +GLabmpsViZvL83tAuSfUMMX07fhAzf84opubT6U0QXzzvvvoop3vKWpAlNmHklzeRzf6SQloFAi pwDOQDleqXsRhUvOf+4rL2HmjOlqbipglPMW98VKAv6yFavo9/+EglKRcsesXr0KNQ2t+NmPL2+P mjdZq0kBkwLfDgUknixmkwhaO3bv2Ytkas//+sefsGVnBZbQ3FdWUYrb/vMk0pwpmHjkVDj4926a jOMJ6in0qzbSN+1KSYOLZtiJUwZhOTWiAEEwlQATsbuwcv0aMqootdkcxKUmII1CgSeZ/tDMbBw7 sB997al4+ZUFBOMS/PYPNyg/9UcfLacWKTJDMjWPLOwq74N7HnqMZmkbjpg8iX5cL4YO7ougF/iE ptYhA/ogPtGFgYNGYuhIMnDKIc/PW4EzzjoXw0d2w7x5y6mZ1pERjkcCr/3u+0vQo28/tO3cjt0V 1DpSvKiob8XdDz+JcSP6Y+KoEdR+S1HYszemDxyimLLPFyYQpaFPXwobFDS60TKxeu2nuPiSi1Fc mI4P3l+EOmqp444aRHO5He/OW0i/fh/88rprFYNesngVktPT8AJN4Ik0/U6cMg7LtuxijEEzSkpr 0KvYT8tHAi3Ybrz5zkdk/LsovETw2z/+nho9sHDJElpTXBg9YSj28jm1ktmPGT8ar7z5HtzxLow9 YhJ9rRnU4D7A+4uWUujIo783hGuuoxZIX/OiJWvpf07A8y+/xniJBEwgQO8iIFdVVdC3XolePXoh Ly2OWm06LSknY+ygQmza3Yz0zFzc9o/TsHVbOX3rtWigC+O2ex+jRSWFromROOrY4zF4cB8899I8 ZGRnY8/evcqvk5uTTS0vSjN4NYp7FOOkE4/nerOqYLAE+r370Y/byKCzbr360x2Qhk9pgbjl/qeR kJSDKRPHYt5rr+K2ux+iwJaEmScfS1qvU6mU4/jdzKkj1doVISAnNws9GRAmwXnhRFoAuC8hjTEU 1TtQLnEFqQwKo9/36GnDsXb9ZtQ1BSiYUSGnn0UiQ3K79cS9//0fg/BsOOaE47GlhFajsho+QxfX cBZjGxgwSvzz0M3Ujc++nnPO4b2l0j0Rbm1k4GCE4J/IZ2Slz74JGbREuBKTqOG3URgFzj3/Erp4 chToCagXFRXRRbGHcQipjEkoUO6LP954I1yRZhxz/Elo2tOC+2+7BYl0VRzNZ51GYUSE2VRaUqYe dQz6F+ZQy69T44mbRWI5jMC3Pn364MMPF+A3v/stMujXT6Yl6AgC9PhZM/Die/Pw8fwP8BEF2Q3d P0J8QirjH6qxY+OnKhAyzHiCiePHY+mihcp6EOTLdfPf/k4rhZVulwEqQPEff78Ve8oq6Dr4kP7+ ITj5pBPwwsuv4226AE6YdbRkFZqbSQGTAt8SBajDGCVDJM9ZIr7J6OiP9LY149mnn6Z26kKjtw2h NgYwVTchkhXAok8+QK0vQO0pgJZoJVp3b4eVEc9bKzYwCCeIp6rLkZ7ipqlzDQNrAijZRS2Vmlsp zdCFhcV4be6r9Gt7Uc1gpxADiaLrJF0mHm30NbYwoO2jBe8q06X4vue/s1dpd/97qkqZlesZrCUB TRs+/ZRMrFkF+XgYTOZtasAjj73AzxEG+/mwa+9WRoHbUUetJiE1hT7d9Wign91P0/e8t+pVGlRS vJ3jrEJ9TRXnsgdl5fQRM0CsjvMqyUjCuJEjOd98/uSqyHuJMpeI963btqCcjDBKcK1vqifja8CK lYvw6VoHWhhA5gtb8cardTTVApmpdtRUlRLca5V7w9taj6a6BJTvKUEd6W2l395L0/iO0grEORic 1FCFpXEMUhQtj0Fq27ZtRxrB4aMPSBPm5pVV1sNF0/FTj5cyUtxCcCzH8hVtaGysRUU5gxxpkUhK ouWksZraHMGM9+ijhrzwoyZaAUKorm1GoCGe91yDOj47KzXLeprPq8sJ7IFWfleHj6nFSc6/pIN9 Sv+r1ysm6jBemfsWNUqpUcBcf9Jcgg4LCsNYv2Yl97dhKzVPH10fewlylQR+Lz/3zolnrEYv5dfu SQEjwONE047SIrBr1w6Cfa363EQ6OhgD0UzNspzCSl4+NcCl79Py0oBSggu9Kfjw4w8ofNSjgrSL MuhsT8luWrmpzTITo6nVh1A0iEf27lJxD5JaV1XnpR+/nPQuQzXdFnG05Dz8ZCkDy+JIq9144rly 0PtCW4RkHJA2fKYeBuGtXr4MXoLbru3b6MuOw+plH2LZh8y2sBKQKUQJaNF4RGGkDnt3b4WNzynC gMVtOzagraWBwXw76PfvhubmQUihoDV6zHhlvg4Q4EWblkC0yZMnK1O5BF6KZp1AUC6gVceFAAYz fiOnknECDJoklmLMwJ7wcd1IYkRA3DC8j6rqGpWWKOfOZJyDvBMiLEh0umjXF1xwAeezGYW5OUh2 JFAgZQAojzn26KMxbvRINDLANJnvQDotPwXDuGaZhZFPAVUEYxnjJz/5sQpebeM7VlpaSuHCrUz6 EkibTMHG6Y5DBgVy4RVNXL/jx42l0O5T6X7iytOzML8ltmZe1qTAD5cC4khUYCl5xVq6tE35wsUn 3UozpJ1adhqDkewO+kAJIhamnQWoHSSRMYrmKOdaqYnYqYWG7D4VJOWn2VbSiXIY8BWhUddqlWuk oR9N87IJc0vLcaugIURpxlUVyOjXTGb+uzVL5RLbmPKWlURAUNxBK34iEfYFE8Yq5hUKB5Ecl0kt TQrJRJCZlgsL94lfPYV+aRlTUrIyM1OVNiP3l857krxnASxlqkwRHQ0Y2D2bkfhM2+KlnJKY3DcP OXLPZMQSIBSm71F89ZKuFWRSfV4efabM5dbSyKzIzmGUsyrsAoIAI6hVDr6kRTGyuyCJgVlM85N0 LTmAGpekChaPGSZD0H8boqUjDf17FyHKiHdHiGZYMsdUmsl70BTKfC4GTxHsyWAlPmFQcYEKQvRT qPJIyhXPlwj+0YP6KB+8XEfS18YNH6hAWczVYQE+OSfoRGaPVNgCXnQfNVjRp433k56cgIHFhXDw fiPeFvptBSjV0qAQEyEISsqdVmMgkf5q2e/gPeVnj1N0lnWTlsg0Pl4rl1YY6ZjWuyhHRdAnUwBR uecCSAQ+CeYTUBSaZNH1IfvdpGNU8sR5jfQED/oS/EOcQ4BZFYOpybv691GR+a3c16OogPhLIZDm 7AhTGKO8hhBeNFVJNpO1YOV9SFp5WlEyBvC+VP0EyeggXUKSN65cKlq+viOOJm1JweMY+RMnUDBg yhvPj3IdF08ao+5BUgLtbqbqSa0F0lhWpDxfefYqT16eK3/7xaw+bIBKW5Rgzngb/fC0xkRDfh6r rbnYHHUj71xVZ+T8ho8YybEY6EjBJjM9hTEJuRTc+F1bI83lSVwKXH+clxT9sVGgNFLJJIreKHZk pAtKFPz4ceMVrSiLqGJAXs4rkdaaZGZDuLoXwc61I/vTaZ1RNZx4f5KGaZNaEXSFSD6jRNYXdeuu Pov7JJ3uAhFGPBwnnjSX6n4idCcz3sNi4fvOtapCdMzNpIBJgW+FAuKAlgRlxXAkxSXiYBASX/rj j53xrUzocLpohGCu+mtRk2wXLshUpzBoz9wOnAIBybWX4iaqWI2cp+WXT2HU/Pd5E2+4qrDnFlFS HF0dISxGWt9n7l/S2yggSYVdqdNgYaVDF99HERqkeatTFyBUaV4Rd3UBNXac9n1CZLoqLE5VaYdR HEabHa2oDwM5KAAZZXDlgnaa2bXqduI66YTN3OeJ12obiNBvVNpXl+A1jI1VIr7Pj9S8N5MChz0F 7O2l0OUlpofdprhJZ/OZYgD6i97+pmsKtLYpG778IaY3vvgSHKexHO5nfq0K9RHNz3j5D8Tp9kUN UURTUmwzhvloFc+MH2MO++hFs48HI9cz2Jh2c1IRr30MxWR1VkYzrxyhVSPvaDMi5UWMJpsdJUhi 6NRBFRVZTLOHEhgiFBRkPPE9R8UeLKVjqYmSG2vkpfZ4MDbRzMWfLdaHKO9BqVQMmDMoaFN153lv em/79me4j4srC02n/cZi6HywaMliodAoa9TxV3KkspjIWWocCdNXQNJlHEV37Wyp3CbfGk8p9jkb z1j7zhhj33PSZmgUxNGeWvtp6qNUodNp3t61bl/qpzF+17WqjS3AK4WVjFXRqeXMftRZcYHJvaha f5yDvhKVBU02Gr30Ba5TdB/jdFSH1JDZuIX2d0OVFNYoLd9ps9eAXFF7X3Prsq/9GejnaATU7tXc TAqYFPj2KMBsNnkJpbmFUfdLIl07v5ji31bslr+MvHYFgTqDadcqFHvQGEnnl1x2SFlRg7XH9tsy GH5Hvzetlrc+SFceofNRGUpaWyp/qDAu2ny7wozh2IvSpKkdY8xNhBQ1gMaG1LWkdJr8Ifegz4+7 SY1O7MoqpUllMHJXOUqVIlVQ3s4T1Qep0GawOGGgBlG0S+rXJtOWPGcDXjSmr9NKlWzRBmkXLox7 V0+sfcgDXj3a+HpdeLGRKzprc9UooEG1haldHbSMld46QFLuPNwO1jKFfR+nmrDo0K0qCOpUEXDS V5VOD6O8r6pJq9+fRgtjBEUR/dG1Y1Ds3ct38lTa16+x3jpgvuOhGPcSs8AM8gttdLePNry2Jjqt 6/bv28USfSZd/9buXl3lCx3N2low7loJdwp8mZqo7zeo9IVDqeNl0WvPV1atEl+ERvriMdaoCHNd yNhlTXV9CY3nbZAkdl0c8HI0DzQpYFLgEFCA6qDW2ENeeY0X6qxWLxGrfSkgpkUZK01CUlxiOJzo E/IdC1XqoKDNVBn5dO1QHK0aAMolCMY6BoTJ3bUGMGIl0M5juA+P1fVeNTdt0yBJH1tvWiJQrvEk XVsyBA29Br2ah+77VCxTDaDPhP7EDoFENCR9Uhov1O5XfsTEKSVv+QfTj3UE1IQcRQ/tZjVjBn/k njTAM7QuQ3CJuQEdKGR8Q1DSmLlo6Jq51ig3akBsV9ZqwGg7aOhT00mkfsXSzgBVMblqD1sDTMMO IOZZiwI0HeV15t8uhChhRL9Xnh9rP4i5Q+2+O13dmGnHHbTP6zMP1xD+lPG5HdBlOE1P1x5Ap5Ha F4V8JfPSvlcrIoY4sfTSKsNrX8dCmqYlG2tEG9jQsGOPk3WnXUXreSBHaoDbLhko+uiGbrVXK/z7 +Vv7dNWhsqA0QJZrtNsDYh/45w0na1Jfy9r5pKgign7v+ndKZFBjxq6wzz6r2Et1fNtZIOgs+XzR 3ZrfmxQwKXCwKUAEkRKvLo098R8JMAoyYMvghg6aZwXNVMMQsi3V34TIFg76FA+wMHhHosIF5h3M k5YIb03f4A+BkEHvKvddAFsigENyrvgGvVJdhddy+9BqYdGYaDzcLdS7GdUTjmMBFSuDcGjGNzQ6 hSdSL4NBV+y1xkhgCTxjIRAlNEhQmgRIUUBRHdFk9hIoJ+ZeMSeKS0A+M/dNMTUGs0n0UIT+PzFx iiYvbgPNDqyQmRnM6n4VzlNACAakkxuvxWh1pau3Wy/kWKmxLjChtT+Vwi3C0SWYS4KurIzCt1i1 gC5N4xP6srSsangjmeDC/rW2qYbpWy6r64fyjQZiMTy3Azo6L4l9Ab9xavt3yuci/lHN0mA4RTSe rtXB7yRBqUvogK5fToboeq3YPdp3xkDaScoCY9yGcXIskLQPqAFmR7V043wReHSI3Tf+qNEN20os zbrekmFi7jxD4zqd594+1RhSd0y7w6bRmR4d8zBO26dZu/Pj00VZuQ25Cyk/3EGH9vvpZCHpMkDs n/ozkpFEMFQjyQPXH0K7DUp/h4wH2vW5fvY5G/TR10ssXT5nOuZXJgVMChx6Cmghzvp7rikGmtYc YMSuNGuR5hcCPpLPK+lG7739Bqt+9cDwYcMIZaxJrmpES5MPieoW1cAYTdqsSnEyzZQdpbQQYXQ6 U2YJvhKfJ13JCGZRNsuQQDRW9WLFVCU0SLetiK5NxDIUKS8rWoafAoWdUcUq7Ur1YNdM1KpPtWp6 IR3JRLQQt4J075J2mMLCumgV+v126FoGi9eEEqXVqLBg6QSmRX3LprQeftnhIzU0MM3qIFHWEfqt 1QzEd63bNdr1NN3lobFGQwgyILYDDruC2r6Ww74ZbseR+8U+dUisxquf8/knaAfpx3zRtTsdvI/h D2R5f57gsL/zP29e+/ruwO5j/zro/s4/0HFj76PjnK4C0YFQa9/HfGYen3l+Ovp/9UuYZ5oUMClw mFBAVJ/OzJ2gpHpwS/UrauEupvBIXeu3Fn6Edz9agjjWK39ryRakv/oezjhnDoawoIiHVeF8zD+W 0qbtIVECqgrFOL4AuKS1cZ+DwCyd15jKzd3MqeX+aJCBYtTAQ4y8tzClyxmR6la6sVExIN3PSm1X 8sRdLC3axrxat9QDlzQupntp2rlo49o1VR9s8XsLmIsGLACugF1XU+g37lB/5SRDh5T5ysFijNZ8 u6olKIUTSRGTryT9yQBoTdcWLV1EA10fYnCgXXcrOGmZsLCgiQhHktqlmWO1VqLaNfU4BJm7HkcQ g/n7R5LDZAGZ0zApYFLApIBJgcOHAjqo6xMSwJL+46JdK/Cy4vkXX8WHnyxjWdgszDjjQub+9mAx kBasX70GN93+JAZ2S8dFZ5/MRiAZeiqMgKIGsAKo2m/+zWpfbHxJsGPONoE97JY2lszjpbbvDNrR SDN9OMHHEqY0TQdTtHg1AUAmwVtonpd86xCFAAfnFhIhgZq6FAyJEuSlbrgIDSECtXQzkzaxEWr/ DkaSS5tXyYnWNtFItPm1eyjVhXR3gRHtLoKHiuKX6HT5nnNlFzcLc4PFjyCBhMqAIWZ7zkV0cgcL 8ShTgxpZzPBam067XQqWMJveTWsErQZyaWmWI/kBhuFWiRRGYGCH0t+xSr6Kynf4rDFzJiYFTAqY FDAp8A1RgNjSHn6jYZ4Cc83c/Pq8d9nIZC3OvPhSxOexrGVNG3bVsoY6m5j0GjMRg0eMxxv//Teu +92f8MgD/0egFWGAmqkCIUKbhnya+ZolQatZjvXC885HuS8N/3n8aYzpn4E7/vob/Pep93HZT27F BT+eSTBmv2+917e4mqX+dTTi5XxYk51QWLJ7LS688g+48S83oXzjSvzv/gfw8ptv4/67/ol7Hn4c R0w6Anf+5x7VR9zFHztjApQVXTRpFe6rOrdTCDBuXQu0E4Bu93kSkMX/WLp7Ny68+Ar88vobMX3K JBUbYGxyb5Eoi3CwLrxm6yBwMwWNNWx4vzS587dUydu1ZQ0u/fHN+NUff4ejJ49t949rVJdrawSP dS2Lq6J9MwwI39CCMC9jUsCkgEkBkwLfXQowCL0jelvDGc2HLFsZ66THs590cZ8i7GU9cwHbIDuj sfcFtmzeg5K1q1jG0qU6dRlm76hUwJLuTzSLi7as8F2zffNXCGvZR7wilIVlS1cQ1I/Cx+8vZCvJ DWzzWM4a3NRuWbxi71b2xHZGUJhdyNrvrOZFBGyrbUUlG3V4m+qwZtWnqvb0gL59MPvUU1iGdgf+ +597kdt3FMZNGMeKXC2sHZ7CGMAwKhtqVAR+elqCKgRike5dBNuWRi/bb1YjmZW3UthQRWLua2ur 2HGsDcm8dnpuD7Zl9eKThayBzVKmNloGGtkCs5b9s3NYU9zGymetLU2sgV4LO8tleis2sbZ4EUtn ZqrsgJamFtSzXKqP1cBWr1nLLm71itIN7KK2p7EOGSyzmss+3SIE1HJ8qVTWxtaa0gdc+tRLfXsx x0slONMG/919wcyZmxQwKWBS4JukgF2Kp8RGV6v0LeX3ZVQ0S3rWsPPU6k1sz+lgyciseHy6sxQL Fq9DI7ujFaa6kcleytHqQvhoWmbsO4GInmUClCibFgJSe+0OSdCi1p3MtqX9hh2Jst2bWDu8gGVH 89A3hy0wWT9bPN433vxP3Pane6lZ+3DVhdfgT3dez37SrbjyvN/i+Q/n4qgxA1SwXFJaErZtWo53 X3sDZWy+Ucb+3SVtG1G6bT27l72Np555Ci3V1Zg6/UT8/BdX48orzudpIrDYsY713i+5+GfYuGkt CulOePHlZ8HS1jjllDPZDnM3shPj8LeHnsK4nlnshsauXMmpWLPsI1z582uxm+1hp46cgtvu+z/s 3LMBl5x8KVL7jMb6T15B7yHT2Of7Odj8VTj//F9g3oercfS4PFow7MjMycPekq04+fhTsIvtYJNd Nvzf/Q9i1qxZuOqaa7Fq2RI2SqnBVVf9An+44Xda2rwISHweDPP7JteEeS2TAiYFTAqYFPiOUoCa eoz5XbeWa2VIlNqOzevXs4MYK7j7HWyLybaPtS2wsib8gB4FcEZ92LluKUrZF9rGJhJinFb9qaX2 NYPhtNKqhoggfmtGyhOoCnsVMRiuGhuXL0VuYV+4trA0Zpwd8xfMxy033o67//MYenWPx7kzL0DP cQVgTxJ2LFuAh195ATWffoR3Fj/AtqFRNrmowd4d23Hd9X/A/LnPYNx5P8Lx43rivEuuwtrt5Wjb vJxd1QI49thZvLZ4vsUlEMRPf3wF650XscvUv3Hrrf/CJ0sWIy9DGm+MwpnnXYL7/n4znnjqRUz8 009Zl5zNbbx+3HzDH1lxz4ZLL78Md/zldhT/dxhmzxqtOm1NPfen+NUlQ3HWxfdi4dJ1iFR+jPkf LMaTc+eics1reHPRQxR6oli1cgUtCWNw6oBh+M+tf8UrFEimE9R3UVAQ68fLr1Iw6MU63DxWAF0i +51MEzQ3kwImBUwKmBQwKXAgFOjUT13BOMG4jED1AgFn++4aTGJrzgfvuBPd2M50+MTJUtmUTTec qNq5BZX0F+enx2PWnFPxq2uvx6nHT8dENsVQ6WOMnmeIm26W17zaosUHKRgUsSmJf/tSrPyoHFl5 o9mDmj3FGQy3dcUGdC/ohwsuPl1l6I4ZMYwdyJYjPSkB/QpH4oxjj4F3dE/84+G3mErXQlWWnbOY dpdbkM8OXDSxs83r1KNPQJ9e/8bTTzyHti0f48ip09jhK4uWBx8NBTShN9Synek2XP3TSzFy1Eg8 +9wTik7Lls2jMBLFc88+x85uTaxznaSaigi4lldU0QTfyJ7hVTTRP4Ee/bqzTj47qTU2skVtClt1 HoNjBzWw/efL7EzmxZa169F3wECcPPMINA5JxN8ffI8ad4Tm9ix2sgryms+yM1sz3QCsy81rWznW xKlHstXoBDWXgHRI0cu8SYMOOzuOddTbO5DHah5jUsCkgEkBkwI/RAqoinJahJyW8rVx0ybc9cAD 6DZkJE664lx2b0hC/thqzHvuebz9zCPoN3o4yrcsRSIB9YKLZqPXUDblYFvHLexR/e+nnqapfjd+ esU5HJZR6IwW94bYKEbljov8QJ88o8iL2W9742Y7/ssWrA8+dCkcTz7Nr/zI794bpXt3UttdieH9 eQxbuo4/6UiksjPUY5VvYteeCpSsW4+asp3wMNAtCPavZoetWvbm9jIqPRCsU/dy8Zmn42oG77mS k3DvA1dzHtIhjPHs/OCJS0aS9O3euJwa8aV46MFHVBe6V158Gm/P/wQLFy/GT04/kWAuneIkFS2A NHYec3ocOOX0U3HLLbfi7n/eiQnjxtDvHYBfite01aLJl8q5NMLhCCGX97Frx1z2aK/FuqUbUFVb yeI6Ydx+5z1Yvmg53vrgfZx+zFQVBChlZ6QegFv6tHLz6+4PK33qEmKvpczFBM79EFepec8mBUwK mBQwKXBAFJAYNG5SrEXyyG1YsXot8nr2w7kXnI2NdSECaxt2l5cjgW0gF73wFJIzXdi6eiGuu+4a zDz+CGwqC6OkNoCddYSntAF46uU38aNLziSASsAce6Vb49hfnL2bmPMuQeFtDV6kstVmXGI+drX4 WcgmB5HWCtQ0lePIY3+EU084GkdPGo2E+ESMZD/ziy64hMVcbHj4gUcwsm8vFPfsAX9bHZV0mvl9 LrR6g2igr7yefcSDwXp1N+fMmY3bbrwZ5WmFGDdlvIJEETBE642LS8TNBOYrr/wRCgpeQ1tbG/7z n/9g3PgpePzpV3DanDPRVFYKR/cytmONoMnbioQEN35yzS9w8RVX44XnX0A8e24fddwMxuFZmIrX wnaprQTjfsydr2GP92qcds5luP/+xzCsTw/06NOXWnkDPJzF8HHT8dTTL+HMk2ejqsmPveU1qm2p n0V9/DTxy6Y0d/4jee9ahp0J6Ae0ks2DTAqYFDApYFKAWVhSMMXADYKJ2+1B6Z4SbNjSjLjMBOze vIFBYhtQwD7akn61Y/kSoKEZ2zeXY1O/FmqwNmyluXntqp3IjGePbAawSeU3iTQ3iraEeQHxEydn 5OC5V57BwFGjMbhvP4w59ihkZGXinvvugy2dfccdTvz3f4/juDfnqp7p04+ajiwG1kk6+KNPPImV a1dj4ODBKK+vQf8Bg4HsIhT2HIgCRpHfc+/dSC7siQpGx7fu3gtnQhJmn3QsUlnWVfNRaxXWZdw5 c04hoBdi+/bt6NevH4YPHw5vaysKu/dUqXcFnEtZc5D9ohPw5DNPo9+QYSguyMbL2d2xs2QPxo4f i77sQV1eU42XXnoZI4ePgMvjwaOPPooB/Qcymj6V+f3PYfGy1eg/ZAQqauowcEAfTKCVozg/Gxkp ccjJysZuZhTIrP76lxsZU+BBQE8nbC+NqyfLmevUpIBJAZMCJgVMChwIBbQeEzG50A76b6srqlFT UQdLM33iASuKMpKwa9USpMU5MffZexhZPhcfLFqP2vI6JGXkI9wWQWZaInatXIDUSBMLrrDMqzSY osggTVKkAluIBVic8SmYdsJpmsU/NxvdqXmHWA1uwlFTpeEn66szoS3ejTNPO7197sEAa9PT191n yED1IxvhnMfTYp+SicI+vdDCAbtPOU724IPln+CMyUehd+9++Pnl57LcLYPNRPOl2islXGWTuYwZ M0b9yBbgNQSUTzheAuq0bRB/IjS9zzp2tkaiYCsmMwd+8iTteymPm56aiuNnHquAOUyh4YSZx6lj A4E2dOvVlz/afIfwxyuxg5zHKXNO1q8QQV/q4610CxwzeZw2D6lfz6pzmpBlPBTNNWJuJgVMCpgU MClgUuCLKEDY5aaDhkSrT58+FRu37sTcx+9FXq9haKJPfNHrL6B3dgJ+84cfI4Vpbmeecjz27izB 84/8H7r1G40Ggvqy9+ZjYJ4Tv/zVz5RJWSrTBVlWNUiwk5KzUpM9LCZ4v5ffMYWN5nNpzmIRv7Gk b9HU7ORxPprDLawzL13RBNws3CclWoNeaSBD4YABZ1YH/ekSHe4LwUFTvpWoLTnwXvq3hw0chIXL ViAjIxMuVrnTSrvyGryW5NnJvGQTU7z8yKb28Ri/n1Xh+NlJ37svQCGE1Ilw/lKnXkrmRimASCBh WG5QjcEaefQpaK1RGYoX0j7LMd6WVgoK8fTJ67XipcsbCe3lfci4quoex3SoOvtSpY47OK6cq7YY 68kXPUTze5MCJgVMCpgUMCkgFCB6dm6g6aHG+ttrfoxNW7fh2VfewYbVK/DHX56P008WTVgDuSRq 0zfd+CusXbcBz7z+HjZv3Iibfn8u5sycosLhQmwGI7XTHdKoRTqdGfVTWMDFLh1b5G+WbpX2qxEi uup+JuArxVlp/hbNXhVuJcgZddbtTJnTkJRFVmlNkMpwDim9yrGUuYElWh0ERofHjpRB/dWhLRQA 3FSPpT6cALtNhAv+1lLtpNkMzxTA14HeLqV4dAHHpbqxyS0LGMvc2LNNr/kuc5Jz2nVp1Q2uwxIg SXxuBvfJuYoe4ogwBBgBd5m/6ijH2vWC7xqeM8hOguMUmY1/Yn6bC9akgEkBkwImBUwKfD4FVOvV jk3gyM689AD69O6F637ZC82MVk91E6AEmlQtdDGnU6uldjlk0AD0508jtc90grHgkYCkloKlWfal GrrCKSmFqsBMi+UWQFNV1blP9VPXQZKxZ6rdqgCbAbbt8+N+6c4m13DKNZQqL21UpPO4k7+li5v4 z+UaUQI6v9Mbt7S32lQA3GHPjv2sVW+T1rBS7V1asnJuqk2LBBIahV35nZwfW9dVn6Dar/BYa2uq PnJMad+iFdVjwCCFEyVUyDwokejyhVY5LjYmrr1GvbmETQqYFDApYFLApMCBUSAmT11Xp6VVKbX3 UIhmcEbD01CutQ9VQGQMShBmMFwg2CaOcyRJ+Vjame02Tc2kwV3hU0c/cIFGvQmKaKUcR2BYDhcd 2AByOVs+G5My3P1GHzO5uqFlK41bgavUxBMw50cBSf6tpXgLGGttTw9k0+QICe4TUGcfd85Q7kON qfbqwoZC6gMZMfYgo0mrZjHQkV//HYvkMnYXH/oBXetA5mMeY1LApIBJAZMC33cKUN3VOotpmqcG YC4He5XT3xxhmphbTOHUyq30/+rIqQETO6BJ+VLRRCPsRqby3KWNKkFeAFugSsDZJj3QKSSIEVtM 8epAOV0uJ7/5S/VZ0bHN6Hges6vdIq0UaQPp5aOu3LLKfPtzkjsIiRasbAXSOU3M9l2Ach9PVSuO q7d4le9VpzZ9UspU/uWWgmGa187qpIK371Fd3tq/M9q5drR1VdaKL3dZ82iTAiYFTAqYFPgBU4Cg rndf1XFH4aZ0DmPDcyu7jokPXUVjSwi5wiftt83uZmdSasUS5MVCMCEGiUXFSa4DbSf9U2n5oquL d1vb2tPoumCe+r4zInZWjGOA3QD1dtVZnRcDisYBBwTIXS4ac1XdhtGxTLoo159ZP52uF3uwdo2u e2JV/xiZpf04E9h/wG+oeesmBUwKmBT4EhRQbdQ0H6/gIc3NSuMWG7hWBY6F2mIwpwOtVG83Zwfc OJx6IBsPlxKv7Rs1d8OgrgzhMrQIBfKRp7d/yw/tn/VYuv2CmW5R18z0YkGQk2Vu8oWNfd70/XJt pd5/8aYN6VKQ65ZJ2uLVX9rG3uz63L94JO2IWEp1Pafjuw4h50DHNY8zKWBSwKSASQGTAvujAHVr 6QsuUeZMGwsGVIU1B83v5mZSwKSASQGTAiYFTAp8tyhgl7QxSfWSyOza2lpVZU0+x0aFf7duyZyt SQGTAiYFTAqYFPhhUoBp45rhWUzw8fHxKCws/GFSwrxrkwImBUwKmBQwKfAdp0Cn1quJiYlISkr6 jt+SOX2TAiYFTAqYFDAp8MOkwGf6qXfkUf8wCWLetUkBkwImBUwKmBT4rlLgM6D+Xb0Rc94mBUwK mBQwKWBS4IdOARPUf+grwLx/kwImBUwKmBT43lCgHdS1GmwdZVE6KrrF1naL/bxvGkjUfCcTvpGU vZ+CLV2P/8z53xtSmzdiUsCkgEkBkwImBQ4tBVRNV7+NVeOY2uZkyViLNYSQleVVQx7mrvtZi50l YFgDXlVzZ4U2aTwSlT6p3EQI0IQBqRan1UILSYU5abail0bTSp1zH4vZRFl6NcIfVVlOdTtlbjzb nTqdTjWeAHqQpWmla5uq4qYEBKMErBTG0YSKqLRC3UdDlUNLKnN0kwImBUwKmBQwKXB4U8AeCUYQ YmcVaS8a8bKtaRJbmUT8iAQ8iHN62Y3NwX7lcSyF7uOdSPobS8cSqR0EaX+ANd1VWVbpWc7+5CEC tMONEPdHpNSsNEQheEtn01CQvc8dbJkiPcyJzeEgBQJVT96CgIzD1qQRtlWVOvEynqTaBQPSkEV6 mYvoYOP5mrBgAvrhvajM2ZkUMClgUsCkwLdDARafkS5sAtJ2NDfU482nX8Dsi0+DW0rABqmhq57j Vjj5WwrVgK1MLdTgqyqakZaRRM08RCCP43dsMepyiq7ODm4C3oR/Fzu+2dlqlFgdjPhQV9eG5ORk rF6zkvXl7RgxchB7ovMcfh+2BLU+6iJEyBhsX2qY4p0OqUEvGrrS5xWl1FxEbNB7oX875DOvalLA pIBJAZMCJgUOHwqwx6i0RCWIsrq5gOvqVZ/i2NBJsIXCaKxqRFxWDtwJFmrfflTXVCM9qTu8oTrc 9Kd/4dpf/QyFxTloqG2iNh1BvCeZ7UqDbMHqUj3VrbZGlJdXICkuj0p+AH/5899x2aWXYeDAgQjS KmC1elFb2UgrgAMZeezHHgzC53WgxVeDrMwCmuUdaGpsoTBQh6ysbA3O9Y4v0te9vYvp4UNPcyYm BUwKmBQwKWBS4FujgN1uZwNVq5jLtTagqWnp2LRpJ5687yEkO5phT8vCFT+6CM88fhfqGtuQYC/E hCn5WL5iBTat24LNm5bjxWcWYPykEfD7knDxj0/AHbfdj9NOm4Nla57De++sQU7aGEyZ3gtLlizD 2JHjULp7G63sceg5yIHb//YE/epu/Oyak7FndyneeXMTWoK7MHHSDEydMh33/ud+GuNbUFTYG1dc cSEFBQ3ZjeYz3xrlzAubFDApYFLApIBJgcOMAvZImEFu9HULUNr1PuqtbT76t+348z//hmuu+yN2 7qpGHbX0qdOOYsOXePTrl49jpx2PyUdMxiP/uwOTJ03BpCmj8MD9r6kguZqaWmzbtonAvwz/uv02 lO4IIykjihnTjsVxx83C63NfQEIcMPfF93DBhefCZc3AW2/8F2mp2RjUfwCmn3A6HnzoReTn76LA 4cCsWcehrYUBdBJcJ7IHtXTDNG/Gyx1mK8qcjkkBkwImBUwKfGsUsFtsVoQjAZrP7SowTYLRgiEf evTMATz83+NGbn42Tj/7LCxc/Cl2bKxEdu4ECgLSU51+dKcHaVmpkIB4h0vLW/PEudHU5IXLmQi3 Kws9+wJNzdX0vwd4jg12l4PBeAyei1iRnpEJtyMVrrh4RIjQhd0yVUy9dI0bP34Qg++8WL16Laor GzBp8gTEJ7jpr9euYwbMfWvrxrywSQGTAiYFTAochhSwhwjkUbdqps7pReHztfJziJHtXv4Zhs/f iJq6anw8fwHyC7oz4G0XnO4kVNRWYt777xPMKQQwCC47Lwt7K7bhrv/7P+zYuQ2nn34qtu1ahtv+ 8TcEvC4cd+JUHteMV15/kVYAv0TRYeTYKbjz3rsJ4HE48qhRqK6qRiDq55g2An6Q4+zF2nVrkZmZ ioqyGroIdAoyEE+1eT+wVumHIdnNKZkUMClgUsCkgEmBg08Bu4U56DYVLBeGJyke5110AeyZLvTL G8MUt0Zc/qMLUdC9GPGuY7FmzXpccMnZNL/3x8WXxzEVzYuhwwbC5XJR03bhZ1ddhJKSXTjyyBno 2as7g+J+gXnz5qGoqJjHDUcCG8ZUVVWiW/ciFUWfk5PNwDhxktsxc+Y0lOwuYRS+AympibjgonPY Ma4ANbVDCPZV+PlVVyIxicF0oqUTzA1TvKTMmZtJAZMCJgVMCpgUMClANFW91BmKFmQeuSfOg+4D BsAXaYA7Mx0Rfz369O5J7Rno13eI+pGtjT73oUMHKk1Z0tEpEyAUDmLwkP780Y4JM/89OSUJp1Fj l00C8Xr27KV++BdN/iGlec+cebT63ucLEMSLaFqnFs9Y/J49i9WcpkyZrL4XX7pRqa5dQzc1dXMN mxQwKWBSwKSASYF2CtjFN84ENFiYh251sAQNwdZpSSaI0rPtSFTV2xz8EdO8FJ0RQPV4mHtOlDUK wUgOuY1meG2fZiOnAUCBsApok7E6VYeTI6wMqpMqc5p/XNLX5CoSGCequMqdd9jav1fmdvmJ0cxN 87u5kk0KmBQwKWBSwKRABwWI5FInTlN5VdlXQWP5mxHm7d/wT82H3aEa7/uzlHLtTF4F2u37Or60 qut0bMZ5kqpmbLF56CaAm8vWpIBJAZMCJgVMCnw+BfbTpW0/3VdMapoUMClgUsCkgEkBkwKHLQXM 1quH7aMxJ2ZSwKSASQGTAiYFvhwFTFD/cvQyjzYpYFLApIBJAZMChy0FTFA/bB+NOTGTAiYFTAqY FDAp8OUoYIL6l6OXebRJAZMCJgVMCpgUOGwpYIL6YftozImZFDApYFLApIBJgS9HARPUvxy9zKNN CpgUMClgUsCkwGFLAQXqkktuFIrZV5MUSXAzkty0fm4xW+wX+71Nra2rtsnZZm3Xw3ZFmBMzKXCY UMDgSVKN0ujKaJX60Oa2DwoIfw3qvFUqf8VwaVVzJMwf4cNCv841Qg4PcsocjeYeOspIl7CuG/uS aJu07IytRGacL79l/zdcblQv0NZ5ugbm6b9VsZVDv37txgtjgLnxd+zkZL6x5FbTiq0pY6C+VI1r PzE2110/QBYXa77v+8Zlb+yDONS58jHXMsrVxcz+8Fjo5ixMCvwwKWCAuAB7OBxm9UmWyDIrUH3O YhAOLcC9L1AzAE8AUSp2Hmre+lXWrMxf9dXWT94XKBv38RnVUj8vVjA49ODZ+S6NCm37oq22T4qt So8VWceHUjhlQxetJKvxwsjF9vXyGGTcR3G4TvcWU3MuZn+sRNX1ge9PovqGJS01rW/jml/lBTDP MSnw/aeAwYcE0A8lE/w+UJIwQeVcK7GtNFhpyKGQRHYZ2rn+u5OG2+XuYzFpfzrWl93flbV2vYZW rpT/GAqfjjbyy1C41DncYRHjsn6PsfivjpPvRLDpqsXH3OP+7s+glXHogd6jTMmYo67UdkIRhfXE VP2Yb8JG0u5Tl5emoaEBra2t6gUyarIb9xrRZ6oMGzFWhQ6ZiSZ8i2Fm10BcbkbVcVd/GcBOU1q7 3r8/iXFfktjXefUMO0PXMYxVEzu/r3Md81yTAiYFDgYFBNDFapjIzo7SBTIUCillw9TW901dpaNa dfO66n5FWrUDlBQAJ9gpSyk1RQFPnfVG25m5drAlxmwf+93X2a+wIOY6nxlLrknssBjHUOigmtkO 6O3HK1gIq54jSnCR9WBACD+wO4l+j3LvAuzaPR3IfXzVe1dT1+ncDu5qgsbedsRXtBfvkd2uCamH ai0rUJeXRy7S1tbGbmk+JCQkfAbURZDqeC4dmr1QWJu+vHBs6KI+CYE5aa1FC00O8lv+FjoHKTjq ZhYlMRpSmSw4OV8erlzri/0isRaGWCGkE7EkXoB15tvJrBa2WhXaT/tCkvs4dHJU7FwPBtMzxzAp 8H2mgPCklpYWMkBpFBVVoN5V2fg+3/+XuTcD14LUyK1W4WFh1QFT8V+d3wmwGXxawMXYhFPHbjGi QDsuKd4VY8XUeoToFt597NeQtPMdaOdorLfTWGpeghjk+0azD93NEtUtCu3zVvxaVxx14O8YK+Y7 Q5M3piCAL1+rCXTM66veuw537QKQNCaTO1CkViQ3lFJNoZU5irEkHAzAxpgAj8fDBmbOL/OIv9Sx yvxumLbEzOV2uxEXF6eAvutm6LWxQSs+vw+ZGZn6oZQHuWBsNIO0tDTzRdQWj5Ud3DqkJnaCk05s 6sb5wqqWqoR+Si/hMG/axscbDsFhdamFub/NkOQdDgf7ust5Wke3fYFnVMQj/YFKFzoR4jRydwTw iRBh+Yy//0vRsv1ggz6yI1bAiBU8vtrI5lkmBb7/FDDeGVEwhDcZSkfX9+n7T4kDu0PhpKI4ud3x 2LlrN0pL98LpIG8V1Yq8NywCkU1AWAM1G03zSqXR+aVVECfGZiz0lzgG4csiVIVCVMT4vWrCJb9V sKKMJ105O1BSm4f2twgXIY7hIF9Xz4/8WS4qwpmNcwmHNSHDInPhfiP+UcMd7ZnLcZ2BVwPLKL8T 37SAYyAgwYEaaAsGRMKagmqsGcEgAV1tE8SlBYhzkI8GZhhUtsp96zEcdpsmTFrV/D4joajzFWDz Hx/xp6WlkXTVm6GJAktaybVdDhf8/F4mOKBfD/TsnsfjRPjS5ngotHWlqceaAuRCxk/skrJy8u0Q qCQuAngkrLT6O+++CxUVlXC6EhRYtvn8uOKyS5CVkQqvl9K2JQCn3YogX1K4HTzXRotAkAvPwYXi UO1eIwHeoHqy1OW5GCwiTcZGcHZZ33J9eSjBYFAtwFj/m+wz/raQ0MGgtI0Nc4FyDkE96MaI9tM1 dnk41s+53oG9XtpRMh8RNmSL1TK+zBjmsSYFfsgU6CoYG0L8D5km+7930YIJJBHhsX50LypEn+4F CJKXhxTTFtATsCNPIqMTUDd4kwaoHYgu4K2UsXatWSGEBuTC8zmOnSDp94XgIi/vukkb7rAAs/Bn CgSimXGX4r3ynQwjgB6k1monjxQtVoQGt9tF4UM71wBS4e+aNVX7ZRhYhU3LlAMBP6/hUPcT5I3K HI1bMT4T4zmmCDLafSl7rG4EFnCN3QT3NPjWBBZlxFdm8s53qa4djMDltKG2vhErV65G/769iEd6 EKJumZbrinDQ1OTDyhUr0VjfAGuP/EO+hA8oT10A3TAoGMAuEpw8YJFSli5bimkzZqGsqhn5WRl4 5rmXcPe9D+H3v/0F4qn1B7wNcHAxueKBtkgQ/pCV1oAkBHwC4CE+UCcffIQPm99xPJHylLkmVnzs Qgp5yQW8xYwhc5FNpMCumnqYD9LhiIONkmtrSyuvm6AebpiChPLhKHOOSHAdPpivS3VD2JC5GX5A 2Wf4Bb/u+Ob5JgVMCpgUiKWA0v7IzsLkn/GpiYovhqhEJce5Pwu8mi26wxQt7E/DTe23QwNXhwJV AUXN/SGKinwWvhyfTEuqPrKBeYYrWaBSgFxGFE1a+LMIAopHc9wwyPOdce1yQzz5f5gI6PbYldLl JFgKjxYlTwkcuoAhvxQoi+Ah1lybm5pwhxk7pIQFzRKguW00TVh+ZDwHx7M7tLHtKvgyNltLI4A6 h8cpXs1dgkWxQo+y7/IeXE7OjZ8bamtRkJuNYQMGdKJzrG4v45Ts3KlbRw79uj0gUJdptPsL1Jw0 k4Qh2eTk5KBb9+6o9ZYjr7gXBg3oh5C/BTfc8Adc/9urkZOTiB3rV2DH9k0YOWE6bHF5HMKGZcuW 4f33P0JzcxMSEuPQp293nDzneJpV3FyQQf2haNKOPFDRtkUIlEADIZq4Cea/955aidOmTYPf76ek pj1Aw2zjpDuhoqIWzzzzCuoaajFu3GgcddQUmoPYSl7MJQR1ZRLiebIYNI1AAhrENSDX00xHhj9I LiwPWUxLQgNZHCIla4AtsgEXDheUz+tDkC9YQ2M9srNyuGhDmklMXjx+NiTCQ/+IzSuYFPjuU0Dc czbdPaZZv8Ts2kWF4h7DBy/v2L6+P3iU0PiFgFHHZkCjAY8H72qfP5JmkiZV4BSgIt8ShHI77diw YR3N8eUEIJrRCXqDBw9Abl62Ol5n5Z0yyQzfc1VlBRLiE1BWVkr+nU3FiyBMbZv+WmrFQZRWViEj PYMA7DIc5Yp3ihK1t6yMAgCBnHwwOSlFWW+ra6rpyo8gLS1Neyyco/B1GV8Unry8fISo/Yo/VqYv eGMTX7i6FwkQ4HX9AdTVNyM7M4t8lJYCXnvHzs3YtnU7evXujR7FvXkOtX+ibUTnzyqYTkzdVBhd LuIK14WVOBKm8GDVrantEo0iSBR7SnYhKTkZCXHxmvVYk1A6JB/1N/m/so4I+HM80t4vFmK6ccUV ItN2UuDgLsR7xArM9aiT/CAZhPe7JA4I1KN6qL4mJ4k4Q2mL4fBi2g4QzORZ+MRkQ2msui2E3F6D sHr5YpTv2Irnnn4CY4f3x0fvv4o+/brDRgmS9CTgBTFy1Cj07z8E99xzP0477WT07pMLh9OBXbtK kJyQiLSUREp2VuypKEecx0lJLhlxXEM11TRjcE7ZuW5U1tSphWRz8PPeSuWjychI5wISoKbk5gvg xZfewrCRYzB0aE/cdefdBNkMjB03ErtKynheFBlZyfB7Awi0+JVgkJqRhdrSUiSmpcNDs5CXAYQN rT4kJUisAd0L3lakp6dT6rOjtq5OBRjm5+erc+V6zc31XKTZ+GTRInz00WJcfc1PSDcn9uwpQ3y8 iws7m3P2cZ+YeMzNpIBJgf1RQNOcomhpakVNbQ3BPICkpGTk5hTA528jc9dcb5o7ju9jbZ0SxOX9 1ILrNBOqUkB4TEcKr8alxdqofMq6nmoohoYfVb4TBUH7m2OJ4qgisC3kC8z6JnBqUdsyvrj9NJdi mBZJmbdEYQvPkP/sVBQUqOhmX8Xcyd+sPC4SVn/wHjSMVIFuejS7KA2aoqFnFelasEEz5X8mLxaQ FEVF06/FdxzEv279G/K790BqcibBOEQ+lYW8/JwusT5+/u3SeJHOkF544kkMGTEM6ZmZSjMX/7Wx +X1tuPfOe/D766+HxaXNWyytct+rV63Atm2bUVPTiF69+mLmrBlq0I+ofNU2NuGyyy+neKFtck4b racO8tiFH35MxbAYBUW6eVrdhKY4amZtC5WzEjzy8HP4wx9/Q+HFQd76Nua98y5SU/Lw1hvzcPYZ 5yC/IJ9Avx0Tj5jcqcyLAPq7b72FwUOHEjdy2+9FAFlzC3RAYRl5/ztvv4dLL7uYcxThUDfTGxZr CQjn87FS0HRQ8w8ENAUuRKFDFEBxI9g4Pz8VO+VqZoyZWIa12IRDz/EPCNTDoomKJssbtMnDEylF Fp2dZhNOOIA4BO0e2JISsL2mHuGkdEw44QR49/bC3Ef/Dw07+2Dhpzsw4/TT4E7Nga9BAig0m4+D kkxikhOpqSlclHF4+80F+HjhAnjiUnDpxadh9dZGvLfgbUpE9egzcBbG9fPgpRfeQZQEzC/ORlJu Aex8IT7dUo0XX/kALf5mTJ02EUeMHgKrtxl7duyGP+rGqCNGwm314cofnYMkdzo+WbABr7/9LiIe L04660isW78bJav3cqUx6C5nEOJr1yOS2QOzj5uKp+97CMGUAkRbapBTkIstO3bipJNOQl5uCl5+ 5T36TJowadJECgBu/j0XTpsH3bpl8h5sWLG+EdurKynklGP7tk2kXD2mH3k2RowogJXWDLswA5On mxQwKdCFAqI8BMls/RSeo7jpL39HK+Nz0jMSUcJgsJ9c/keMm9yHPERScPkWkQfs3LEHt9zyDxx/ /PE47fQ5irm2trUoQE6k1umjD1YA0y2WQIKrt83Lzx44mDInTNnv9wo8KQ1VALilqUVpfB5qbDZq dT5/kEpMM4Hch5qqNjxwz9v46c8vRVKKhfvrYXO1IN7ZnRoneWK4kUyfpme4qVy4abnjtel2TIiP 434LfEEfFRYLTcJuxh3VICkuA/62ZmrXEcYmJYGyC1p9Nbz3JAKFkz9RKgtaNkAc5y/31MrsANFW gxJgTD4cpPWzlftTDI2QgFiYmYtfXPtLasxJ7fTdvnkbNm3cjKqaPZg96xyk5TuwbMkSulFXwk21 8oQZc5DMe3BQ8YiLT0eCMw0bV63FB4sXotfAwThi/Gig2YZn/vcCknOTcMzMaSrAWua8fMUqTD9m NOa/tQGRYDKvKRYVG1ytQdLQiQ2btqJ01Vbsba7G8eeegkxHPBoCLbj9n//G0UfNxIWXnYunH38G /vggzj3xPLgSnNhWugvvzH2DilUTM9qyxMOvVPl577yGfgNH4JwzLsbuHRXYvmUjFq15Df97he7f fo9iyaKlVPRKMLTPIAwfNRz33nE318XpmHPOGXj00SfgiU/C6acfw2cdh+WL1mL56oUYM2Yof8Zj 5fIdWLtuAwYPGqCEts4BgR2plfI8nE43148V/7nnYa6rAK6+6ipUMsbspltuxZlnn4dJR4yHhcfI GlIhAoeY4R8QqItUqmnrHSH6dkqNfgY7WEkQCeiXPHYvH541MV49xkZvEzauXILTj5+OupIduOrH J+Ou2+9GWd1duO1fdyEnO0+XWkVSkmhEvmTeEJYuXYFf//qXBPZVeOPNt1Ha4sFPr/oRVixdiFWb GxCsW4uTTj0JkTY/3vlgPuJzbPA4PHjjjQ+QmZ2JxGga3nxnPkYO7oMMWgUkglaTeoEWatj5lFKj fic+WvAxLrzwQuyu24olyxbyOA+GDhuF3sWFuPOFD3Anr3nbU+8ymrRKmY0uu/JcPHb3g+heXIQB lPa2bS+haWujosnwkSPxFgWEMWPG0rRVgDNPl0XzAMb1H4lpR6XynO6Y98YG9O0/CC5PM5JT4pRF QflqaBL7TCSGyeBNCvzAKaDpM1owrI/vrWipf/7DLSgoTsfrr73Cnw9xxFGDsHjJB6gor8OMGcfg nXfeUWfNnDkLHy5YyIjkJrrbxqjsmE/XrVf57kWFReQVb6Jfv/7o27cPBYQSlOwuURruyDHDCZ7A e++9S4AKYfKEySomaNnKlSirqMLkqVMJ6AIoGs9qrG+hEkAfLfmgzLetpR7vL1xLP28qxh0xHOVl lajYUwkfAW308IkEPisWf7KUgn0QBd1yyQNo0g5ZaFVwYsfWnehWmIutm9dg89a96FbUD4NHdMfe PVVYvWY9unfPR2ZWpjJ3vz9/Pq2RGRhFS6fX69X8xORRqmJZu1VVXBFOVJdV4KpfXIWMpBxQrMAv rroUb735Djat34yBQ7rjpefewKxTBuKFZ1/A+MkT8eiTz8MdyqeC5VCm9vvvfxKnnTAbzzx6N6ad fBKWr/kUPXsWormuSfm2P1zwCQOi8zBx8miUV1ZjN/llt8K+DCRbSrq3KkCXzUpLZUJSlNd5De4q L6K5Nrwx70Nk11ejLtBABakQ2TTnv/Tsi0hMTqLS14KHHn0K55xzMh647wEMpHm9kc+ztdXPuAE+ AqcfZ515Fu6571HMnbsQk8dPxOWXnYd5T+6iGb471m7YhNLyMgwZ2B8vPfECXJxH927FSE5OwbNP PqOEqyhv4IknX8aIIcPx2KOP4NgTj8GH73+CESMnwB1nxcrVazBk8EBlJeioqSp3Y+CglnUgGOBt CyIlJQMPPXg/4ohHq1evRkNzM5+Bg5bdgPL1WyRD6xtQ4Q4I1LXEgs5mA0ldUIEMXKI0OPCHpm4u qgClYxGkyioqsI2g565PxZFD8nDMuMHKPH7z3S8pH4W8rAFq2xLgoVIuOLyf5jQX4x7S0+K4qOhT pzQdpOadGG+j+SiN31VTeqX0TqnQ406m2cZNrVjMTDSbU4jwljegoGcuRo8YrElW/D89PZW/Q6ir bUP/vHS8+uYrSE3M58tJYcDj4OdEKueU5D0uLip+prTeIz+VLyBNZW1NcFKsykpPBmM4eKwbuXyZ WpjGF/ZRYqekUF9dhmBeMqZNHklJPoDstAQeyyAO0TLox7GEvEi0u3DMUZOwlWapT2meckez0b8X zYM0qX0T5pgfOD6Yt/8do4Dy66p0Jo2BivlZBN+161YTDnNQSX9u7945WLF8KebNe59HuFFWWkNN tg1eCvFvvPEGtlBrC1LTLCvbiazsXDzw4KO4/PIrsJzaaJgq5ZKFS3HhBefjvnv/g8z0TGzfvp3X Oh/N5CPvvPUO3Xweso0o/ck5vMY8xbxLy8tx0UVnkdfRzM2/ndS4Nd5HiyOjgJ9+5jU01tLPu70C NfXl2LW7FBVMLwuTP5XvaUPvvml4+eW3EYoG0NRWgaNnnI7SHeW47LLT8eB/Hub8LsJzL7xCk3ch nn/xHVx73WV47tk3qf3H0SpwJ62MVzKzyIfde/di0cKFtEK0YfzECUpoEd++0ykU61ADI3ToZuXm 4Gc/+REKs+mzJpNNZMS6y7kAJ580G0OGFuOph9/HBxRihg0ZhNnc53Qloq2K+rWYkcmTE2h9TWUW 0+ARIyiQfIL8voMIjMkcNxvnXXwmLE+/SMGlkdf1cj70w7sTCcisc4ImJCaI6VoD9YCPZvSMMIEv DbOOnAxvYi3e+Hgr0hNDyMjOwbARmejGud5x7x3oNqAvbHx25a02rF75KVIpWJ1/3oXYunUdnnl8 iSocJzy/T+8+uOP2O7F+/XY8/ujTuPOWOzHrqNHo39qCaRPHoa2hEcuXL8cuautOWjcGUJDLZnzA 488+jb4D+ymsrqaAccKxxyOnMBHLuJ6GDpmospey89zYvKU05s2Jxb8OGhtxBLV1DZg+fSbXhINz +hd69CjG76+7gQGFqbTktlFYpEtG0vgOvfW93b3x+a+9spQberq2bMQbLNJtmKloqkIOXzxZvBbx 69Bn3oMvQ+pxJ2PxG8/h9oVL8MHCTxlI18aXrxJ19EPnFxRqQW0ENpdLpN0QAyDiUFCQh3/9804G tTXitJNmIaXCR7PGIwRtgnv+KAztNwYvvPIWKxgzwpEXitJcHqGT/miC5uLlK9FGE1VBej6Ja6Ml wYv8wnw+zJ546L77kZ/jxE6+7D//yTUYMLAXHn74IUZ6+jFx2jAygV3Umn3KL8WLMZDCDxdT8ewU CCIEZjdvOsgXPsoxKY1Q7gxixPBh8DfXIsiXy+6JQ6KLBXwa6OeTdA0GTiQzDmDLplVYuzYP2zbW oqm5ER764Oy0Soj34XPS8L9jbNicrkmBg0cBLShVUo80QHDQbCuVLl9/Yy4eemQ7Y2Jycc/dD+Dv t/4d5eXVNJEOY8rQGjLVo6nxFdD3WobKqgr07FWMFauWY/iIUZg2fQbGT5hAze88nHnaKWhsbMTq pauQ5EnCJedehBUrV1B7pXZXsxc/IngOHjQULY3NjMG5U/nye/TsiYULF2HOKcdRcKcpVXQX8gb5 cdJUH/SHMO2IGVi8cAs19BpUV9cQzhJw0uzT6fN14I2XVqG2YQO1y7ORlZOKf971Z5XG67FRh2Rw FbmCqvcxhdaAnQR6CeSd/+GHcCcm4IbfXIvb/hJGXVUNPlm6RPm691KxWMzPE6dMplZMnzD5nVj/ lCikA4do7S2SRqwjifiOxUctaW9yZCPBxufz0irQg0LCWpUdtHzFCvSm+1HUOD+tESJENJAXDxs6 DCMnT8Lf7roP/frmqyj4MJWY1qYGJGQy+E3uwMq4JPJO2YoKcqitLsakI6cw5qgFS5eswInjjsPe 7TvVuI2MO6ItQF0/muDh86gjv84nLuRiwKCB6Jmdgo2Vrcjh2HVVVahuqMDG9Z+iuq6SAW6kfcSD v//jNlpNR+H4mbMRPOssvP/a62iiH1uCsJ989iXspZtmzokzsWnlRiqDPnjJ073k3RnZWbSuDqPF NAXlexvR1NiCo2fOoOUhDnfd8TSmTqVAQGVS0uX2vxnoLBhGlzSZeQNjBsbRYnAN121eXh5jP1Kp rXtpVXAx/Y9CohFwd/BelX2O1N6lLTYvtOuRFuVA1w1i6jd9QWJW4EOV1ASJFlzx8ceoYe4iYxKp PTPlgAEUuzdtwqxjjsZR06bSRFbDh0FT+h8TaQIrJG56qS07lUZ9ypyTKf15uJAjmD37OCxZukyZ yQf1K0abowQ5GUNp6t6K2kAT+vTqhQAD8moqG1BTtgOTKJFFGZyWlZalFlRb1KukMKluJxIXdX0c M30iTfNJqK3ehRNnziS4FyI9NR/xiR7YaWYZMrwPtfOeSKaEyQBPzDmOfhtq6KedfCwD9uLQM2c2 H1oIp558AuKT4umbC6J7QTZdCNlEevrXamoxhJKu0CgQ6I1kBsPNPn4WF2g2LjjvFDIOK015hTTn rCazOII5jSPgZXEeyd3fV5GfQ/zMzeFNChz2FBCBPyLBuITGIN8xD6Ovr/vd72kyrcDvf/9XrFxW wgjlRCQlJqFXz34E+gKV9VJfXy/hVdQIk9G/Xx+aivMZed2ggujEvZdCi19mRg7jWmbwnS/C5rWb qJXHwUctP56+c9maaTZt5DiV5ay9QR6VlprGsQYgjed5qJFHpaaGFDmhNS6RPl93vBuRpjAef/gJ DBk0hYqOX0ns0YgLbo7dTMHfQWtdJKrxipT0JMX3QsytDgcYBU7TpmTLbKAP9zW6FqZMP45R3vXM 7onHbmr6MpaXQk1cQQH5rYuWzDQG+o5X4CRxAhKV46SyoErASrS3juo2Fj7xJCThX//4B4UHDz0F YZx44gko7snAubRURmUnIbcgA2MmTWdwWRVu/NOfSasmDOw1CompBUiihl7cW2iWgA9ordhSthvD hw3BgP4DsaPnDrpkXSjslkdLqkTAW8gPixGXYEFtVSWmHz2Hro3/0JX6K5VPPnXykRg5jNbKjXVw JTmQ5swhj+c5ngQ4kxIpmMRhxZrlOOv8s/Ffat1LqPkfe/wZ6NO/LwWXKfjjdX/k83FgwJBJKi7C QmQ/88wL8ODDj2DeW+8jmYrcz6+4FBH63V+b/wHG9elPRWoTnnziWWTQqpCdn4308iysWfcpzjv/ PDz62KPKEnHqnLMVDjz+xHy6a1oxfeZ4JNI9SvaMfv37q/UgBWliN62ErVYzVdzS4rOR3yLoeBk7 MWr0GKX5Nja3qkBvG4W+AJ+z+IC7DHVI3kPVpS12M0oxdq39roLelY6umeIDkkfIv1wEplnHzKCU 14iMBC5cFUmqFSpIZ/rEZEYhDhg2DH0pjcoZcjl/W6OKOAwxWlxSyQoI4ALA3jafSsM4esZUFWEa 8LViDc3VZXvLCJ4RnHj++djw6SYsXUvTGrXh42ZMpmk8BeE2mp8I6ONHD0WIa7uZvpxImC8WJyjR sqFIG0YNHUQtfAADGvyU+mkOIaEnThzNFyJI4aSVZnUCuVRqkOASiQvw0ZSfm8H3hKkQCTlopikr OzuDvqsgGQwjXK0JSogQn41ULJLId3lgVqbmhWg6Ku5WSPNfAMOH8poMogGD9WYefRSH9/EFZiyC EjoOccTEIVky5qAmBQ49BVQ1L9pZRbmRLBtJn6phTvCgoXmYc9IcPPrI07jo8qNRUbUb77w7D2NG j1PBYFLgY8qRR+CJJx6hb/x98p+xDMJN5fvZSuBPJW+ZQY37Y8SzdsXooSMY5MagNPIaG/lOAgH6 mGOOwYMPPsjAXAtOOvEkHDtrFh5lJPj7HyzAoCFDVWBalOZzT0I86hor8Zs//Jr7nDj2mOPp2/Yo TTeO0dzJ9AuHI3bFGySVLDUtGUcdeyItDC/irXfCzBYKYixjcO687V+48S9/ZI37VAYMx9Oa14T1 9P8XkX8MosZqtSXil9dch8qSbRgxmlrpCcdTg18goco4kT5ucU2IC1OyiRziuyRHE9eAcBY/afin v92EFkmn5RzovldpeC6xRuoN3c79EV0Ae7bCQ7513nnnECSfpMnYhhmzTuQhPgwayVxwDtaz908Y /EcexyhyEZou/PF5FG5AP/QsXokfyHjjktKoUHXDe++/jdPPOB8/v/pXdIfQ926nm5TWFvHMnnPO KRKSoEq396G72i4T5bwYm6Z4rYWBZ7cNHA6vtRXxdj4bsuTZs+fg+GOOBdPSeW0KULwXK++tqFsv 3HjjX9Ei9UoYhKYy8sOp+PPNf1VWi1nTj6TQxO9cWoBazwG99Eh3C4bSyhriGB7R4jiBG67/Awvq 0DrL9KrtO0oomEQZDD1SYuM/k6MkOfwiOIlGLIXSlKdXrCD8IIKCxDmIgifZUQG/BFpKTpt2n128 2IfkRWrv0hYL7vvviKQDtoJ2CcSQ4JAmnHfOmVpxAUqi2jfiAxPTmR11LV5Ut/hYcIY3yXQ1J8FM /O/tlftkiTDyQe7XLpEXBFkfg+BCTPNg0CtT3U5EXQWlVkaAxjEdY0BWGqXHbiSYk36iDB7bwgXL c3l8iH7uIO1idrGNiQClfP6S7xhk4AtBVMdQrWxgmA+R4hiPs0fJPPTcdtHQEaZJSIoXiGCgYgXo rzJyUiWdQQ5R7SA5W2oRkotobCK0qDx2VbyAYB9g3osqbKMFAqrGBWRS8l2X0geH5AGbg5oU+C5S QNM1rGSKIZUdc8WVl6jCUfWNFTjyqCkY3P8oZDH76aKLLmCUepBaX5HSfEePHsmI7XhcfNGlaGFM jASYiWUtFHLyXfQRII6lC3AoLXBJyMvJxYWXX0hATSCIzUAkjhovtc6M1HQFej2YCiZ1KC677DI0 t3qZblWoqpNJKVIno+Zv+vufqVGXkxfYkJ6SRdDth927a+gTZxOauETyF6nxzVQ0Sy5GDkrDui3z 6SKYpua1ePlHdA8U4fobr6OGWI6sVGq5iXZqy7+nGTeM/KLeqGzegT27K3EWo7Ufe+ghavjU0MeP Ry7nEcco9RTJ+ZZUPSnYQnBSVdMkP9+h6epSolU2F3kZ8YUuw5gtps1FXkE3mtk/xPMvvUjT/iAc M+sI/UD9IMWcJYbALfCt83eyMs3Oyx8pHqKdMm3GNHyycCX5ssRchVV+u0U7ULkc1aZVm9VO6bBi czzN3G2lqZcilhpWFbKTUxg/pWray2eFE9qJwsnjCejt6hHH1rqMCN/njwB6zHWMQjIOEkvuTpQ6 cX5IUJeLcVVytcamRgpPM2k+T9TxQ5+3/kvczca0pUBPG0E8PSGDQoWou5IdRoSTNEby/TgKi34+ HxUPbWROdh7uoP+l0VVMNvyJzef8vCuJ4UGiP9XCYeRlS1O9Vq9dAkdUJLuQhsUCWL89ZOFSkpry CkepIat4fl08UxfZh2eZx6py8QRihz2iNOY4jlPJlyEx6kDvwizt8dKHLwgrjQCsKsRdK0PY3hhA f5qciYhS/JEyiTJrMYVIEIeIWHxAsl8VOJBvpPNPSIW/GPXhJaVP5TMq09Z+5tyJYIa1QojLazFC tr1ynSqgYXrTD/pKNgf83lBA5ZyLn5rMMIWlp/30uyYmZiktSysr6mMAWwGBqAI55A3+FCn2wTgV gpdY4PwSsMqYniSvpHER0MiwJVDKS2B2UZvtzaj3kNTrZr51Qhq1QYK0nUGwXvInP33VxcXFikVI xLII71mMOk8nqxDfqZTjsBOkBLAcrITWk+VBVR0c+nj9tMj1ZjBWMNTAz4ypSXVR6amjpsoAtXit IMncV18i17Hi0isuYVpbkGbjdKRnMy2tTdwMftawSOFPnOJTEpOzfdMGLPt4EYr79KSVYqgCkGIG Ycm8pEy3cKY4SS3WS7NKOday0grq2AQV3pdD6mqQ5XhEGBHORwYmPEy0eVUWm0qGuD2nHj0NR5HW NCJi865SOBlH1Gpn2l00EfFMxXPSwkjZBS2SM85Yo4QAAZCWiJCTGQB0ciKcTJowbY38uk+/Edhd xowCjhvhSSoPX6yYylGgRWcJPxVdV+rLqXKs5JERCY4WvZhKls9G124wnjxX0JBCC2kX4nwCVBbt 5KGOsKb6hjl2gA5tuTc778ch3el0hFdIoxi2ZmOOVaJE11a0ECuN9P2gmdzO5ySWXbHsREiXTdt2 qOIyDtK3a8MwZUHij+Sob99ZwmNLuC6kf4iGiwpvaBGJcL4Bjt9Av333vJR2YeBQvqx2rWi91gZO tHXJuZY0sM5F7A0g1lriKQLxPFlAIZqzXZRG5Ca94j/gnTrELsOjmNVOUJcbY24oQTTqb6DklsSA BZZPlbtqb9WqEd7YxDQjmrqdiynMFBJX1In6FtZ4p7+m0UuIdjI4TkCZ+8Uj5eLilfx5GcOvHrI2 lp0DcV3JUuY3Us1NJDpR4QXUNaC3cgGBvi/pYhRWxR5kwdMXT5+NBMkpOZQPxsZ9mhdFu87nb+Jq 0AsWKFuTvAh6hSvVMlBq26uyFIfy2ZpjmxT4TlJAKyQjPSEIXHy3XQTPgE9vDsVYHclJb20jqDIl pb6hhn7uNBVwK8GxyuLI8wNMSZOUrhAFg6gwIPIkyXgRZUTSoqRIiOIzfBf99I07aAlUgkTAC59E KfMcG997MalGCaB+jmcV06RewjpAhcLOgletPuay0/RsZdiX5CE3M3fcxuIbqix1Wy3vQyt609ha hZEsgDVs+Bhllrc7PRRKpIR1mIFk5ItW3gNBPWqjlVIC3/jkEiiIXPWzn/D7sKrEJl3rFH/ivaq6 6GLu5f0J7xY3ZpjSRTbjfBqZBlfGQD2xU8aTJ7cy993DMQXggkrzFRClC1EUDOb5K37IjJ0g/2Y3 D1iZDeTh/lYX08d4XMDHsrCsExKg6tvAe4atjUJICsfhdw4JjOM4Ypq3Vytex5HJ46vgTuC9t9Hq YeE4jLWyW2vITOMJpuSjNsY5+HPIy+s5Fyp+EaZG0+QeJiYEqAy6om2o4VgusYgqhUoEPQpLYokN u5hD71bV20K2EAJ2ul/Ju20UDOy0yIhJX/i0cFf16A2c0RVKrTqq8HsKAOF4zpbauqVNKXehAMdw t3EeFCCCzK9nLEQ0IvcYw/OF3hIkLgXOqPH3ZwVVseAIjgoOGa3Fxcce4bry0+9gp9sml9lVUtrc 6AtyqF5Oppt39E5PYTSgSCn7bnFoaNcCx5ogIH5tWVxyE7JQwnwJlNSlec91AUCpzipq3GbJ4GeC K6MMNSLFgmMMqPNckYodBFZ5yPKCWbOku5tEGXKp8kGqSj8ClnwRLfqLrEQnTs+AXVnUej8iHsv7 NOq76xWg9OWtvpNNSYXc5A5VdL8aqSMnseMhGMaX/T2W2BRAg27G/Wn0+6IRDtUDN8c1KfBdoICW 6mlBG9OTpHsjA14IXsJIxZTsUZqquPjcrmQCMUVoSRlS0cXCXSVrVkBAQJlaOK2JqoEIj5Fys5It o3zPUuObIK/KvVJDk+p1TjJxQT8pECMR+MIZpCS0+GXlt2huVo5ni0oFNmUMVrnIAvySmitNSoTH RQiiYv5VvmRxxYmrjsxdSwWmwsP5iGVTKs856YsP03VgI+MX87lNaYZi5qdgQwEjge4E6XqpNSkx SnSLWZ/z41w04YdWBRbHyWS6WR7TqEJycfJNAbgAgVB86gJkwtc0TVkslKLgEBBFSKC8ElJqLQvd 8BxbhNUxKXBEIglw0XXqYgCyFCDzyYE8xxWUCnPUbPlciObakrJKJU+CfsRNYMxU8UfWCE3YEj9E Xm2zZimLRlhZhll7IJSKsL1ZgWmUChqdLWqOQfJ9F4UEH/P4nVLtjc+F+h3VMs6BkxNFzEbaKN7M sYOcg5xnJR8XjV+pngq4dZRpr/aiKVEa7yUtZD/vTyy5IlBEZG1ZGQgtFmUKVxI3pUrWKqGgY5NM L6MDXUBAWp6/GlHj69q6ECVZnjWrySlXtMSQ0a0r2VTEq0MZIN1ufpcpS1WgL7MZjVQ+e84+0t/l ZfkS2+cffeh60X6JKZqHmhQwKXAIKSDAlsjgt9gujNEogUExK/mHflf5oWl7/2HFOicRRUKXq78s n9v3Le6LQxkpUB0lVb+YPHKOKDnGlqgAQNvk/rTNo/y9X7Bp+oLaFIfUXeKxnzuPIAfL9feVusUA OTWGILwcR027fUYkvkTPKV1dxB4D9Jg9oFi/WCWZBaV4vqHUyD4tu0DbeG+suKc/SP4WQUubsPim KeHwHuQcbdM4PgPujB3t/nwpwN11/vtTmWICCdpHNgKiOuYez6yB9ggEdcpnz3PqTcQcTEnseF7G dXUrbfs1NCuThVkSsXVJDlWNkk7oa/b7bn8K5geTAiYFvmUKGPxIlAeDAZo86lt+KOblvxYFjPV7 qABdJrcPlfprzdk82aSASQGTAgeFArGMzzBXHkpmeFAmbQ5iUmA/FBBA79oa/FAQywT1Q0FVc0yT AiYFvjYFOtXK+CaqdnztGZsDmBT4fAp8E0KpCermKjQpYFLgsKTAN+F/PCxv3JzU95IC35TryAT1 7+XyMW/KpIBJAZMCJgUOJwp8E1q63K8J6ofTUzfnYlLApIBJAZMCJgW+BgVMUP8axDNPNSlgUsCk gEkBkwKHEwVMUD+cnoY5F5MCJgVMCpgUMCnwNShggvrXIJ55qkkBkwImBUwKmBQ4nChggvrh9DTM uZgUMClgUsCkgEmBr0EBE9S/BvHMU00KmBQwKWBSwKTA4UQBE9QPp6dhzsWkgEkBkwImBUwKfA0K mKD+NYhnnmpSwKSASQGTAiYFDicKmKB+OD0Ncy4mBUwKmBQwKWBS4GtQwAT1r0E881STAiYFTAqY FDApcDhRwAT1w+lpmHMxKWBSwKSASQGTAl+DAu2gbrR3l5b2h9Nm4cQ+r0GTzNuYc+zn2Hsw9u/r +y8avxMt9ncB/SALOg7oSseuczhc6X04PXtzLiYFTAp8ByjwBXzxK93BoRiznU9rHw43rPtKdNrH SXZEw7w5C4ICSEQ4B3/kZoWmBvAcrIt91XEEeD9vi/16f4ca+/f1/ReN/xlgP4DZ7PM6XRaV/Hm4 0PirPhvzPJMCJgVMChwSRnaImeMhHv5bWxT2SDiIqNWOiNWG6uYWlNfVEdupc/LHxmlZifA2S1T9 bt9iqfFl9qtjI3z+YYSjVv4LhEJRxMW74fX6gXAIlnAYdocLEYcD0QiPCEXgsLsQCoYoWvF7mwVW hx0hqu9hfue0WpVQEgj4OGc73C4bT+Exsj8ShN1mQzAYhI3nWKwONY7dzu+53+cNwEKhRoQZu1yP cwtzjtFoRCbGv6K8tpPX1MfgtaOkBf/nNaK8NufB+UaFVvwuSFrKORbS0s25aMdF1BzUfHmO3cZ5 8XMwYuU5Yfj8PsTzGorO/E+eh9VOAwrHDoYjsFrCPM6qiZVflu5dpYYv86z2Jcp+2evv7/iDOa+u b+bXucdDNda+zDbGy3Q4zrfrsz9Yz/1Q0fdgzvdgjnWonvuhfn+EcZGTdTAd8h/yrgj5UYS8y+Ui PybvDUQC6m+7zQ5/KIg4t0fxuyB5ooP8NMzfZNawCd/mkBannXw6wDZidnBEhIUv87fD5uR45KPk u06nU+O9HM9hdxCXLIrHCl5YeZwt6idP5Fw4Hwuva+FYgUBQmXMtwlt5fSvPET5sE77L7yzEgrCM 5+S8iTFybTv3yX9qSe7LbHqw1vyhflYGH4m5BzvhWpm3nRYrNm/fgedefwMOj0cBnejsVn4ZIOX9 PPJgbCFCucUha8RKAkeRkpKGmqpqJMV5kJWUqEC2qbERbSGCpAC6EiwEdO1IjEvgg7WiprmR58vD 4xj+IBeZUwG3tpC0xWjh/Wit7gimBEplhRCwlD28JwXG/O3kObLQonbSQQG/FX6fD6lpafDxt/zY eV5EFos8f17HLsIBhRFZjBbeh6zMcIQLUQkdXOQypj8EFxeo3+/nvGyaqYcLUUQQeRHU3PkfVyEX MOdBosjLEeD4Tr4cbT4/nB43/w4oocrcTAqYFDAp8M1QQBCYvKldwBFealVAKopJeloGqiorkZqR TKWklYqUh/uBNq9P8Tn1Y7ERSMMEaQIzQdoi4Ey+F1HoLuMB8Z54WMhX/W1eWojlOOGx/KEyZ7VE yGOpgDkI+KJoCWgIGIOgTg0oEOAx5Jd2ArVfB24Lr6mUKvLUKOdpo3IV5ljyW/i38HHhxyKURPlf iLgg8/q+bXaLaOmksEBhgAQI88adcXHqb3k8hByECFoBp64qql8xIEPAbd++aD+PtYmGKxqpPFtK TSmeFNS2VeCYI6cgJ87NB2BBTVMtXlq0CHFpSXDxQbW1tiI5JRUnzDgGazduQOW6NfDEJ6qHrgCT 849L8CjJrLmlFUmJCQT5AH/CfJhheBKT1OJqamriMdTm3VwIfLhhPugA55CYnqKANUDNHWELkuJT Mee4k7F06VJs3rwZjohDLUK32w2fPai0eZfHSRB28BohjhUgELspINg5ZhC+KCXQ5HguNu5PSSbA e+WOkZyQgOamRgoFYgmhIOWMU1JtOCCLXhaom4KGEz7R0CnANPMenPHxCPA+lTj5RfRVj6zLIv2y 5+zveBn7cByrq8DzZdZjV3odqrEO1TM5VPP9PLocjvQ9mPM9mGMdqud+MN/Ffa4hHZoJvgawC2CK ZVQUIUtqOuoqq3DmlOlASxMqq2uQmZmNt955FwnkvcJjm1q9yuIaJOA6ha+R4Yk2LwqPMD9vWxt5 /iTRhvDuvHlAnI2Ko428kUqcoA+VO7fNoyylATJcX5BIRH7t8SRS2SMwuwWzNEHBofgm7b/8nBif QCEhiKAvoEDf7eL15DsRHmgVTc/MVRaEFl8bwnEUJGJpebDW9qF67gfyvosCLNbnKE3Hai1TorGQ QCGCY9iw+MpD5GAeJbgZYP4VbRNiEhCTtYykD2WNUkON2uDivm3bdsDfWIdpR07FgOy9GDpsGCwE xtqGRmrFDmS7ExBpaMX0oWOQSq3eQYlrxarVKO7eHbm5udixfZuSJvOys/kwXfh00yb1OTs3G2Gf FyWlZagjqI4ZPAR+gv3CxYtRVFCIwsxMBLhoV23cjN179sIescFjcXJOFD9CVrgoLY4ePRo5qUnw NzWjZPde/j0GjY0NSoJduGgFxo4cStB3Is7jwuaS3YjnmMtXrEBxYR4XqmZ2L0hN5YIMYNmKxZgw ZjwXtwNxKUn46MOP0L17DyRRQ7fwpViwZDEq6uuQICYisSxFjHjGL0t3tWJjBNGvY+s9XMf6Lth0 D5Ud9rt279+F+cbyucN1zR/Mee3jmShQEiXCuI7+N/eLCd4dIlgGHEiyuJCYmoGol0yKP30Ku2Ho kMFUkMKorGsk0Gdi69atSM9IJ5imY+GypThiyhTMe/cdBJtbyWNFuSMoU5Gy+aMY2LMXhvTsTjyy 4tN1azGS/L+NCpM7Lh5LVqxWPL9XUS4Vujjs3LELicnJ2LOnFL6AHz179cGu3XvQrbAQaQmJ+OST ZehW1A1ZWWnwkK+uX7+JvDeE/r2LlVK2iTx62Y6NZMG0zn7P7O92ZaIWcwV1STE9y/NUmrv8lmdK cHfwD5dujYlBiK/0MUwQFBOOlb/Fr+EkWLvEjB2IYNKw4cr0snr5agzr0RsFCUmorKpCcVomtmzc htYsgmizD+MmDUTp3j1wcLLFaVnolZGLvbtKsWP1Blx4/jk0DVUgzMXQJ6cQGelp2LllB1pbmzFk 8GBl9t64aTO2bttOIO2GyUNHYk/JLiTEe5CfnoXqsirOhSYb0Za52CK+INy0CkRo5neTGHnpqXBS yosL+/HOgo8wfdo0TBs1DC6KmO+98TpOmDUDGRRcsriw1njDyHTFwUHNvL6mGgnpmUihVSBtzES0 tjRj4ZKVOP64EzCqZ38UduuOXSU7kcxr9MjIQUNlDayUMsM0HmjRDeZmUsCkgEmBb4oCupauLicY IcBOZY980RVkzFDYRsumHwFrGAVZOaita8CkkaPpKgRqm2uRm5qG2po69O/ZW8VBedzxGNirL02+ IQSa22CnMmknwEQk/okWVQ8vF0+Xa8QXQre8bPizCpDtisfrHy5Gn769Mbr3ACS4HVjw/rsY0L8f 8uJTkEDe2sp4q7oWPzKc8ajwhZFIbTSPoD+mTw+kp2fgtddex9gxIzGwIBvJFAJaWlqUn713ViY2 UgkMBak4fc8s8Cr6XczWSpcQk7j8IyBvfFYmeAaiEQwPxmbjwPFiYKG4FCTwWgmaNppWXDSz7Ny1 F5lJ8UilRtvCeVXSn72Wkl5yUgqaCaIRt53mb5pi6G/ZuHcvPDSpV9fUIKMgB600eQedVjTRxLOr thYtrS3K1+JJiUcbbQMNNGWH6aNu87Yi4rQhNZ/aO4PqmhnssbWM2rnDjYa6Jlholo+nyVuC19Lo q09lfEEGzffDevfGjh3bkdAtE9F4CxpCrWiz+RCKs6CxrRkZjgQ4k2jO4fz8lgACDMbLLsyBMzmR sQAeJNGVsKeqElZq89WcWzolXDe1dC9Ru9Hfhhz65HeVlwMNtSpYMcqgklbuc/A3LUfmZlLApIBJ gW+QArFMh7qsBDaTV4myF7DRbUkwdxI3SnfuxBhaMQWom2obkEhteueO3TTDJ9HqWYohJ59I83w1 GiqqMJGa99y35yFI07xkWUkwsWjdKZ44+jbj0HdYf9TV1qBWXKPkzY20anoZKBwmD/SS54vFWHhm lK7PgMNCTAiR5yYghd9HydOHjRtFZW8vasnj26wMQLYGEJcVD0dKHKoa6uFIjUNZUxXqaQVtpStB cITgpwHf92izG2Z6FYUokd0klJ2gruIZFMAzOIKiTJAg9XWt7zJikCBqkyA8mli4ROBzRtDMny0N 1Qh727BwUxkXySgsp++8F63O3Xr3wPbSUlS11mNHTbn6eWfFMvTu2Q2NBMc9O7cipa4a9a0NqAm2 4a0lCzGoXz/Yg8lYSxNOXE0lqr3NXIhhrCnZit27d2Ps0BGIy83E4uXLUPkxNXiabmp8raipLkOz jb54Ch2byrcjOTcFI1NHo6KmFqt3bWJgSBq28foVNRWIp8mnwUHhoqYUO7dtQ3dq1/1GjYQlJQG7 Nm1AKQMCM4uyadYPYdXW9QwEjEdKUjK21lVhy45t6FkcQY/hg7no0rBp9XKUtTSid/8+XJAtqN5b Ai8D7sJ0h0T5Oyqh8XpIQ/vaOxBLui5kf6lz9metP1zH+i5YdE3ru7YEvwvPSldu2t+ZH6L3qj36 3bh5atP8KPFDspSDNsYAUbXeULmbvvE6NK9fyaCzCPbsLcfokSOQM7Q/tmzZgp38blXpTsYRNaG6 ugqRzER8WrYTkRSPMtFv5PnFuXkYOXUCSuvrsXr3ThTk5FDjbsKO2nK0WiOoC/tQ0lSPtkA1Irx+ 7z7FSMrOQmlZOUroKh3Utz8CPjs2lO5CS5sPxXl5KCVWbCvfg7iGGuQP6Q87rav19dVYvnA+xg4b w9imOGzfuA5+CiYq08gAtgPhqV92PRxMvnkg7w/vwW6hZqn9JxljjE0PUiNu00zwEqmtBctRszaC Jr6mRBMmyAUckpIgAA+UEBQjCU58uHYlgyYCylS9/Z03KVRYlKQngRQWMfnQrz137muIT4zHqpUr sXzlCgoHNJ1wjEWLPqG/hCkVDPDbvHET1q9bx6A1p/LXlNL/TXhU0fLbt2xVgR67d5XQQMHIevpT yvaWYsOGDbDRtOMVzZjntQWa8fSbc9UijqN2L9xIBavxJ15cFDxXkjGiTLmY9+5HCrCLM4vQ1tiG 3f5KlO8sRenqT7WgEKGgRLtL9KhEXNJ6kMWF622lr4jmpo30+++lfyfo34k1K9eqwL0oz7PSSiAk lytJJKeZ0f41F555ukkBkwIHSAEyVRX9bqAItXTNgKuCzJrIm53kUx8v/4SKLrnr7h260mHDprfm qqBfq/xQ237x/XcIMlTiyNdX79nJgGIGz4l1mMxt/sqlKpWX0dqIBpkqR967guOGGVjsZAD0GvJb F7X4pYt5HGO9BvTvTz4ZQmNdPbbShbqLfHPLpi2KNzsZgS8ZUOtoYfUHfYypciqffLDOh73BasZr 7WEsVClKdr6iUuXkfqySPsfxvmcudWYIyHNTOdQR5GRm4MQjp8FGggggauERkoZFgD9IFgqRi6xE 4ohEJHLkAJHdQTM6BTcCOaFSpTsQ/OTaXAgC2ir3UAXscZ+kifHhKU+ziI8qX9GmBBC5B0kLCxHg xQWkxBIVkScOBFpaKJVFuWiCfKI2RlqK20Fs2xI1KfvFnOSgdtxGU72D4O3gWD7JmeRCFgeFhYtB FqssIsmjD0pupYzLc+Lp23EwulLcC8ePn4g2CgiSC69Wu0qt0OgpdBUpNSExkX77EHPl2zB78pFM f/NQ4vSqY+1c+F5xF/BUEa5kFD1URY2nIF5eBJl3JylTS5WTaxibxExoQgX9VbKf/wvdZDbaM9by 7sWsZlxj/4/680TFA+QX5mEmBUwKfAcoIMCusS/5IMZ44SXiU7eTDwpPjjIlzE+eJVk/wqfERO9j YLMoRn4qhxL9LueLBVhywsmVydM0QA9RQnCQP1r0iPqo5JRzTEl/k/EUP6dSFSEPdpBXS1qbpCQ7 GXMVrW9Bv/QcDM4rVhghGURarRGmv0kKMIFd5id/S3pbqMmLgblFGFzQi/tpiSaPFD+/ZHZ1soB+ XzR1IpUGePwZXFSEIfw5PDcBck3zPdDNeEb7i4OIHVEWrRE1EKsXS4Ec+bujSL72rezXIhGkGp9G v4MTddBxd0b5h32HyX2WHmIJ0MsptA8iwtG+C/zTV6XK3WibvDTiYTE3kwImBUwKfBEFmun63LBh O1LyUmjC9hPcWQfEmsr8cVo7XZL228QUOGY22RlkTEHAw582Jx2uBOVEi0eyzRnbxCh6xk2FbCza ZWXmj6RcWcmxmPJjlch45lKHqdko5Y6RdVILRFKORUCwZWa1Ky+i2IjAIbFHorAYSo1Kv1Nqi6bs yFhSmEYrX/L9tX6S3+s3KfAUo+F90UP9qt+LKVzZcUSUEK283civjWgIhzSYqwdoE6nK2sIH7Geh mXRqsV4uEuZ925KUNm+l+YeOZ2r0mt9HJMFgsFVp4ky+UJovYyo0S0NUK44ApmIEqDkHeX0bAzGs 4Vb63J0818XFR4BjWKakWYgGKwEZQhampyt0DNM0H+AClPEt4WZR/+mbiWfyG/POw22UWDkOi9PQ JqAcF1qYobGAZEwdRnXEtnBispZDkg3AHPeoFFWQinp0RYQpEYdocvCI74fhfqy9x2tyZEsbrQSt nFcSLR20KMSRElKdideW+5I5STU6p8xRJF7R6hnLEJWXgzOzsrBNiBMO08RlCXIfJxBhjEMzj41n pTsL71lqE8i0DZzXrAUyaSOAxhAFv+pKMM8zKWBS4LtEATG9CzhKllQz04xTGQTcp1cP8qg6KgQM +m0Vs7vU8BALZiv5BeuB0N+tuA7dvBEGEIsVljlPZFdiLZXvpHInc9ptBH9m+ljpmmWosY4N5KXU NsRSaiVPlrEt5HHm9vkU6KTEHSQL+5eiuW5M1kzTGo5o4E5wlnKrKgpfJDA7C9NIsAbNNVIeULBL ChrIAVJxjtgGJ33UYQF5kcZoCnLRjKOwXJmpZXQNUJXRWvnGieDcJZ9dPMdLQBOAtQtgWigQEFQJ k9oYVi4mSoo2DwvZcLZepl4IaEpVPAFL4z608bVIBMImlyzHiLZQgHCpOAEa7wmyUn5H2zSjvNwv BQCxmiiXAkvlslJSQCRTZTEXY5RmB1DigdyrK4mfXCzCIHvpI5JXh+c76B6QzaoIpJnWbVLRAQxO 4b9epn/EM1VE3P1+ZhQ4KBHLFJyMHjVeF8lMaH8Q7fPUP5i/TAqYFPhBUkDja7qgr7v1QlQ+7LZ4 7pVIdoMsUrab+8k/XW6N07VKGnMbTfLUzunnJP/Sjm2mud0mpcE1TyiBnW5LJ/k4XZRk3+RdVOwI /kHxtUuFOQY8d6gaP8jH8IU3/S20Xo01UuvLhGAnAN4BdLJ6tBrq2ubB0lUfI9SWjpEjilnmTwBN 8/erswhKao1I+VkuJrczQX3/AoPdRg8ZjaL8XB4jY1FIEF+31GbnX27xj6ugjCh2lGxHfEYxMphi YUWiOl8JFOLTlhKFatp2fDL/baZI5GDEiKH8O0GZttUsdWlEzDtck/peBvgpi0SiBphqv1ZxmPjb vmkz03ViLvoWpuQtWLIUY6dOQkYcJVh+L2V11Xmch4/lGF997QVUVNCHb3PD7bHhnLNPQ1VVBV5+ 5VVkMm909uwTGavA2Ai+DM888yyqmC435/QzkZ+Xi5UfrEJh/+5IzEqmwKS9pi++9BK2M/DkiJHj MHbyWBVnYG4mBUwKmBTYHwWc5FViSX3muYdRVtrIFOM0Ve1tytTxGDJkAFOAd+C1V98lj7Hj5IvO QD7jiETL/3THVrzzyutMRUvESZeeAY/Dg1VL1iInNx/Z+amqJrzUaV+w4EOsXbsW3VizZMaMo1Sw sWZZNv2En7cqvwVQF5AT9VhFwGloqAAX+ICV1STQYuoRRxBwQ4xqX8ICB8D4SSMw98230VydgQkT r8GHS95HS70fx86Yjj3V5cwvb0FNWRm69+rH6nK52LRpDTZu3YWb//pX/O3Wf6vmAFuYZtabqWvF PXuwytFmbK9qQBbTMoYOHY4NKxbhZ7/9I37y+5swZ9oUvP32fKQlujF6wlguIRY8WLwEUdYnnjpt Kp575jkUDRzJ8wbiww/mwcaozKETpqpANIW4ROt331+g6rUfOXUK6qr2YtvucgRYTjElPR0ZDNhw 0uRQzcIMScy7L2fRhtqaKvTsUciKd3XIp68oJ9mNf//7DpxcW8kKS30xevw4CgrM5dQFAzfL6ebl F2DRR+8yaM+DOaceiXpGhD712OPo038AKyuV4n+PPo6LLjgPzxLQ61j4Jo8FHe6/77/49TW/wtwX XscZPzodqdmpUuAPzz72GEqYQjKcxX9eeO4ZxLFWwOChg1QJRnMzKWBSwKTAviggvnIpH1tU0INK w1q889aHuOiS01nkJZWAvhW33/5vTBg/nYW3mvHPm/6Gv9/8J5Tu2YM7b/snjjpiGsr3VOKfN/8N f/7DH/D6a2/h6GnHIrconRq7Ha+//goWL1mFIyYfgQ8/WY49ZaW44tILNR+5yZc+d0F+46Debl7X gxW06GwL/vfIg1i0ZAV95gmoKKvEyH4FeHHui9i7pQqrFvdikYF4JPoTMP/VN/HiwteRaEtG+fat 8NL/O3fue5jAqkP/Knsav7vsLNx+17/Qa9hIJNFM30r/8auvv4M9G1fhzh2l+Offb8Fvf30t4nuP wrkzx6kI+HoWhdmztwKtTQ24/46/Y+UuH8LVm9FUtgkVzkK89sbbyAhVU1AoRzKLxkhxmjvvuR8r P56HzOwClDUGcRIryYn//s477sSmbTt5T0HUsZhN5doP8MySEvz43OPx8AP3Y+zsCxi5acU/7v4v Jgzujdc+Ws6SsUOwYtFHGHvUbAoYK3DHjVcrAWEb7++lp5/FeRdcSVN/K1Yv+5Qquw1HHDEEs447 DRV7Aoz2dOGoo47C6y+9QMGgB06aM0c98D/9+WasXLWG2nsVrr36FxJBgsYHH8MH1NLTWLtZxlF2 EhXyLi4LoN/AgUhJSEYaq/AFqcFrlgqtEJH40szNpIBJAZMC7RRQzNyC8eOPojW0Oy2MNhw/+1j1 9X33/g1DBg7CWWefrv6+6fd/xnsfzcdW5q9PGTUWZ5yp7f/9L3+NRZ98gDhq8dIgSzaJWi9hdU0X K2oOGzoUYydOxrqNG1Wgm125Es3t8yjwjYO6TKbdL6O0dIZK+Fvw2itzcdWvfotJEyeobj/rl3+M eFYLSk31YcvmjcgeNVRVZnt77pssStCG7LwcvPnqa+g3cSyGjhmN6y69GMf+/Do8cu9dqv7w9X/4 E85lLruX0ZXSFjUnJRHzKyqxt7xCdXU7+5yzcMzofoo2/blwunUrRjfWHb793ttwzwsfYffSN3D7 X65BfdJI3HDLzeiX6sdJ5/wR/fNc6Dt8LDV0h9KwR46brJoYuAiawbZGmptexT//fScGDerL+/Di oWVvYvKUaTjjnIuwhhq/nwF4dpr7nWw3G2Dax+Dhw3DF5efhN2xS8/Nrr8Wvf/RTlGxax3z8JFzz q2vx3suv4bXX38VtN/0K/XoNgK81hKIicQ/4lRmeRZfU1tzYrMDY2JKTkqihs42u7JDWrdyymbLY 0tqoghTsdGLJXmkmc9o5Z2L+xwtwz913q+pOZ55/vnouWvQBN9PaZXIRkwImBfZLAS/Lr7ayYxtr nDDGzUpfaBUbvowbN7X9jKKcXGylOb6O/TLGjBmh9ot3vFdxMQG8RDVlUe21uUVCPlx04UX4v7vu xy9/ex1T3ez4/e9/086TzAfx+RT4xkHdCLbQnNRGeByBjsBbyxKBXpaO3b51G5657z9Ip4l7zswT 8ercR+GX/O4A4ym5YmxuP0axeluvbvnYWlUGX5uFueVehNtYHCY3EbX1DahihTgvhYXlK9bg06XL 8fS9N2H+8i3sGiSFbFgAQeIufSxiwLQMt5XR8irEndXd45JYd72R1eXqkZiWzkh4F1poIi9llaOk xBRq6dIJrpkNXUag+29/j5fnzsXSTbvRsyAX7mCTKoBTzftobM7HXlY8kiA+ixRwZ4BcBVvM5hFQ W1ka18ucdgeDPiTQro2mfSfn1NzqY1RoRPUfbmSN4mpWn/PxPlwsrPDugvexYc06gngUx80ah9z8 YpX2oXrOcyumULJy5XL1ecfWnahlacbZJ5yA9WtXo4KNbHLy87Bm7SocPf0ElK5fowWgyMH0i734 v/+h37iRuPmmm/DMY09g4cJPcMZZhSwSITEL8pxMM7zJSEwKmBToTIHYpmHCyYVTGAa91JQUVFGJ Mra9rCg3eMJg8lwf9lSWYSy/EP6zgxr5lL6TUVdahXi3FsskrszyijL85te/VqM+/ORz+Outd+Ch +25vbwRmPov9U+AbB3WZSkcUpVb0xcF66FfRRHzbHXfjqedfxVFTp2LmsbNw/9yXseuTEmRmpMDD tqVuWwJOnHUx/vzIrQpMj508ATnZOQgzSMNH0ExnjfgzLj4BD//vEfzp+j8yLUsz37RV1eCWm29l IRnWK+a10llb3k5tPdzaRHP57bjm5xciN42a/Hsf4/wrf4y//u7XrPnehutv+SfKm+Jxz32PcLE2 4dprf4oV778CDy0Ge+jDf+uFZ6mx06d9yhw88/xLKE624apf/AJ33nU3o8utmHPyKUhgw5k0KcLA yPojZ83Ci6++iE9TbMhiqUPp6pbmSVetYLPSk1VEf1Y2m76kJdOsn42/cs5xbApz+c9+h7Ej+sJ3 sg9OicJHAxd3iIEpDMMLSzBcFCPGjcEGxg384qc/Vy0Hzz3/AsYPdMN0muZvvflmuvptGD5qFMaM H4x3XnweN930J6RnZWBwv74YQRrde8+9rMIUhyz6w8664ALtGUlkv1SMYliqk2Oam0kBkwImBfZF gTD5eGurlCLVGPy06Ufjrv/7D4p7DGGJ2DpsZ3ntn4y/Evnk13fd/yCKevTEjs070MA8trHjJmHx vP9iGZWScFIDUlnfXSyeEdDPPmMWO3AWojd7b2gxvVrGk7l9AagbgQffVFShoaMrWU2eEcFj3KQj cV//IWhi2kN3tiu1MBd94NTp8NB3HhfvQBvrrNvCbprgHbit77/YotXLAI18tLIZiqSvOSxB/PfB vyMpwYpBw0ezLaqXtdbZPNWThpNnHolmBp0l5eRRCw5j7OhBCMQnwRHy4jaanD1uK+56cATrv0eR SxP16P4jqJE7kMyOat0Y396t6PdcYGHks7PPpFFcXPTDe9jadeywgaqSUkZ2HmaMH4k4ar9O5nX0 HzxQ9XMvyM+Hv3kKj49n3eIgzrvwEkybeYIqT6t8SOEW+Kxx8DAH85Z//hNWNkO45dY/shStDw9M PYVtYmuQwpy1lJRMXp1lFBnNLlXuJOpeotqPPWmmZL/R+sD0OgL8RVdeiV07dyGeAlAm5xqiEDNi 7Ch0616EVlauK2KLWqnRfPUffoMa1stnkgg7H3koSOTiRn5XzxrN2WkZbMrAGgB8cRz0X6me9ZKb +pk1pAc6Sg68FJKIOUL2qPI86iU06uGZr6FJAZMC32UKqNTgWEBtLzNqY2vVbBw1k/3RVQx0BAMG jcWlV1jxwgtzVf2M3/zm10hKTsfw4em4+OIo5r7yCi2kLvzy2l8hMSEVIycOwceLP8b2Z1fRCjsc V1x5NbN2nsFTTz9D5SMPP/vRheSvRA4T0L9wCSn1S6vGIwFRWmWeQ7kZo2uyljLYaMDO66czOpz/ a3nlVjdy87q1T6U9h5rHZSfSd0xLjRwXT+1StigLxyS5tMjIhDi25eOPthGcWMA/IaFY/4v3yI5A HrmGPQ5xzD9T4yRa+KONmceevbIJTUT0zGXTFTUS/3bRvK5dL8Ia7vn65yhS6Fc3zskmoGrHEIhl rvpYsh7zc7Lb7wlIU6l4cpwzOU5dz+p2a/fCeSV5CtvPFbpJeUO5Lm3mjKNzwhmn567rXfVEiu3e Q79Pyd+X6kpCV1oFSFa9XCwoUMShKLGDtuoYgrn8aHOV3H9+4EU1IcJ4mY1oCPktME5RI8qaAfwk wo32reTGyx7xj8l5hmEu5rbNjyYFTAp8pygQiw0GsEd1+7tEqwsvPOa4fJ1nKmaDESPHqB9jEz4j +DJx9Fj1E7t/1uwZkJ/Y7XxaG2M34UumK/CLl027TTUWzA81sO9vWl1TFfaVumDUMjfGiD2mfbF9 RprrbK4x6qVrlhztu32NY9Ch/Tu94IJ27c6pFbHWjgMaqwsRjJdmX/PZ3/PouE5H6cPYO/3M/GXW ne5Bv5Mu+5Rc10m2M/6ILVirHSTVotpz7I09Kp9UK0kn35uRdl/8IppHmBT4LlDA4CliwTM+x2bG fF6WzP6+O9DMGlFSTF7yxavErrRDMa8eYg39i6diHnH4UKCrz8oA9Q6k18Bay17QoLujGK4Cc7pE DKna9IAdPk/WnIlJga9DAdUcinhhZ5W3cha0EnDXLJpfdztQwD4Y1/q6cz28z2/X1OVhyQMy6vse ztP+JtwEB+v+v0tz7bhn6dCkt7jREtn1r1RNO82txe+V+V19J12SOtxd2tHGy2e+hAdrLZnjmBT4 NikQq6WnMtjYyRgfwYvYbV/WQeP7fVkJO849ULevqSJ80Rqgm7YjmV8ekI8pB4dLxR7DgiDzMhaE 8j9zMUltYdnXdaF0tTho3Xk6L7wvIkrXRWpYM2SsWLPT/saROYoka8w7du5f5tpf5ljjvmNfqtjn aMwh9nvj2cs9GfOVfVEGE4qpy08au5g/KmV1/cxBlepRqi+87q/XgFtAXi9Qw+dhZU68Jhhqpnox AMnfseMbNHRI+1rVRldzC5ibSQGTAocnBQwN3ZhdC1NuKyoq1HttKC7Ge61KazOYWN5t+f15QN8Z 1GN5gMR30bXH872s9yG8QmMRHcF6Mq7wFtVCW+chsu9AePThSeWDM6tOPvWuwHBwLvHVRpGFImAq DzN2schoxoOMBU3jKl2D/oxjvsosYsdSwXuSt80F9EVCj7GwDCAzAkQOJXAZc+260PcnoMh9xM7L EES0gEkBahsBPU4BtkFDqfXsY/9keSaqX4zypmsCjEUPggkpAHdoLRhZoMfIo5dxjWsadJHnGjuP r/KMzHNMCpgU+OYoIHxC3v/W1lam4rrRp08fxUfkXY5VtmRGBq8URUGOET5i8HMDiDuDesxfBHAt ME5y36VBjCgeIiDEHqP9YShtsW7kL+LR3xzFvvkrHZbJx7HgZ/hspDSrSH7yAA0fzr4CLAyJUs6T QjCG5eHLAmosiMtjkbFkIR9IUIcBkLKADQHEALBD9YiFJh6Pp92Fsi83ihzjYiqe/Mh8RPuWfQKy 2guhBQy6XYlKS1d05nvlYj59fDwtD2yG42K2gTyHKNvLBgI8h1q9TdW9Zy47U/WsFBakw5ybaYKS Iueg5u6Q8XUhQsaXecpLbbh7NCuAqakfqrVhjmtS4GBTQN5X4SPC42QTgDf2Ge+zwYvlXRd+JDzU UNQ+y0c/+/6HmX5rI/8Q1uBwaN3ZtGC5zsAuYxs81+DbP2R+cliBuoCLbBEmX4cppXm4UAIEECcL xezZvUf1S0lNTVMSoaCNHKMSphSoSM9w8fFqwCRS3bbt25mmlcZ0tgTVHUhS0gyQVR1OqZFK0QRN GqSpRyRKnqsAUcBJARGrvrEhzLZt21gEJ1PNRWmqPEaKstiY8qVCxHj9MI+T1qlWAl5tTQ1Lsrag oKCQ83Wo8Q1hRBaqLFAloEgaIf9S9y7mJI4hY8lcZBP/tcxbIvaN+Wn3q0XfG7UYxB2xnfebnZWt aci6SVz6F2smck0waSLQfvzxR2rew4YNUy+jzKOyshKZmZksPRtAdVMzMtIzVItbqWG/bdt27C0t UXXgE9jopgeL2jS3hpGX2wesgYOG+loKAg7sZbnHvaw17/UF0IPNc3LzC/m9D34+w6baJmSxWY2f FQM3bdrIuvj1yrzWr29fNqfJpYnNZwL7wea85ngmBQ4RBWKzdAS0S3btwmbWde/L97lbUZHijcLb pJ6G2sioKioryIsTEcdS1J/dPusrlzrvTeRFXloHQ9TUxQrYrRt5Skx2k2EBkN/1LEErvDGNGPFD 3r4VUJfYK0v7g9FATUqhlrOsoAB1LusE21hEuLKqnG34IujVi81aWPmttdGP2/55C3bvLWVp2Dbk 52ahjQ9bgN/b3MiyrpkspiIaZAAle8pw9c9/il/95reYwk4/e/eUsEtaFrVECgosxFLXQjMyr5FG oBGAF2DbzSpx6empSGTOuZfjl+6tRmF+N7S2+HDNtdfgn//8BwGtjwKvVAK8NBwI+JrRyKpv9kiQ RRJyiMAWHt+Ix598DOs+3YiHH76PHdlqEPSHWeQlna0JQ5wry8BKYRlWToqjkGB3x6OS9x4loGfm 8YVgSdpmgl9TczMLM7CSHsFYgN1LvHcSWAMUWpsbG5HBynMNzV4kso58iMLHr3/zG1x66aWYNGmS Mp174uysAstMeJ4T5Nh1tQ2cz/9YlrZVacnr1q3DFVdcgRp2cbvrrjtx0UUX8qVLxj/vuA9//dOf WL1O6GLBv/5xGzJz05GaloKcnHQWy7HgZ1f/Brfcdi8mjhmFB+59gs0beuNddrejEQ5Z+ZlsxvMa rr7mN+jXMx9LFy/FSy+/gt9d90ts3bYR/7j1ThwxdQLL7TbgA5a//elPrkIa70XmZG4mBUwKfDco oBQYAvrSRZ/gqZeeRzZ54kcLFuD0c8/GgL79tBoXuqIm2vvdd9yFiy6+ED1692q/wagoZl20bylP 7dAtd3WsBvr4U8+wQuZZqteFJh/EZOHws6bkAS8+/RyvZ8PZvH7sptpIi96lqTcd15Yd38O4u28c 1MNSEIXao50gZKM2aaf51k1An//+e3ji2ZfRSA3wtNmnYEiOB3e+8h/4q92YNWU6K8pRC3fkY/PS ZfjrI4/DSSA/Y9YUlLBy3NvvzkeGvQWNCT1x48/OwS233A5rYipaG2rQSqHg3jvvQ1nJJtSHE3Dt L36OO/92A0rtOThjfCHmnHkO/G3NbBN4D7uttXGR+nDtzy/GGy+9ib17m/mdA3NOm6MCwLxoxt0P PIySDWtgZ5W3Cy84Fbf/+Q9w9ByBysXvsHXrzdixsxQfzXsWLayMl5FajA8XvoTnn/2QrQmDOPOc I7nGXXjo3ncwZGQmzjn3ZAzp1x1vzP8YTz7+FNxt9Zhw2o+Q0LAej782D2MmjUEZhZGh4yZiaL/e +Ps9T+HokT3w9BuL0T0vE9HGCnjy+qOlchuu/dO1CHFxP/vq87j/v//Djy+/jg1x6rBuVSlXchNG jR6Ikh21LMGYhd/+9kL4fWE89vj/lOa+keVl8wuyKXyUq8I0IZbBDbEKVDoXvI8uB2mG8/PfXM1q e0X0okewfdFaDCrshsUrFmBY/zFKgw8GK1mmNx/nn/tz5A9MwAuvP41XX52Pwb88E6U7ytAtpxfL RW6k9aIME8bNwq9+eRnfqDZccdWvsXV7LSaqCngmqH832Lk5yx88BQimEjsTqW3FB2yydf7Pfozh RT2x+IOPsHF3Cfp274W3nnoOe9gPoz+bVk0ZMwzxzR4khemWqy7DUy/MQ2quBWcdewFaKxqwsmQL Nny6GZNGsqfHyAEo27YLb7w/D+GqFmUNDCckISXixsL33sWmXTthT4vD0B4DsXXFp6hjm+5ePXsj tdGGxnSXwum32SBsDy0DJ55yKq2O7DqpIoCI+QLtKiBIhAmt8Nn3bfvGQV0IqMoDi7bOT3YuDj/N K9Ih7MzzLsO4I6ajio1Qoq1VyGfDlk1sifrOvLeRMr4nElzxeODue5BA7bpvfi/c/e9/o/fEaapE 4TWsPnTu9f/B3/92CxJSc3DNn2/Cj2YvVVp8Lsugeks24o2PFmHnibOpsdbhlJ9ehfNm9mb/dis+ eP19bN64Bf/35AvYvWM5QcqHjMxUtmQN4aP5S9Cn32CkZ2SwOcxSlj18E9f9/HL87d7/UlOnxs3m MVeccRqWhmpw3wOPoaGhBXfcfDU+WbwaHy/YQPO2Az17ss7x1uX4iJ3QBg8eQe07HX/6y59okvci 0FyBe+69BxedfzFmjOqH9Y1RLH/2bZqqs3HD727Ez35xCTsb1TE2oA3l7LpWU0UNnJaEn1z1Y7aZ vRy33Pgv/OtPv8LK1SvgYdzB5T++GBvX7cJ/H3kSf7jhdDZ6sbONag3SCMwrqjehT9+hLCsbVRGl l7KzncQJLFq0kNaJeLz37js47SwKC3w2gRBN/lTV3ZS062tr8btf/16Vth3RfyiOHjgB/Wk9GcCe 64sWraFFgJYES4jviYOCQSOy/A6a5rOwfPEqVFeWYvXKVbRiZPE5voWRY8bhvffexJ7ybVi/7WOc ftaF7E3fDwFK8uZmUsCkwHeFAgRFKjqt1KQbaOnLLaJZXMp9T52M4byFj96Yh9bqWnQb3gdPPPMs MuOB5PgUBMnrX3rmdaRl9URd82a8RetePpW6f/7n/zB71sl4mYrded2z8PyDDyOzXzF8EixNjf+D xSsQ2FSCidNGwsaW0nc//RBuvuUfLNGdiTeeeApb+u7B0YVDaKF0sOPkx6pve25hEZ588hkqT2ch JTVFAblRE/O7QuWvMs9vBdS1zASJyuKPpEBRQ2tlp7JUEr5bfjKSaTb+12/uhjcziDknzMb8d+cp SaCxtYF+6RBq2NZvQFExjj15DnbVNSOZLVrd7K6WwEAt8cGkZDmRmhCP5JRkbFy/Hss++Bj/uO4X WFkVJMj74Cb4xdEqHWWvdX/QirqGBtW1LC2BNd379MXa5R/gsUefws03/hu7dzUwAMyqiqsEfDLP Vprl97JRyjT04OIrZ5vU5Pg4+rFFBgzTbN+CFNY4TkpOUS1fn6Cg0C1/GE4/7TSs+vQt1ox30y/N Mq9ipmcDhDBt6kHOI5G+7eSCAvTKsGIZayKnMBZAxB4/NX4XtXsnU8uc0i6VqWJZFDDsPCY1NVH5 xhPYptXXFqC2HFL90FMTkwmSbdhesgMb15ZzHHaYS3JzTsnYVbKdc50CCzvbPc26ynl5FHjoakhn 45m6um3YXbKblhMbsrMZ3MYz6RJnS9d0XPKrnyG7qBsSWcJ284KVFIaCmDRhEp5+5COsWrmatJiA YJjPgt2ZHAygKSuvRFZWOjZs3KTq5ludUbpXamn9KMfEiePxs2vOw69v+JEyf6WksBMeLS7fR6n5 q7yU5jkmBQ53Cki9ihB5gIt8l1hOVyZjlmiBjdIyWhtqxXC2w15W1UgX5FrsZNdNH+NswkQbUaje euMNjJp6Aiprt6OKfS5OmDoV4ydNwEWXno5br/87lrCbJBtOsFfGhajYsgdPsk68k2Nb2fhqCLX+ D+a+hJ//4lpMHzUZ5Vt2UWHIxPW/vBafPP0m3X82zKNy4qupRRE7YX68eBmOOvoYWk1TVKvXH8L2 jYO6CmxTBU20IqLSetTucOKkk0/Cgw89gOdoNilmW9H0nCws3rkcVRtfp1mWrUm5gDweOybNPAb/ e28BqtjLfEA3+sgZ2FVVU88+5VEFuOecPgsvv/42/nLjX1CyuxxDx7MJDEH/tXnzsG7Dp/TZn6rS slx0A9RSkvzZr2/AJRedz4jtRbjhhj9h954t7AR3hALl1958E6vWrsDwccPQRo12+ODhGDWihL5g mvpb6f/OHKAivCPUeltaA4wFyEaP4h7sgHYrmuizt0QTkMXa73toeVgwfyUtDx7OkZ2MLMz/5gK9 /d//Rbi+Cqeffho7y/0P8155Gqm9x7CJC1PHaHYK0U8/iNd8d/77KNm8CQG6CQIEbh8D8CQAzs+G LXYWaW/zEvjZLa6lrhb//vddaKxtw6xZJ3Guw1GQybavlmbGCsRj0MBc/OMf/8Jf/3KLEn7S2f1O ggBPPe10jKeJf+Gi9/HCSy8zKK4Jd/37XjgZBzBuxBDVyvbx/z2OBAJ2Dt0OfTO6o5n37KGgMXXq WDx4358x+8TJBPpWPPDoXcgu9GDH3k0468yfYtuGj/HTn/0Mhb0L8fQzd1NLX4AehUdRiEjCH66/ Dr/85V/Qu3AQBYRhDKLTfGbmZlLApMDhTQFh4RJE7KLgns9+E/PfewcnsQHXI/95AJ5uuYgyMNZW 3cQmLzOwaPVq8l0qZeRfZFRsLFWMwYOGYnhcN1pknQhaJaOJ1kM21GpibFRGchrWUjkSK+jaVatQ VV2JHGs/FSj8zAMPos4WwSUz59Cluhu3/PFGnHzNj5FCRS1ExSAcb0UC46LyqOgcOWMGAT+bjb0S taBqw9T+PTS5x66Wz4D6Ia+A1h6YoJUXlSCGMMHpoosvQfde/dlH3ItJ4ych1R5G0bL5SLZnM6I7 Hc1xTIlANoZ0T4GVwWQNjNY+etJoDKP23EZNN5U+lr/d9GeM6J2HgUOGo4R+mtOPOQI53XphBgPl asp24X9zzkMm/St9rr8eid16MxCsCT/+yU8xZNBABsD1xaKVa3H88dMwit3X+tJfs3tnFY47YQ6D 6TIwasIAdh7qhxtvGIwlH76HcQyYG9i/J7K5qFJpWr740svQHHJRw83DsoXzKEikEuSLkZgawCcf f4pTTylkO1UXIz/jMXGsEy3syT7zmGPgYrBet36jkcfzgs01GDT5WNib92BqkEJKSyvN02ejuHd/ lTp22kU9kWX3oT7goLaehT//9a9KAr3mmquRmp2CYYMmUUPexedrxxETjmakfjMykxPpO2qj8MR4 AUsCrrrq54x+/5DafQLGjRtHa0Ez+8QnoJ4R7L0ZsX72WeeioSWEqtJyuBmd7kmKx095zoad29m+ lX+zkUx+z+649MofoZ595rNp/nr4f//lGFEUF43BeprIorYWHH3cVAYZ9qPFJMxud6loqm+j4DAV 3bv3R1ryALQ0BWnRyMD1v7uOPjP68SXq39xMCpgUOGwpYESdq0A18UtLgJvHhrMuvgC3PXQvFr7x NnrmF+H0aTOwe+t2PEkT+sYXauiKy6ECkYXu/buhW99eOOOcs/DY03NpMfXj/DMuhZNj5eXnMPUV 6FZcxCA7tpmm9n7973+PZDb26jV8KPLYJrq5tgWfLFmK8tZG3PjXP2JAThHqvc149bnnsG3NWhST D7szkmiin4iH77qLpvcn0bNXX1ou49RUZWvH8+8xsNv3BeIHkov9VVee0tQVcfVKQ3pUYogP9hiC XJTU97X52BbVj9mzZ8PiZ9cyinmtdlaQCzNX3FfPaHZGd1NqC7bUozDNzQE5VqAFY0YUM/aqAcOH jcAwh5utTb2Mjo8gjz5458gh8DMyOxjww1OYhSbaguz0t48bN55RlW00Q+fjdC6AcJgpWJQSBw8d jhHDPRQ4LDQrh1BUnA0vTdrpNHmffsbp8EZojud5I9jmtSFoR2JxTwaXMQqdYDx79knKAhEOMT8z 2ohTTunH6HXON9zK3wzYKGB0vb8e/foNYKAgTfq0QhwzczopEkK938KYgCK2a3VRWPHSTRCHmTQf cWLwWRwMEGxGoS1O+aCHDB+BZirigwcPod9cLAXxGDqkH4PdLbQshJkFQLM395OAUiJG5ZlnZKbh rLPPUmkhAujiS5e0PgFVjycRgwYMokuEtONzYCt1uhyYasaXbfDokVopWN5XqI2VohwZaAn4KGEH 0Yu9jkMMiMnJSsGgoYMJ6ozU97dwjj4UdmO7V7rL5RlmZuYiJ5fR/YF4uj1EK7egL8+Nsid8gM/v UK67r7pezfNMCpgU0NKEjbxzeU/lx8hRz8zNxk3X34gQo9PdzC6SmKnBBOK/3v5P8iWa6OlalK3H 5X0kPxfjMidjhOrSxtoWtPbJCb1GDmb6WxSXX3UFAuQzs044DkdR03baGIznIA/m0a6hw3DC2Sch Ql7VSJ4lefIXXXE5/JIOy/k4afENEVxEU/3Dn/9Mvu5X85HtB6upG2VXD06B/s9/FVQ+uS43qcwC Puym5oZ2WYptAhi9HiIosRsQjwwRKCz8bJMa9S1NoKWGZnwutLAWYCUdvWW/jYEVAYJ5xOJXvdOj UjaQKW5eyZlkAJyYrVsI9BEKAnT/wE+zumwhgn04JAAozUnsNKcz5zzKv/VZWgi2AkJBXq+BYBmh FitpeS2tWp30NinIotdCb2jUyqdqbWWjBLdGDiOfda9OtEntl5xwCRYkBqv0NWlXGiFwt0m+vYU+ ZrFkMGCthaZyCfKIsExrmHnjEYvMWbu27GsLadQEgdQvNdvVn9KrnqNL6KiauvQiJm0IxPJjbB0l dKUEruTkyxz9jPQ3Ng4mqfP0GigjiyHhiiNNobyfKXJCA9KG5ncVY8qgOaP2u5+WFG0uHJV0JzH0 6rI8n4KOj2Z8KDprpWbNzaSASYHDjwJGkSoBdkkZNqpRGjMVILXrAGoUHrc5beQGsZ0ddT7EX0Ya mjqfJ8hRVsYgySafhQs5WfRK/xqqxI3e8NHCOiEJ/NHK3hDs9esac5FzpdalAehqzE5pc99jNV2e Q2xdcqN626GsxqO34FUxcvKUDD6u5Q8KOEiHL4IswYrqKo9TsfLEQxEBWFFOCrNQ61M+HSUNSGMR WQRcPpQKBcQFHawEdPWNjhQh7rcQ4LTrUQvlsWGqoKo/uWoVyvryFBoY8s1jjGXJ4wlQqrc4+4Zb OB8L/T9yDatewjDCMWwKhDmWuqJEWLYjH8+TpSfLTMZWE1Y+dQXy6v55n1IoRs5WgkKQ985r6fcl c5HPMqZNzZ9zUH9r92x8lsAVRT/VP0WuQVqoa+jXUteOba7SdWFrQoucq67DjyEp2COz5D82jiWC k9x2WHVVFRpy1ryOfNbAXLtPrUObzEhLJGl/huy73HH/Igtp7VnVXNtprh6QuZkUMClwGFHAwAmj 1Kto6jWsvyHFuITF6jWudMlfYyVGpLnW+kn4tbbHrviJ8HnyDe5jKQwE+ePkQQ4ydS8PCJDHJpK1 CCfxKSdxFHG6PlDJ2jWMu0UaWZufB7SQxSbys5tKQ4NH6QpIUOAgk9B/ZAi5vpqDcFujLfRhROSD NBVFLgPEpaqZYVI5SON/dhjd3K5IK1XgFPPXNU0FiqLlycNmFTaCg4CqbA4++aiV2jQBj/1iFbDS uKxy3WUTjdVOjS/M80SDFg1YjtU6icn3BCWClXwX5bECSEGrRHjL31r3MQVzBGExVQsAilYv4wio WQhIFjmeB0muvVgE5FsBc2U9kOtyrnK8dr5snHuEK05JiXIfBqjp2qsCPAFtsUuI1k2Tlg7qYoWQ RS+0YH4Av9NAXfLHNXCXefA+1GcZQ2RT+WwIDvJZBAoxXInAoWLZ28UNbX4dzXzaXwCZvVgFeNMR ZiZIHXgJbLQxv5Sz5fVlP6/OZ8OwB/7SxmdtPQXOImpYRTPnOUIPAfWIAnsRqrRnAz5HOd8itJHv JGq2nWafXTLmHpMCJgW+XQoYvSWMBi5SfVK09SYGDQszcoiwrypd8o0nSxagJstQn4X3iIIQokIk 3MzBfVKnxMr3P8Ic8yD5Y4j8xk2LI7OE0cZUWi+L2ji9msLW4pIxmdpGthEij/SLvke20eIn+IsA QLYTkjRdWjW9UmlT5iHsVniM4kWG8iC8R0rKCn4IXxfrqVaZ01BoYqmsIdNnzYeGOvTZb77dZ2Rc vVNDFzGJqOYch7QOt6bNKuBWkNpR40dA1EqCi5AlhmlJk1CGbGtALYJoNI2LQPRTtogVrY8gq2nB ojlzLAZVqN8EkwgfWjRM0BCTjpLOdFCXZy0AT608TIDUSrwS+qUYDr8TTdRi5RxCTg5PGAtT9JO1 wIWneogTvJmgqQLXFOQrAYEtCAmwAr7aMtDtREJlAWbOH1EZR84VW7aAmtYsJUgLhI1j2ngtsWhb pTkCR5EiL6pjmujH4nZQwB1GkMdFpN46j7Wrt4a+fbm7ds1ZhB91Fq9j50tAuBWCiile0ZcmdnlB OF+xevBW1SYvgowphzKunvSmxCzz404379FBeogE7ORLqAkRAvICyNLgRvNbKee7sjyIkCTPRZu/ Rn8xr4vgIcexTrQSWIRO+nempn54cARzFiYF9kEBo1GUAe5BIqkqba30FPJGWt3s5GsRArWFQCtK iZX+cAFR4etSNtYpPEhKa4tPXj4T8YVvMZuY6ofwPII888xhbyP/oQvVnkLu0Ma9tJaSZ7Q5yAd5 bDzjnELkQ2RJFATscPHMVhvjfJha7JZYnaCU+RYrrAa/FvJcC0t3S2lvVUJcOr5xv8Q9SSXOOJfE O2lct93qaAC/4nWGAUIbTx9WvtG/MJTSw2PpfCb6/RsJVlL2Gg3WY/V09VkBg+YjV4cJ2PChRAg0 kSCjGF38Te3TanGJ/qrZhhWIaKAiEpj4vS0CftI5jA9XVRGSMXVhRenkCqSV/qgAT0AmwigLq038 ysxbt6aqesPSatTKiG81JucrddzVkzTENRlY1XJXH9R3oq0rrFK+ZEFN0WAN4FM6trqyAKlAcohi rdbWVK1ANV+5dwlsk7KHXs4jTuYh9eb5wnj5osRxSAcFGzHVB3kNeTFsXKQSmBL1OOGmjVwuL+KA aNhqk/gC+sylsIyD4/oo/HjEwiAz4j/KPiGpcpx/AqNVpH5+W9QLt7IaUHDR71mkcu0BaveiUVL3 o/M4cSdAafAenUzyfWyHJc3Hrk9K+8740/xtUsCkwGFLAeHHYs2trq5Wtda7dytQpa8jQb7DBNZo yM3AOMbKsMy11c7GTWQW/qBfsWkXFYmQ3vXR42BTKWUVNFgJgTjsgp88LeqJEKzZ8yPA+hwu6dch SpH07yCfE62LYwaY0ZNApcblYzAztfpWWv8i5FceWjrdbipQ5IvCeSk2kK+xPgmZoV0pceTGHMMu LaSFz6rAulZEmL7rYnEz4ZZhsSgqy6nYggUbOiyaRuE0HTk0hU89rVjX5rf7+L7xPPX22zUsHtoz jdn0Ji3K1y2ALlqxBnoS2CaSnaTAWQi+8sBEu1SgJEorsTLEB6Ei+qUpCyPHRf3tMDx0QuKO64pU KdH0ohEz0jJC0HOqzkKUBhnNrgRSmoQk8ltzwWtapq67qzvo0M3lO0Ny080+6u5ir60dHVFdiNjt iBGgUiFVeRLEPCQR8tJMRkA6TClTzpV4N8n5kMWjtHsuflHtCeiSaqaWr9BL2p6KP140aHVd7V/V DlZ6lxOZJSc0xGIQUjFOFq7qeWwcx9+UIShQ0FxGiRc2grQIWmoYPVqgXXTdFxTrAkT7tU24/nZf cfPqJgUODQXSUtNVkyuNOYhmTHCMCKCSj1IzVjxOr+ImvSfsorgQeGUzbHQd3IFMh1q3xNJGnfEc MZGZPilUssSxLm5Mj9KQRUdK5BBB+CAQbAk6lFBBeYEaOEE92KZqdnR2LQrLJI8XNx8VPSstvGHy TrG+avn2rPshDkSrNJr5fEiM5W4GVQ83DvctgLqmH3dsWqS4/KeFxGnfiplYfNgqeJsrwBcUaY1a OMHI4ZFycGJm10YRoGdhONjk2RPlBcRtDGxrCTAljOlZRhCHZhbXDP6aCdnQuEVoEOCmdMcUMHno ba1+VkajUCjAR/BtqK9DQrxUcJOITOWJjxnLmL0h0Wn3pDalqasP+m/tBZB5WCl52mweSr11BFEf cljOVnzwAWrbFqbwWQnWFHLVEDahhUi5BFqHgLAQhd9bKICIR0AEAlmokk7m4AsVlbcjtrYx79Um kjLPl2PtvDnxeUtwpHRD0jRtbZ5OptOJyOKgwCHV/vz0dTkpHWsd35STgodp1gbN3C4k6fpc97X8 9UuYv0wKmBT4zlNAlJ6oxCnRairNovyBetYU6a7uy88MG4mhkYh21XWTCkUbi4i5mYbmlC6X0hWT xykuoiKjyd/Jy6xMS/OSb1vJxwLCd1jHQ2KmRaGzCb8UnkMGpoftKldsiPMQRc/jYGtXyeCh9dMm zFvn0crNS6FCGsVIBU7ZxH0QFF5KJU7mqGKlqeUL5rQ3G1OxPhpifB5wx+inh8Uz/RZAXXysBr07 AE+I2Sn5QZm0uUflLcSzlvkD8NZnsgLZOfpSMJIlNFOuSn7gPzY+YLszCa3eFhZN+Sl+dMlPMWHs KEXsjgdjmOu13EsthkDMzXKUiwBejt/96nr85rdXs0NcXzQ1tOKtN1/DkUcejfz8BH2sDhDTxo2d vWi3xtXkBnTJRB0ni02bjI2f57//Ot5gBbyW5jCOnn4s8zf7sIziPFz545+o+a5c9SGS4tIxggVy LARzFqTly0G/kYAoF/cNv/4dBh01EWfPORlrP1mKZRvW4uIrLoWFpV7lfDH6ixQrrdGdXLxbd+xh gZ9GTGB3tUT5QssaUT57Wdli+k/g3LeuXo9Vmzeg95HjYW1uY/57H3ZO0o7VXhbjfikVc1wt0t6w V5iAblDK/G1S4PtKAbEMWmjS/vCD+Xj1tXeJyU1spTwGF154Bp5/7nkW1CpmVbdJilds2bQFTexf MW7UqE71KESDZvQS68fX/D97VwEYxbV2Tzbu7p4QgaDB3d0diksLlFJX6u4uUFcKRdpCcXd3dwke 4q6b/3x3dpKF0pbXFvu705dHsjty586dz79zMHLEPXjy5TdRMzECyRnn8f3keRg1rDO8A51NYory hXLMnlpe0oqihAWx5typMzhJVs6WzUkuJbzuTJeWC1lldFBx01iQrZgR3GNEFnX18MfunXvRtlVT QliLlBTzglDbEt0vb3/TlHmRKrzWJJ7evaVOJl5+xZVumcd8w5W6Ju6F+N6UdxY7iJ5lUtIJvPf+ J8gm8MzIEcMQTgaAj7/4hqlZB3Tr1hLJ5N/OTrZGdlomXv7oZeSmFGACgQeOnk/ChnXbUZSagsD4 mhg3og9ef/tJnCNM4SEixGUNyMO333yHE8eOwCcoAoPv6IevP/0Ex8kuVDcuBENH3kXktmxM+e5b 7N5/FDHEfu/bvzWJSS4hm73jr73yBiFMWyAjLQ3JF8/joy+moJjgNAz44NH77yb2+Zdkf7NDyvF9 eGDiMzh7MQXzf53GEJA7enTtRyazObjjjsFYs+IA80Mgx7i3wkEWDPfoKEKnfv8znnjiKaLGReLj Dz7GsYMu7EsvxPFj+4h5vxLOvqHwiQ3Bqh8XYvHeDTA42+BRIsjBmYuUa7woMwdrSX3YpmULEuMU kFAmk0ZJOj7nXCZnpaF9754wZOWjdfu2OHDoGFavWIPKVStz30K88eF7KEglM1zj+mjcsjl++GIy Tp67hK59huPI8jWYMX82BpDEpSrJGkoKc/HUC88wxe+FJyfeiz27dmDxknVISTuPYYPHoEbNynyS kgK4Zda2ZSCWGbDMwHWcAWs6AcV0nr4nxPWLr7xJYCk/vP/Bpzh48CDSqKSDCCctUc6D+w4iJDAE ViTcyKWDdPbCeZxLu4S6hIp18NCcJCGYyqFc/fqbqXg77kE4Mi9++vR5VfOTlXIRuw6eITqlK+IS quH8uVNkXiN6HPvYz108AndCetf1rK4CkxfPXcTxk6fhSv6NiLAgkoAZsHn/fhhzUpFQozaRPHPw PFFAH3/6BTRuWF+lAy4kX8LRI7sQS5IqV+9wFBD6++KldGSkXkD1OrUYPNU64kWhq04ok0LXo76a Yq/Iu1/HKb+mU99wpX75qDQvuYQVi6+9/DJq1mmA2IQaZAVLgxvDz56Eh12/ZBPSLh6CX62qhER1 wafvfgArhsmrVa1OhrJnUaleIvYfPYbHhgzGgx98gcKzh6mYkjD6oUdxitCBuVws7iQ4scrNwgdU dDW4kJYsWIRO9OB7dG3BfEwRmdkOkzP8dTz+whtUqJnERc+lArYnx/jHiImKQWiYP959ZznCQiOw bNV6TH7vdbxPlrYvvvwWW4h5fNeTL2H5yT34cdpMkpU0IjqdP2bMmAsP1zgkZ57Aug1riXl+EF26 NcfefXuodAW73YDAQF+MHDUCX3/1Jey44Lt06kFqVHf88AONGeaS+hATfsov8+Fu64UD67aiSedm OJtyDvPmzMcAGidlxIGPCAhBRKcmZIXbjDAHN/rxpDYk13p9kqZIBeivCxciMSIGR8hCd/zkSZLR nIULoV+F8CA6KhohtTwxf8FvqFKzKuom1uYitse8eSvRMzEBBdYEoWGT6OmTKUhL2sp7a8A8vjfm zPwFWbnpfPFcMaB/S8z+lVSyNauowkTVkGBx1K/p5bPsZJmB23kGylh8Y+PghISEBLz8yksIjwrC HQNGExbWB5vWraP3nYrPPvyEqJUeOIzdMPq54iwdp40bNyCsOmG55y7BuIkPkrLZDUaCUgmqpoNn CGZ88w0GjB9FqG03ZF68hJnzvgTcAnD28Bk0bNsV586SR8M7Ao1aNcS7n7yHxokdkHIkFz3vaIRJ n0xietYFa9dsxF1j7oS7nRHz1u4ifK0bFi9eo5yXLMr4Nas2YW3+Zgwe1gUffjyZ+f58LP5tAcY9 9BTmfv01th48CVc2w5+9QPrWXt2Vt/57uaYH52+tp3jDlXpFCZkpBi8hDOZaLpw7j+o1qqMB2X1k +/aDN2iRnUYH4ggf3LtO9XBL73ry2WQcyjnDfkY7YsXHEDa2kNCkNVG1ciyc+TAPHdiLmFrVUZ9K P8DPE6eJYb53w0b0b98UW4+mKi85kFjEcVWqkLRFBacRE1cZDz/6CHbR+zx7PhmNmtdAGr3dHduP II549H4sBnEkyIJwqodQsSdWT0BYTByO7tuKiNAQVE6oipMRYThNRrUVazYg0Ato0aIFFbctiU46 Y978ZXBxCUXNWnHYtSeL+O8eKo9dXFDMcL4/xk0YizOnLmE+lXWL1g1UXt/ZkdjxgcE0LljwRk3p wgXeqEljbN+1DUf3HlBzJEUfxcTKr169OnZv24YNq9fAhSQtbvSuU/kyrNm2iRWhBiQSNncpmYu8 SDhTv34tZGRn0XBKQUKj2qgSWUkxKTmzXuDi+VSs2LyNZC2ucPZ0VsxuBp6L9aU4f/wYmvfpz1S6 HxbP3Ud2JmvC09ZUWPdSeCdFJ1JvYIINsGj2W+s9t4zGMgP/6gyI9FZIHZTL9z/0MLaTqXH2/FmY cO/DePO1p1Xe/KUXXqTTMhiD7h+MX76YphW0UVaMuWsMmnVsiTeeeQXb9uxDy/r1VGePMFyOntAX bz/6EJauWqpgYJ3cPNCCcLEnkrOQfCYZW3YcxPhRPfDb1EXYun07YqpWIp9EBDIYHVi/eD5iY2Nw B2msJ3/2jWKtrE6nL8vBH7ZpJ7BhzRb06NcPHVs0QWLtGti1aje2LF5BjooQjB0zAl99+iEWr92r cEdGDh1OzHg7zGLatSOVumrlk1y+pFWVEtPddt2DuXUy6zdcqStlpH604rgy6Q8nTnsNcnNPmzoV +w8dJ9ppLi4d2E/rzAnJp84ik6EQ4onCocBIprFqSDlbiLh4svbwsyNpF5FEzvUcYrann09D1271 sHrLZnz780zsOXQYPvGXkJqcykKNEhw5fJytFsRaz85FPoskci9dwPOvf4C+Pbohk+Qkrdp0wEcf T8Kp06dYQGGHDz54D5M//BKRIVEcp1R0GnDiZBKmzJiNA/sPoyXzQ2t++Ykpg1ymBdKRnE2jg+Hv yA5VsW3rDtSuFkkl2gn33vcIhg14lmEiL8LBpiEr04FhbFafU1n++P0vvJcqtHKDadHaQYiMYqIr o1Xr+vjt5xnEZ2dxCKtCyzJLMX3WbDLLXUST2rVUNadUw+cTWF2q5Zs0aoixr7+H2lywq9esw6G9 +9G2WSvMWbkYoVz0y555Bv2H3QFnF3scP52CelTI69atwV5SE15iqGzjhi3YsXUnunbujmm/rEFe 5iVGFM6y7S0YDiRkiakWjzmzZ7EFpQpCQ8J4zAlFHVtMaz2fxow8VKl0lUWvgTmYlz3+q/LEcjLL DFhm4BaYASm8LUxPwbTpMzBszN1UlIn4aNI3WLVmteJ6GDp4CImcMnD66ClFd50rbWosYHOl8yVb YTZZ1ajMhfdDIWqyQNjVxRH9Bw/F05NegpdDQ1w4ewFzl8xHtYbNSEFtg0wWzwWSNCadhF0rd6zH 42/fibwTLKyjCBIsUD37Jx1MNjZ2WMNjz1mHINyhlMV7vBZrf4zSIifNa4IPoq6rHaVkF6Ob0rZs SwdFOEgk2C7NuVotv+ns5fpbL7q+BR6G2RBuilK/vE5aKhKtMPGpp/Hx5C9w4sRJ9O/fF0EdGuFT Knl//1A0aFYLJSGepAL1Q6t6CciabsShI0cwrHcvcuZSoWaxIt7ZHuPHDke3LrXhz1z1aS6Gu++7 D/WbdcK+uGgcPboXjz35IHPmoRg0dBDpP/2JDVxE5rWqiIyNJpd4CjZt3YQH7huPJk2qkbTEDo0a NaZd4UWClyIMHj6aTHCeqiL94MFDDJW3QM+OzRHl50ySFy/mrNuhvoMPWc08sXzBVPTs1QWVoxvQ ELAn29AziI9qTMvTDr17SKGfqViOim/UXSMYbv+Rxsx+dCd3fHhYGBxJHxhTuQaVZhGcggpRJTgc B2YvJrfwYXrHsWjSkjSnAqLAl6Fjz56q59yVTGtPvPAsAWOKkVivHrLPX8KhQxxn585w4osyZvxY JDDEXkjqV2d3F1SrXBXrd23FDnrzibXroE2btshPycTWbZs5h80RXyMUSdnJsPMJInd9EGJi4rHr +FlW1eeja/de2LFrPVxInejp5UxDqr0qxJPiQIF91IoELyt7vLVWvWU0lhmwzMA/ngEhUTEw/C7E URMff4oY7LZwdPVBrx69GMqei+atmd6ks/Xum++iXtWacAj1IadEGSZ/OhlOi39FJHPh9Uj8Ys0I qHQcGVgInFdoZASxAbqd6o7vv1wDD083FJOf4xAdtCI6ZB5+Wn47Oi4Wey8eRGxAPDYe3ENlXIa6 rdrhwy++wqsvvkzK7AMYOHggI4ou2LdpG1xC7eHu6U5Z6Eq67GyG31fDkcBiddp1wKrPvsPEJx+D DR2kO3sNxtKD6+g0lRBoi51AlNl6Y7LUC1lJn7zqrauYvlutjEhD1VWelbbpGL//+In/yQn04ndN 8DOszomyZdXi/fffb3ZUGZ6Y+MLvziL73jN0bPnnkeW/lbJgK4x/GdG3z7DLjounkgd6lX8WHxup RQtoGQ6nspZj2ncL549pF6E5pcEgzmbj5o3KjzuddBD9OzXDIw89qJ6pYMp17D1I/RvWvmf5fo1q vVwxKraq9ew+WP1tZM+5AM6USQ+9WilW8GEb2/0PPXTZeBu3aKoKTGrW0VIRsoW1jMGo7p0YEndW 3yl0Jq7vWp0bq3sp5Wc1mtTTduYHw8aNqhgDgXPadiLTG78oKixGJNMWm1hcl52ZhUimLdp37cT8 uB36j9DGqZ2DczBY5kb/sxB3j33EdB8lNASkqlXbfFt6adCL0maoQy6WieFS8aQrTmz5zTIDlhm4 3WbAnCNEMbbxBgSoypZU0ndOmID9LEbLJ2tlBNkqven89CKTpeBv2LP9OCAsmO1m9NB9PfDBG+8y r90ENerVQkJ8AnPyFGKU6b6Rcbj3occhf4oIGTZwNLq07QMfH0/c8/jzOEHudE93d3hTXoqs6Tm8 KzoMbEMcGnvUqVMbidVIcFWcg+at2qgaqtTMbLiTR71Vi04Ijt/Prp4SdBocyPP5YuzDj9FhKoaP l69ycCZMGIkTTC9GMqLp6eWBvnfdSTIZ9sXzHkOrxfAapvJu1dyjq3BR7Fq3j/bJraPalVLXof+U LC9v8bo+y0730vUqeH0+lKcnGD8mPaChrWmBehWqVyEPwWlXu2mfq33Uryb8dlN/uG6kqHOZjtGC /RWTr3rUpfdb/0z6tKUXXqaEP8oiM82B6jUvUfn0R6nQRYFqKDTs45Z2CdXaIGM0VQyUP3jpkLQ3 XUNyMII1r51eDVuOUwUYMhbtPsrXBneUsUnxmfzbe0hf1VMuDEkKype7WjNqIMfL3FiLkjeRzFQ8 ORN2PS2IMuLia94075LnqMM8Vn2G7PWtmH2kgtikDCyeXzpBZVxaTz8PkjYR0/1Z8XxyLa1vXTYN Ae/yzRx458rvLH9bZsAyA7fLDOj6QYcPL5dLZnqsCmuUzDc3KmB9C40Qp0rbAkKD2SlTg/VT1bQP lMxjPQ7z5278qdjo8FChy+bl46N+zDdBoHWxJUgNj5fcu40LsUUu5GLt2nVU2Ll0ftxQn227RgrZ GqyBqthIAe0XAoHM0TdPDw94skhY31xYrKxv9iamuPIPLtPdt2Y0spxP/YbAw172yC57RqY/TDN2 WXTDpLjVV1f5Xfv4cmvJfOJ1xa+uYB4zuRqggPS8X8XiKtdYzK+wWl7a0UrobQtcoqKp1RHZTGM0 X5gVl/z99cqvpF/zD4w9eZkK2K4myG/ynBR+Mn8vvyOTQfC7y5fvoVkLqsZDoc3J7wSopXJXaHJ6 Hlzh1ZgMBTOL9PJhmezSKy52db6AW8d6vdpqs3xmmQHLDFzbDOjvt+r5poyQXLi0oeUxnVdB33yV c4m/Ytpfju1MnnSBn85m3dRVPIFrGMzl3oNOAVuaU8qaJXfcc88EVevj4OhEQC8gg+1pAqCl6FlV hEFrQFPOpY5e9pdX/Z3HcpUjrlXWXcu5/nJAf7pDuVKXvXQL7EYr+H92C//m0VqvoaYjpX9eg4yV qndd2QuCkq5U9QVlnr4wH80/TWWYK0pdoYu3LsQ7v7+mSdkqr1mHRDAzL0yevDxbnZxBNxBkL/H+ 9aiAPu5/Ov5/88lYzmWZAcsM3LwZ0OWNalulDBEFKjgep06dKncKzD15JUdNzkMxtasofimsKyYy qMgvUfTm29W6vDVfSmt7rogEak6Jrq+uJJqRv4sps4k2o5FwiUHBAj0hzJK/pYLddLQGuGV2DX08 5lFH3RH665mvAL690i80Z4G7ms/41+f+3/ZQfOr6BBUWFnLSpdbv1tiufHjmSkZfXFdTqHoKQV9U yps22/Tz6p9rCk3DjBflKaQnuvLTrqN5tTbEVdfPqfJKph9z5WuuEGUh61SFsq+5sfRXBsGVT0Ci AjIGOYc8pys3GbekBTSDQ7Ok9XvQvXPNwtbC+dr+2j2b36t+XvlMDAg9ImA+z1fb/9ZYMZZRWGbA MgPXawb0917C2yLnvL29lQzRZfHlMkdLHUqqjoDUylPS5a15pFEfq3B4XLnpUQHRSZocMqVjTVpX l7u6nFIyiv9j3R4zqxqCnKg3xXKpEEpNnBqU9aL1NCAZacU1ULaSJEwZGto+uiIuYWS2PCJ7hQ4x T0soimph1RSWUZWalOtqN2XLLiWVshVX8SoO17/9vMqVuq6sZIJuhU1XNjLB8lB1r1IWjqOjo1og +sO+UuHoylbuw9wbNVdYcqxYjHI+7fxaOFv0vyh4Ob8KK/Hh2HKBqF9NrGT69f7IyFD0fjQU5F8J UcnvylI1KVJZJHpU5M/mWs4vz0NbLCRh4e+6Qr7SmCki1rJssriMpEHUjQBZ5/K7woVXeXUZhzYe 3TvX71UPxct86ONXlq9p/vV51cNtFk/+VnhTLGOwzMD1nwHdUZJ/RZ5cICiLMLUJr7q5vNUdBV0R Kr0i5FQcooTBFVGVUnqXh6t1gOnL70TShOJcsG1XqKVVqvBy7a+PS5f12v68mkmPyf5yhFEcM5H5 VLDSRq1kl5C6CFubkq3FJuVNVjk6TaKIRQbK57qS1+Ww+VzIdWU/wZHX70l3quQ7+aygQHPEBAFP U+rXGqr/e8/1dy1tV0723zvtPz9Kt4L0CdU9RlHEuseqe77mY77SajT3NvVRyT5SXKErSaXAJGzN fsVSWXDipbKXUUI2siJKaGWJl67+FfB/s2ei55d0ha0tBE35ynfaIpbjNUWq7y/3IQ/6r1IdOr+9 HCv3KQaNGArmx6kXjSh7ZaxYF6IbeWkEDtHJyVkp5GKSu0jvpbo3LnI5p+To9UVnrtz1serzJnOt K3a5jsybeS7+nz9pyxksM2CZgdthBnQ5q8tmf39/cmNUUkPXnRZd4el/l8tc8YpNtU+qLvh/1Gt/ 55irz2lFNbKWbtQUr+YsaUkAAa3RZHdFUsDceNCdIN3x0eSopDU1p1CUhpYm1drvxEvXohw35inf lD71v7o1fdFoFpCWDpCKbLGesrNzlEWlK6Qrz6UfI0ACUgEpClBVdv9uRvVQuwD+G2hFORESlV6s sIwS0c2Wf8txohjz2adexO/sCd4u3q55gYeuvHWF58DWPHnoUkCiKz9ZHMrY4L/C9VtMRXktCl3O qfJPHLvsr0cnrjQEtFvTFpKgurkSBc7WVgwGrbBO66skWQvJF2wcaTVSoct59aiMzJHgJxcRqlH3 yp2cnNQ9iFEiilz+lb9lHPqxt4oB+FfryfK9ZQYsM/DvzoAuo3Xjv7xwl8JI5InutMhVRQ5JfZKN RCqFNltndNT1q3nXj9kw9fC1yE/JxYucFh1wZZRSDAj5ETklm9HkAFWcSqKuogO0sRhJ+mVNRjct xahFZTUFLQ6+FEBralF+1+5TS1PKvYpclONEFuqRVJH5YgjoUVQZr67Q8/O1AmcZn37ef/dJ/P5s t4RSl2cqD1yUkUyUeJkySVKMocLUDFnMJGqRKMm+hPkT+j4JmeQwtyPHycMU4IISPvgsAgtIrkcW 1quvvor2BIWpW5fsPSqUXcxzs91B2i2kr5rXzWZ1pLQbSitESGgkoQc3o2HDuriYfJbAB55YsXwF qlQmfG39RnxQtLaMDjQsMi+z8ORhyxg2btyIuXPnqlkeNGgQKkVXIoKbizJI5D6STidh1crZChBG YF/lPiQ/pRkP5F+jsSJQijksQJHfZT5Wr16t7qVFixbqGrKv/C0LRbx2+Vvuq4AgPA4O9khJSceX X36pkPfsaZg40yixtXHAuXPniGEfrKBwW7duBR9fH4aiBNbViB07d+L7779Hf86tGELHjh/HqaQk tCM8Yz5R+5YuXarqCiqxvz0yMtJkwVqphS0LtZD5KCeORf6We5J7uLohdb2Xs+X8lhmwzMCNmAFd sYqjIvJI5MdhgmPVZs94/379laIU/gwVcqciFXyM3+bNQZPGTeBLzgu1STeO5J3F5zBzunSvWEDJ kpJOY8+evQqUK48sb/Xq1r1sXz1PLzJ29Zo1ZKM2kKCqsah2/kiOXctj21B+lZDHWsLw1nTO1hBp M+nMJfTo2UvJtvXr1iMgKICw3SFITcnCKsrdXr16qUp9FWHg/4ninzZtmvqsJ7+TfPyRI4exadMW jBo5UoX3CwsLMP2nGfCiDvIP8EPtWolKN+kGwJWKvSICoFk2Vxosf+dZ3nClrnqz+WMtRRTSDc0J t2VoO5cK4UOyqWVmFaBPrz7wtinBR1M/I4KZA3p17obN+3YgL90WQwZY4cPPv0IusdmH9uuBU+Qi 33/gEDIvnERwQj30bNcY06f9iCMnz2HW9GmonlgHi5atwqE92xASGY/mTRrh1+k/Yc/ZXFQPdkQ3 4pkv/e0XjHvwcQwf9yAi/D2x5dA+vMi/+3UnUcqe8/D2iUVu2nG89tnPJCvwRb8+BPhXfLxart+Z EIg7duzAqlWrcNdddyGD8LPTp3+L8cREPrh8B5Zt3Yh6jZoi1jcYW1dvQvcB/bF93QYsXb0KnXv3 QQxJWRbNX4S9xw6gZkg0mvbsiLSz5/D9118R5W4X2rdsr6Byv/76c7h4uGLggDtw8HgSthKKNiAw CD5+7qhVJ5a47E44d/Ig3J2ssHnNcuzcdgFjx97JHs40vP7GO4SNbYtLqUfQtms7HN64F7+s/A2t uvRG1YhorMIC7EpKRpu6gnNvhQN7d6FFk6Y4eewULnDx+/r58llZ4xJzad+Q0a5KQhwpEhvjTNJ5 VIvxx4IVJJxpUgMbaDR4+kYiNsSd4X4aKSp/9ftq/L+zWC3HWGbAMgO3xgyIklIV5SVWmEo2zUL2 iU8gCM3PP03HT7/9ijt69EYR2SEF4dLV3Y0tZTbYtHgjahES25fkGJlZjALalpBFzZN4sdQJ7DjL ysyDh7MTCpn1dKDIyCvIRSrlyxqSaDV5vgVsmEYsoMPD/iNYuRBqWyjY84pRRHnlQeflws6jyCeL pSj1kpwCFLJAzpkANOKB59MhlNqoMvHSqYTWrl6POh26YMPSeTh69iz6DR4Be8q3D197HjVbt8O2 jUfQu7N4m0Zk5mbDid64PQF0EqpWwbtvT0LH9l3psNmRP94XCxf9ikbNmqNKbCWs2XQQC+gEffT+ 23C0c4KNrSh6I4nFeG/sh5cUqIFpUiNlojWxPwTnRNLsZYS/NVoVwV4a8E3pgL/7pG+4UpebKGVe V4BObDnpdrw5W/LjvvTW63wI9vDyD1cMOvUjPXDm0kHsW30Bp3cegiHBGz6GaHzz/kfYR7rQcEKz fvreOwCBBDZu2YFujWJIJfoZMk/vx3yy8bTu3RdO9KyzaSGePH0Jpw/ux+ffzMLH772BryZ9Av8W g9G3STiMJITxJx66M5GPPP3DMHvW12g7fhhp/vwQ6e+EQ2f8kZ9jTfKBiQiq1xXrNq7j3+n0esPp 3a9VHnXDhg1x5swZ4rzXR3xlspURgjYkyhMpRek4uecgGtWhIbFkBUY27YhANz/sP3Eci3/9DTXr NsS8JcvRJbEBfvzuR7Qe0BVblq6ETy0qWeK8BzNnJVjJdsVO2L1xF6rEVML+I/uwasUyHDxylqQz WahPTGQ65OQBzoWTwZsGRTYCvJzgRrzj4kuBOLTrBJwCU4kvXxnRgfEwFl/ECVIXbpm5EAnNgjFr 0TJE9evNBcfiF5aNFpBcp1JkCDz5Mpw6fgInjiQhJrIy1hDP2cvNnSxz2zgubxw7epC48/ZkUWKE oDAFkz+eAi/PMdi+exeatqykrN/iAubvmesvKSvUEQb+7jq1HGeZAcsM3EIzoKKrdMbyT1/ExeOn MPK9FxFA9PUxo8cgqSgHe7btxNzJ3yLd2wGO9FofGD0Awc4B8KI820CI1h9/Xg63wHzcO/hxFF5I wQczpqAgh6BYlJ/9xg3G/Gk/Y/665XDNAzwY8VxNOWo4eQmFJanYuGkD9l46iTFDR+PQ2m3Yc4oO HYlcWnnGwYpy/CL1w48fTcIFsrF17tkdNerSsaP87dCqFRykIJqFxFkFJXALCsKOaZ9jA6+f6xmD GmyD200PvsDLC97OEcSTL8I8ksQs37QJISTsGjZwmIp2eroFUp5J7VQR/CgL27Sqj4UrGNGlUl+y chd69e2LU0cP0SApQ6P24fji05k4nXYOHXt0RtZFKm4aCjWqhuPbr+bggafuxyeTf0CnDp0QF+2n UEetmEL9J6nNG67UVdO/vjhVWMOaPLr5xBzfjkcJC9u6bXP17fxvfiANajHRgKoj7dwFOJUy58sQ 8+ZD23CBlo1LSDEVSjKx2T1Rq1ZN9O7VEdPXvYUFCxagWu0GGEnc3zUzvlVc6ccJARhOBenrfVHR 7vn4+qFT+zZIqB8lWK/w58MNJINZZeIJr2E4KYAVnX78qUoYw1VkfcvIyMC+/UdQ4Lab+xfiNBV4 m7btVJhftjCGhpIYrlbWqygz5k9cyC4k5AA1EhPx0+KFOHj4IIzNOzIkbo+TSSeJnb4LLrzGOdIT poRVIrZ6JQzpdwc+3LwHx6j08wigMJAhHWvH3+BQTIxiwirOW/IL9pJCNTAoTIX027drT4a2OGXR lpYk4zwjBCdJgNOhS12c2HcMlSu7oIQUrm7eVoiKskZ4eCiOnjGQ4CYN6zavQRXPmiSvKSKkYiZq MEw0fz9fmsIIQjWWIS4uDlu2bOEis0FjRhnWrl2lLN41TFNEVorgMRmoVKUejE65WL31AGpXCVMR ERdvD8RF+KKQ+xpoeQpJwz9ZoLeQHLMMxTIDlhkwm4FSupiS+ruUkky5yLw1PWhnb3fEwh0HL6aj U6+eKPZ3xbuTJzM0fwR2zo64QEKqn6ZOI03qaBxJ2ohPJ3+Frk2aqND6y8+/gklvv4st+/dgJ2XP 22+/g6Ob95I6dS1SyHleQLk77sGR8OB103YVo3bTxujatAMef/wJNGzUCKVns+kZM0ROLg0vetCN 2rXGB59MxlPBQejVratUrKk2thSmQd0JThPk5YOSaokIqeOAnUKH7eNHBd0C0Q0aYMeCJBxhJHTV 4iUYSFa52fPn4vspM8kvMhRRZLY8cSIJ0ZX8eT1btGzREt/OXImLWalM715A+9ZdsX7pYuSk2uO3 6Zsoq+3Rv08/fP7tF2jRvBvD+ymwKU7F7iPHsGPTRrbUWyMg2JsRBHZiUbdJffY/2W64UpfBanVd klBhAJ6K0I6hDR/CAO7evRN2Lk44z5DLyrm/wSPBCyFOQThBq8eWZC5FxXkICg5AQREtoKbNYMyN x44jJ5GRmY48YQtjmCQkNhyHDx1l2HoHki+lYDeV57ZtuzHs+YcxddEaFonlMU9ciNKCHLK6ncXc hcsQH+LFfEsJ0lIu8bs8lPB7UZQXUrOQlprKPLENQ0j2iIqNg7drXbg42HCsu5mf3qVyR02bNkVV EsPMnz8f8WSPy2I+fsbcGWjQph3WfT0H/e+5G4c+u4ic/BykZqShCvPW0TExDBMxv5R8ngaAi8pH 5xbm0xKVkJSjqrTfTY70o0eOItIvFp98Ool0saGoWiUW6RlZnIsyMr5lq5xVHvPyTgx/eft4wcvX nV70UVUQcoH34+xpD1vSzebTcErPTFGFbk52jmRuC2eevgn8z5cigNbmohUr4Ucl7+zAivkiYsJH R2PJkpWkfw2Hf6A3w0c0HLjoIphTr51YkzjLYM1ABM6VFGDW7H14cHQXvPvNTHRhXt7OugAZ+Y5w ZRSGnfEa5Kxls8yAZQb+X81AKVOQzsRPdyeeemE2w+keDjiwex/OUH74W7tgL+VjiqMRyUzZ2VGm 5RTns/anEGdOn8HG9VsZsU2lnIlHCcVDDGWrI0m5JBcurXK2rs4M2TvC0dODeXAWDFPT2TPNeZ5e +bKdW/DC0y8hyNkb0z75ClEkqurOOqGFk35CMcP4Z1KTcZzOUiajjuHhESxwZoEwz5wr42Vb2Xni yAewpijQyQ5JjA7bwgEe3MdBtCmhvF05VgMKkJ3O8xw7zijlOmmBIkVrgKrhioqK4j2lcMzBDJsb ERtfDU72q/DWey8jPLQaPMgfX8IotBPPc+TUORw5l08KbIG9DUG1qnFYPv8QNp/MQLP60fjhp3mo Rz3g5eRAm0PqDySlK3UAf79U/oYrdUXiZRqwZNVLpFeQBQ1PPv003nn/E2wg/Wfvbj0xggT3H0yZ jDxaQjWZF7cL94ILQtGpcVe8MOkLzJ79M4b06kSWtQSkpmUq+tZ6LNIY1b8jZvz8K6Z+PwXVa9ZG u/YdyC/uhW9+nE5e8Rr01r2JPVwTQcxD5zO8snvPHjSs2ZfUpY2wbvVKxekeFRSIdh3bYM36LYiL jUX1anFIjH8Uk39cSmsKuHPUMBVq78swi4Tf9Qr7s8zNSHGek7URg0YMQjCZzc7FH8CUaVMQGx1F fGNbxDEnk1iZTHPEXZ8ylWNs2AD+1QK5uCMVA1AwSQWiw6Pg08kRX379Dcv+3dCkXnN+7oFf501n sZ41GiUkIi+/DCEhwWSfO4HDR/agfafGLGCzhZ9fAFJT96JRvaYs3FsCR+b8I6KiGQJ3xaFj+3md SmR6q0F+m3TMnDkPgTG1CalIYBsyIAWwMJDQCfTOSbDAaEZEZBQqRcXQeiwmT3ElxUM/mAWAnzB9 4eYTgMbMXUXRa29Yrz5TCTVRY8chGjdxKjdky5faKL2iFn3+/0qQW27GMgPaDIji4evt7YJGLZvj 3ffeRoP4qtixfjM6DerHNN1OnE25gBrtW2L1NipwypQCklt5MCLarlMnlNl5wc7VljLHH6UUqnmk rzbYlCGTRchVYuJwmHn0z+nhn9t/Ajl0qiIZARWH7LVnnkOusy02rN0Am6xcfPH5JPS8f7wqkssh pbbRk5FF1k0d20yudRb22jteVA7Olp27UCOhCim4i1CtSUP8zLTn8XMZMLh4kCZ7K/JdAmDl70Nn pBDrNqxHOguqIxNbovGRliygDocjC5n9aQjkcpxLeOxzzz9GeUvybNXu7IL6tapj0KhB+OG7X9Xs FNFJMxZaoWnbzihavFlFYgtPnEZYoB9cabzs2pVKArIOmDruHYy8a6yCry0yGiivdYCav++uXwYT qx7VFchn//YSVkg+0lrAfmqpKtTReCOjKuGjjz5i6JpFdFRE9rSyPmtWE4YCJ+aVbZFuyGcOnhXj pZl47ZVXWKBRAkcqjzxy4oonaFucjVdefA52RZl4auJTyGPexNPOiGwWUzRr1oLfsxWOHmoRPfQm jevhEk0Eh4IMvPTqK7DKz8RzL7yAjCJbONkUINOYh7HjyNRTOpBFG55UeKR2Z0HHe3U7kDiFlYzM e6SzUE+fK61dwVZVS8qPgd9b21sjl5bXmAn3IJdzauVE6y+nEA1bNMDFwkz0u2MAerAgsIh5f1vm sseMGcPr52LIiOHINBQh0jcQNRkSLyELEdl9OU8FqMtCNK1tQugOTRCItAhDw31pWDD0xH18/b0w d8F2sqg1xpPP3ceIQwlKDVk0Vpx5P+y1N2bz5bJGyzbN0aAjDQEXH+zbsgn7Dx7G4FYDNdQn3mMh iwCHjRyBUhan5NHL78/xCkSu9Lm/+fabDBmx2p3VpDZebnjsvlrks0/B4489gnxSLWYVZcNRQBtY XV+sjvn7Vue/vf4s57PMgGUG/vcZ0FvYpDBYI5TSENQk7NquO/Hc/TxwijJk0IhhqM50aEH1RCx2 nItLFy9g3KjRrOlJgMswbwRXCseAkIH4dc4iyit7NG/eBLkZmXAOYSEuzzV89DCEh4TgrgnjsWDe fDRu2xJBcewiosdeEhSKiIQwnOU5RfnHkxHu3qeeYCFbjopA1uvaAqXOdogMC8EKknWdOpuEls2b IpiGxIWzZ0ztvbREVP85i+6o4Ku2aYUsZwc4+4agcmQoPMOZHmVRcnjzMHjHRjFNMABLl69CMAuS G1NvZGWlMdNAcBrht9Jw6SgzC9GMqYA5M35GrdqNVNtz01YtkZdphcgqUcjOs8bJsyfRhmNxZetw 5649uX8HhMcF48N3XkQ0o8vFlOsOqvuY+uUfekLlnrpC/jH9/O+P/NqPqHDcNAwhPcpQJF6dwLYR kbdUKgGpDEoZZld5BnqRZTYkuKeyLWA1dWlZgbIS8wT5jStBIQbRSChmiFjOUUZrR5RPDvvLjXy4 RioaKzmOik8qD/MLJHHBykN6trlcDPY8QREVl6zRYmpwG1pgxURokxBIkfQq8t98VjCWGQqoZE1E KpwrHWHIHDdds2F5PhboidWST6UrYyxlON+OayCPnztItT+rIaXvkk4wz8keSCpfWWuFNARo7vAh y1zIomHxmgJIoHXC0IwsIhmjFV8IDfGOc0MjQnrQJZ8fGh6MBx95DA6svMxhGkHBFnJuSjmHRi42 AwsUrchEx0A/j7dGfnohwhiKn3Df/eSC9+ICZWUKr2FgPYBQKcrvXGccI6+tyjQ14IhiWs1GgaMV oyo/gxWobDOkwcRLMdTENjqiQAlDksBEaphOls0yA5YZuF1nQO/BlvHrKJc6Xoj0k7dqyDYy+ZHv BaSKBWvdWICrbyIB4qq6KVkgbGxDhwws/84uwAee/CmmN1+5ZhUphlfp2CHDhpbvozQDPeXoqjGX T2H938+oXL9l29blX4jCbMAorpJDShRZITwqAvPm/ozHx49F+y4d1L7So+PpVxeV9SMpnCMYYR3N H9lE5/w291cezsp1htMVS6ag14k0Jv5Ig/qteA7RTyXwD44EghmDZlq4ZbuW5WMp4EkCg0L4I7yf pYweJ6j7LZU5Uxnpfx48L4eJFQ9NJ/T4N3rl/mjx6j6bJubNPDiJy6s2N3l8VIpS1l9CFDb+pyhN OXllVOZUYQoCUKZSNUoJ0AD/EXBbK4LGqKMVrA+nTE5ppc4AlmvR0y9SYY5STpyBiHHymbUoVHFO 5Wz83kglaRCDQilDAZuRfnYqeZlspdhMVKR/dINyeRm7ydqi6lTFeDJIpsE1I4aDpd3C+9J65WWc qleT+1F18wMhHlDLiKPiHcsXVry2jmGvWjBlBzkJPWGDACjIiQvZg8mckI2X+qpIKWjpIZRryRIq 1k7BkxezgK6MSl3mVsbr6xPM/nvODVsJJYqiAT/I+U3taOZ6Wa7Fz40cpxg8RjGySlx5ngIZOhe6 Ez/L49F2alw6M9KfTJnlK8sMWGbgFp4B86ikDFMUux6Bk04X841K5bK/dVmtiTnKXE0qlW/yubgr 0ksuslKciHz+7Shyk1+yVlfJemsRjtwlW7q++KuLSUcX8A8HEVU8SYHgkklPuenscpwAkSm9QEEr ve9ytp59pB06k04XPWT5XoQwv2MAVF1LTmPLanh1fXHsmFI1UAc0alQPHdr2YIGcuF48hP+yIlo7 yCB6iYqcDla53FVoZlobt7pHNTfawIXjvVh55ryW6goTl1Zm4++H3uU21b3r2L3XU5lf9gTlD/VU ReBrj1cUnKZEBOpUbpDkKcwxlFFpqYekFAmVEifMwAeh9bvTW1bKTY60Vl69USZJjAMeR3w4Ew+7 0mPKS5cP1PxTyZUYHCR4os7DZ6YVdfEZSQ99Kb192mMmjnQxDMj6IypXKTkNPlZbohV+qP6XeMY6 0aoyEqSvUhaH4guQa1ER8nfp0VeBIImQiFfL32UfdjwofnZtbuT8JgVrmjc1YwolTn7RCFpUGIge u0I/kvEJoo6sci44K/aLl3HcZVx0VkYbzhORlOQ++J3Mn4E5q/T0DDhYs49SIA0ZXtMsDbU4tOei Nj3Ooi1AMYRkrAW8nD2PK+Q7IJ/bcQzFfEFtFXS+zmdvOoXlH8sMWGbgtpsBnUNDB0sRbA5haMtk d5FSUCbFJX8YTPJNRLZUm6vaKcqjUkYJRW7Zif6kjDAwYmikQ1JC+VfCHe0p6u3Z955DnVjAKKAX NbvUW+UwlCpyyo1/i6w87Sbyht4864oKKKqyub8Hw5mOLB1PcRbZZAVnnkfJRCWJBc2OMo/hdltG Ycvo0BlYFFdm74zt7Lpykm4qQrrmUh4XCAonj7IVwBo6PWWUl0ZrIm2WsjqeSt3ZrQzZmQYCdCVR sauif56bkOLct5RFdoUUiCJ/RS7ayD0y1VlK5VIs90jdxIwwfxhBpSyW82cxji+RU5m/MjpFDozU itOpwqF/c1NKXQ+7K2S2Kyjx/uZ5//Qwk61iUhKiHTTGM82eEsXOAgQqddF84qXKgxWlbhRLiJ/b iPJSri1zO+I589cyLhprYz6PE04gho8l3K7wdnkuZfnQb1SKm5NpRa5dmXg+BFsqNmtRfMKyIyPg MYYy4qSL0VDmoArj5GGWiDKWFao8X+kjlMUqWkuuJQpUPF5NUeoKXQyVEgIMGBiCF2vRKMQs3EWN Rv1OUhXxlNUzEIuOUQNR6nJxSSso40XGJHOjLTbN1dcWgiwf7dkJvjuXkrIeaW3yeEExEiSnMlHc VOqigMu4sK24yAys+Cy2YY7f6MhVSbQnnllgYu14v7L45ObUPSjyBJOnrp6o9qIoo0uF8YkaRSuk lBatXTHvSkgQ5OXkfBRzbh14MzrY0PVYR5ZzWmbAMgM3ZgZEzuj8E/KvELkI5LXIPFX8LBE5ympJ d9pQLggWiVGgqU3etFLq/F4imCJT7cXxosIsoxwpokgRkWcvJFOUHYXiMVP+uYgPxfMU8iQSUbVj qLOMMo1F68pYsKPjIdcJ5NjsFAsaWBOluVriOJm8HiXbVVGf6ALWammlABwJU7Al3mxLy5fecSLj ifxlbZS1crbo0pUQpVR0hoPA0BLuVTx3mxymhRkJ5VbCzwzURwZGPa3LGJXkPRbzfkQ3yfjEMLCi /JU5EidHjYx/2xK3wxqZ9Jt8ib1COHFW34t8t0cOZasKNZS7UX/n6V4WwBeFLor9ehc2mVSjpsBF 2YjyEqVORSBerpGWlD0nopBwfnKTDlTWorTzDS4Mm/PhMrctoV0rWltGPswCTqg1F4w1J8sokKyl DiyMo7UlzDw0C524WIqoXBXhSWkuz+3KhUPAGfG/CwizSmUkVH0GSXDzx9rKk8cqVauKHiTHb2BI WeamjBWcxXlskaAOK3VIY4ibhXwFxEYn1nqmHc9XytYIxovKbBjcV0ViHHNJNv/mwy8VOFvJsUtC QK4pjEEsuuCDFuVLa0O7JpUzlxNT6GLusTKdY7GhgpSXR4W6JJetFLooaVmEtrB34RHcwSDwjLK4 +L09X5pCLmCaQepYnkXVFhiZRrC3dpYYhWIpsrNyU4YQh8v7pqK/hop13XeX89rKsPmoCGSnNjlc mlPELtOiCZbNMgOWGbjdZ0AnpJL7SEtLZzfNSbizlVZkSCkdBeuyZHqebPuichIZbmXwgBNTc8WU QxKltiKEajGBvgopTz0YJ1d0pRQ6mU5aCtWeirhY8N3paNhQrqcqiNZSyn8tBVpEp86WQkUMA1GC Akctgs1aopIqIqgF+jX3TI9yar+p+l/lPGp87OK7aBC1WrRSVFGZOFJ6AFQPUEoqlWNQZ1O7Uaar LLgmAbV7F6dNoqPap7p+Mxd9poCyyWGScUoiWRLAWshe1TEpqa6F9f/JdtWs/PUMw19206LIlfUk KkieD4uuqHhVPRYVWX4uaUuZk2CBOPPR9HppsdkwPCFerjxQGwE24YGlROAR6D8DTUBR8sX8sTdV 4JWIRSg1a7zTAhapObI4Tnm2VLD24i2rjDutQdLj2VLhygPkJTjHQsAi3jqz4rQexQOVXnYrycnw f6XCXsZyRZa3qadtJEY6WYbhzIMdaHaKjhYjhYczfEMVR9AayWFLOqGkJJdOLYtGOF4GqdUykJeg lF60UQgLJMzP8JFYhsWcG+lxlIIzUfLaUpL0gIR+xNOXnLYwwslxMhQxELifLGA1j0JIQHXOxSd/ i4Gi7oEvmqxDdazprPJuqGev2TPXtKnxmDS8zoqoK3zz767pZJadLDNgmYFbdgb0NK04fwWUdz7E xYiPiUQhi4xtyC9htAqg4nXjv+SmkMhpCV1qyj2QPMVeoo2CjU4PQOqU3YtF9YggZfjciZSo/N2O AoklzVounT8FPFwpey0hTiAtynIKPlGkmuLUao9MrNlKEIk8l5og5VooGVbufvzBvF5eI6X7yHrq Uw7SI69XO4E5e5tmGWjGhNr0/LnJwKg4XruK+n8zK0KMnH8QdS8//T8vtfuHS1AvwBBQAiciDmmb UIOWMqRSQFx1T/7NcDh73Rw5X7bMfRRLvkQqwY3Mczj4wlUdIw/ShkrbgblhWjusEZN6Bapjgtto Z7WjIi3IZ0idHrWL8kZ5HnrCRoIiOBF0RSsx4M5UogX5XBxyHmoqO/aXS/hcvisoImmJkywYOakG GCDhFysne56TIW3Bg5f4kmD4ctzsbEMOjQIXnkPC0zRL6HXnydKjsmWOh+kCKY+zYaWH/J4vtK18 Kezt3VVBnVxbVbmLccIiOGWUctOO4hKmcSFpBMXTq8LmsqQ0y1WzWuUu5ZxaK4pEQlj3wTnQKi41 fmJzU8v0CCz/WGbAMgOWGfiDGVDomZQdUvwl1eZ2lM8GZw9GI9ldRLnnKLVPkmekQpf6NiO/t2aU VYBgRCaW14KRAVrhWdArlwi6yCkdeKXcSVBuLh0ZYbpUXrt0NGksm+ozk5JXaVhRleKAq1Sl+eAv ++OKu6r47uq//dmxJkeo/Ixm+5a751cer/1d/v/lX2u9//90u7lKXTdqeCdOzm5kJFtFMJh9hCGN QWvC9Tm7WmHNyiWwcvVB/dq12H6VjKUbt6BGg+bwYT+iFRXs/Hnf40SKtHiVoUuHRBw+m4Ig38qI Ys5n4+o1iKhTC2uXbUV28l72AbLNYsgYeqgssEg/jZUr9qJ267rwJ1b6nm37sHHbFhoMmQj0j0WX bm0Ug5ngG59gQcjc2SuIs14Vtes2wvGTJ7CIpAXBkXFoQSAFKxoJyacOY+3RTLRrVpea2Aqzfv6Z 6HGXMLjvYN6HMzZtWEEwmL1o2qY9CVAIdEAdLy1oqtKdxovQve7aeRyV4iPZbZeHrZtOISIwGOfS TyCmVi1lVOzZsRObN29iyJ/RBSr4dh06ICo0jFj0eXAkEp+yfQUUif9KNaeE96VNgqtfPiFU41Ea Fx4ICPFReSWtdU69Bv90HVmOt8yAZQb+azNAOSSiw4Fp0qP7D+Jo6iV0IrGJHZ2MfZTjYZTbZ5KT 4RsXQSx1ttiyH33aT7PZasu2XkYlnR3d0LNLZ9h705mTziIaAkoZizZnhJZxSxVHVWFt8cilhkrc IQm5E1pVQupKhppC5lqAUcM/ucZA4//LJ3ZzlbqKQfAxMJ/909QfsHb9JjRv0QILFy4iklsMokio 8sEbrxIcIBS/TfsK+VnpeOrJJzGJYP9BnlEoTM/Ge2+8iY5DJiC+Uhi9Wwc8+cRE/t4Ebz/9JD56 900Me/IJItV9hEdGdiOT2hbseu01vPvKszh8cC0eefhePPvJJAyiAp89Yzq2HziJ0WMG4KMPv2Of pTU6dWqH9KyLeOEFAgREVMNX33xJ2tZggrtMo7Isw4zpC5BHnOOG8Tbo0akX0qzicOLQcsz84VPM WbyW4Sln/GjlhdZNq+OHadMRxXPMIYVslacfYTTBZK7yCcj9J188gynfzUTvgd1Rp34QZk6djf4d O+K3NTPxFBH1ZKEunD2HUIcFaEAQA8m+ZJOiVqhbHXnfqRdT4UQGt81EWvLx80NCtcrIupSB/UkH +b4UkAKwDt5//33EhCXirnsGYR33c6AhUK9BbVrUejJImbjq1bBslhmwzIBlBv50BiT6J0qWxWWr 1qzHL/NnoCpx0cMiw7B41i9oltAAS9avQacxQ+EXH43j5K1YvXAJ+g4bLtlNyh1HxTtuxzRjCWuL rJXSFunDMndGOkWti4ooEXAv7qeClFTmkh/9/quv0Y4U1v5B/hU+MmPxqvZcJcz/u47KzVXqYlHR tSwhmMr06dMx6s4xVKSd0bV7LxZWlGHnqt+Ucj9V5Ir1O/ahBuk8Pb19FXqbbCUMdfsT2i+xdm3U qBwNd9cixFaKJad4Ko4fPQ4vL0+i0ZUhLNwf3XoNQuOWDTD83seQkV2Mteu2YODgbuQ334ABXVrS wy0lAUoskX4a4dtvfibme5q6xunTp5CcnIJJHz6GRyaOxZbtO/HgvQ/RWrTHPfc8g/PnUrCr4DSB FarhVHow76UMGzdsRJOmDdCwbhW8+ckK2OecIrvaWWKrR6BflzZELErFlMkvM99dRBz5UIwfNxCn Thwj2H9j8rtnEsvdA660YqVK34YFfqqgjf8JN3u4fzQ5i+so4oK1ZA86dewY2rZoTXa5X+Hk7YnT h0+ol0wgaZdM/xVJ2YRJLM5FYU6qypcX5hvx3Ve/4XzyaWIps5XDzRk1q1VRnryqL5B8VEWSyiLV LDNgmQHLDFx9BsQho3Nz9vQJhs+d0LNjc6zdugd3UKl7k26VOUk4M/dppRwYUdY2iImIQq169Rhl ZUEvFfX5s6exceFG9O8/ECs2rMMFRjcHNGuKDz7/ltwdx9B/5ChUDq2En7/+HtuSThFp0wMd2rTB l19+Tj3giMjYaMydPw8hYZEYPHiA6hoyUDbeiC6uW3VZ3FylbnrURayKlAZ/L1LeyWZvqgJfumwl KsVVgTer2VcvX4bEu4bToqMlwII12WyEJCAni7zjn2NrXDxp/7opzttWxCLevWOP9mBZgGbNCvYs Iqc5OLkyn1OIw/v2YeueA7j7wbvw+jtT2W95HB6+nlg+ZzEjBT+hWkJT9DWhIQlEqoThC/I5Rhaq 5XOsotB/+vEj7N2/Fw89eR8iA+3g4+KFR15fptq7i9gHYc18vJHUfHlcvBnJFxEaFYeY+Ep4/aUX 8einX6NXz17Ip7J1dfLj4rbDb3MWMJzkh1NkIqpU6X4FxKDaIgzO0i2v7reQ+fO5ZAvacXAvXAmb 2KV7d+wgm9FmUhEGBHhj9uJFSKxWi8xrZ7Bv7xFC4pZg5IjRyCHt337y0Tdv2hzhAZWRRojFnPxL CAhiKJ7sdZpVq9UPKEg4FUG5VZesZVyWGbDMwK0xAyIkDNi6cT2KWODcr2dnvPjxYtzRt7PKbZew Y0cgv3XUUCGS2rx+I9LeeYdFdKVEXQvFqD59Sbq1HS2pyNdt3IqqtRMwe+Z0sqwFoFHDaEZHf8A9 Q8di3i9zMeDBB7Bz9UKco3Jv1qgJfMhV8fUX32LQsDuYEk0i0VUmPOjISXG0XPe/ut1cpa6URymc yGojBCIHDhxAgwYNFQOat7MBqzduh5vvOaXMLqVmok+fPjDQ8nOXcnhuqiqdYZrnXnwZIcQ8RymZ eTKzEBcThT0rmZ/fvQP9bUewAp0Fd17OSCIWcBihBpOOHcDKzbvgyfzOnm0rSA5Ql2FtK3Tt0hU1 aofi8UfeoXcuNK3p9PRpaVKJFxJmtZAsPxG0QpetWYZvyX/++Zc/Me/tTSWYw33zuZhyVR7Ix9MX WRxHdlYWPD3cEBXninMnU1CfbDy/fvcNUi8lq/BUPlnZfHwC0aV9c3h7BqFyjQbYs2cv9u8+qnrA pffTKE2cJg0rRSb3jZ+A2s0ala/XTevWkZhlJh556H7MWz4fLsxd1aiRgMo0IE7v3K8KSvJzadgw iS/jyXHNRM3aMfD0sceyVSuwcvVKDOzTW3UdaF66KRT/X30jLPdtmQHLDFzTDFhJCzDl3c4d23Hy XDqOH9nOuqSj2HegO2t83BRuRgFD4tIEJltuZg5z6N0x8tEHNPnNH/Hha9dOxMxpPzGy7okWDZvi 1W+/RLo92TkP2CiUy1wWLcfHVUUb8mYk7VqPYkZofb19UI203BTQmD1nNvwCQhRUq1BS27Ln3BJ+ v6ZHeB12UoVyWjvX/Q/ch0mTP8fBQ4fJtpPFgotE5oh98dpb78CdiD3j7nsMOw8dZ/7ZHu+++Rrc vQLQv0cLePm44eUXnifdnSuG3tEGAbTwPJlbbtS0IZat/hW+tNzys7Ix8dknkE4PdRR5bTdv3UJG nVF4+pEJaFQtCuu2bYJvMMlS2H/YrBl51hMW4rvvvqUHfwyj7xxC3vK2HN8ERMeFoG6dRAwaMoD4 8dZk5PkCzTv2RKt6NagMbeHhTjx5AuP07jsQz73yAraSs3zYhFfQpJo/Fjz3Mh649wH07toF9ckE Vy+WlIO8oi09+tXLlqBnz74Iq1SZ1HxV8O1nU1lE4qoMCmcntoiYFr/8++FHHyJg/hx17JChQxET HYOdmzbz2EgaPb3w66z58GDHQINGzeHi6sYQFVHzqNAlVBUUEYkNzH1dTLuAg0d2E6TGSPrUKNOD FS+dD+R/aGe7DivCckrLDFhm4LaYASK40cnYT7rsbMrXT1mvI6RVP82YRUbMHxHs5I0IFxKtqN5z TamLD3ecVNJ7Dh1EnvB7UPfWZKFv7dp1MeDZnugycjw8GGmtVrMWzpf5o33zaKzbfoysZi7IzMhj 1JNtbmylKykgLSojtFI07ODkgqFDh+CjT76mvE4iS2RlUwvvf7f8txwm9noDzujrVI/q6v9KmEZA VBKq1cRLL79M2tBUhAQHUtmVomH7PlTQHnTm8+kVf448wrq2aVALuannGO6xRUiQN96Z9C0upBHU gMVgwQGuePP11xh6cSGgixXqtlwBa3KfT5k2FckZ6Yo+LzzYH7UbNYbByVfl83sNHoTW3cisZufO 47Q2iI8/flfxqtuxwtyOUYF6dZujR/fT8GFFvT3AEaXLAADUaklEQVTP8fXnX5McJhe55Cl39/Fn eL4ErTp1Q502vVQ/eQItz0mTPqNnn4XAkBgWhRSR//dZ5ulzqETDBYyWFqYdecfFKy5F05Yt+bu0 rhUwjB6ICQ+OV2i59jRgRjccrtrVpDlt9Phx6HGpD8EbBOO+DH4MnVeNr4zGDeurfHnLFq1YjBcH J0cX+Pj7YvC4oer+I8ODuHdD5uEdUL16LbiSv/3suVrkYHehEeSnATJIt7p6KBpKnWWzzIBlBiwz YD4Dep+69pkURBnIQEbZ16Ez7NxJtczPunfpqJgZ/UgOFRoejnouRgRS3kiGLzghGrar3Ji6nKrS lAZ61EFDhiCcXUSPUT7GJzZQhW59ho/GJ1/PwoyZ89G0dQcEBnugKfP14oDXrNtQUU7n0YnKyyOG SGEeZsyajjatm6BG9cqqHU6D6/7vbuUwsYpyUx7VDRLoFZOuquUUuo8HFbj8aKqlDF4e8rlgsxP9 zcWRCHDc2A8OTxZhmCw/UT/R2iHcNMR/KfgSEBYn9npL+7a9rzO8fLV8vSxMd4a6ZVMENkQ9cmd+ Wt/kM0f2oTuStF7fX84ZxgWqH+PvxZA75EfbBG/dzskDPk7aOQXQxcdPqjKp8JVCtuG9eKsf1UOp 0g78P0WaYkW4RScN9EWAY3hDzm48kWmsDrx37dmQeIB9/CHOYeXX1fexZkuJtg/Zh+iN6+N0IHqT Oi8LVbSCUBmXp/o+Kkrz0GV+y5+FSZdfT/ChywZv+cMyA5YZuO1mQJcPBcyL12+gpQJ1GeXq5oYR gwaV31Nw9ejy730iAvAsu5mu3ERG9mChnGzSd+7g6sVi5DvLdxNd0L5XByVLG7dqpT4Pj40r/75H n+6aLBNJpoTZv9Pvfds9GNOAL6Ne1W/iRin23z/cy+0r9ZB0QJU/aFGoOMK8ussU7tFQCH6XXtEX pbpP7mN+VfnsSqVm/vfVvpdIw2XnlGVVgQtYrlD/aH7/+FjtPPrz+CNle7V9Lh9nxSL/3TlM83u7 LmDLuC0zYJmB6z8DOkiYLosU/aqZA/hX1eZ/9r3IT327WoFbOZeG2X5Xu2ONr0K++XeQ2a7/rF6f K9iIhSUTrpO63F5e2hVhYn2RqTiy/qNP3H85IHN9Fo/lrJYZsMzAf2sGdOUuaG7nz59XaJd6lPe/ NRO37t2We+rysKSq0By0/0YN+2rer7lX+8eGhrlSF6WtpRAuV+gm8P5/CEbwR2P8+2O/fHb/7Dzq jq4SQbhRz8dyHcsMWGbAMgPmXron28mE4MqcV90yQ7fGDNiYh0VEoRewsvBGbubFF2L9yd8yDsEp l0UkhoYeSdD3le+K2atuIyxtploAYS9TXCTSoyiYwDyHtghZZcnctXwmm/k5ZEHq+8o1rhZm1xey fl6Vh+eF9LFeWYugn0e/vnkEROcklnHI8XJ9hccu/O2me5Z95HP9GrKvfi7ZT3ra9RfJXNGbh+D/ 6vnp96Jf62alW/5qnJbvLTNgmYFbYwaulC+CZHmGmBqi2HWnQ5ev8u+V8vLKu9Bl1+Wy+s/vVT9G ZKbIQH3TZay5bK6Q/7fG/N3IUVyWU78Zwl3n6ZWHK0qmiD3puvIzf1iCIicPSleGmjEiClsUox3y CQ7j7OyqKtFL2aolmO3ynbkC048XQ0H/3Fzpmitwc8WtKz9z40IWlShYOY8cJ3/LAtfDUTJOuY4s QH27UuHLPcnx+rn0hSrn0K1gPdxlfu/6mP8X713OI2MRo83R0VHNs2WzzIBlBiwz8L/MgMgRkVvZ 2dmUt86IiYkpl2Ei80QmmTtWIrd0BFDz6+gOlLkj9Vd5eXMnT9cRurOmy8KbEWn+X+bvRux7c8Fn THeoW16iJJ3YMiYPJi8vTylwXVHqHrYopMzMTFaMi0IsZi82K8UJmuLo6KxaHKxJBGBrZ00lT0x0 RwcUkYHNUVWXa96xHCuLTBaBXFeUm5xbrq0rYNkvIyPjMgtU0O7EOpX95Xt3d3f1t+5p6zz0+mKT +5BNvw9dkcp+hWSk06+raFE5DvmRccjfcqy51am/JPoL5eAg7HCkIqQhURGpENY3zcC42qYbT/Ii 6saDXk9xe9VR3IjXwnINywxYZuDPZkDknMgykUX6Jk6MbLoSFzkn3+tRTXPn5spz/5nskn11Y0Hk tO5k6U7Rlef9r8uzW0Kpi5JxYc90UlISjh8/rtqtgkNCFLa7FGPIg5Qcjvx94sQJorD5aB4xWxwO HTqE9NQM9oSXIVYAXah0nYiq5sDWt9NnTsHL053nPIkL55Ph5uaOmjVrKIUqi+j48RMIZk+8GALJ ZBOSa+Xn5xPdzgfR0dHcr1h9l5+fh507dyKUQAnBQYHIycvFihUr4U1gm/j4OBIOaPUIycnnqezZ lsex7iMUrdDJVq9aFWfOnsUx3pe7mysVtjOCgoNpaGiKWSpI5d9jJ47Dz0fDtb9INDsb9rv7+vnS sy68TOEfI9a79PLLwhUFnZCQUK7MrUwFj1JBKtEKaQGRtISB55L9i4ixn5ycodoGxcgoER576QKR FMYNamW0iErLDFhm4P/HDOje8YmTJ5VMcScAmFQ1JRMxs5TpUcH1uFpaM4vIloePHEYx5avIYVce V6VKlfIU6dVmRw//S6+SahvmTzHlly0jstK+VMq24qJiQc5k0bdJDv7/mOX//S5uAaVephT6xo0b MXXqVIKvBOBHIhI9/dRERIRH4IknnuBDd8OXX32FU0lncM/4u/HBBx8oZXbu9FFMuGccqlSrh7Cg EFKmBuKhR54gTGp13Dt+FJ587FGMHjcOL734Bho3aoijRw8RMa4lJky4Bxs2rMWQIcPIXPYRunbt jLfeehvriUvcoUNbjmUTHnzwYdSrVxu5edl4jcxuKSkpxBV2w2NPPIUfvvqOi3I/sduNuGv0WNSu Hk/kuTtxMuki1hJCdu3qlUQ4mkwcemt0692fYwvETtK6bt62Q+Wh5v72C5W/xi4kL8GRA4cwnud5 76MPCIcYjxF3D8OAYYMVPnyZkZjz/E+PMjz//PNETaqqrGSZq8jISCp3Aj8I3jwRa4R6/cLFS3yh PJVBUlpq4Et2Ad40GNLTsvH66y/j6aefVmhzYhx400ASQ6JE4emTid2Emfxft3b/91fJcoRlBv5D MyDdwnQYRLH379GTcq43Jj7zNGwp0O69+14405n68rNPNRlHhSuOhc4psWTRIkyZMg1169dRyjgk NIKgWIR8FQkk0car4LaLMpeWNWvhluYm8jArPQObdu1Ag2bNCBduXW4UCL+7ttd/c7sJSl1vNdOq 1a2JqmYk4cpHVGhdunTDiBEjcPjAQfgTcnXP1jVwIwhMNsPqW3cfgKu7J4rJWkYVp56WY3EWvEg7 eudjT6J2WCCQfQYGexes3XEcdxAG1aM4G9nFwm4WhUcfeRSHjuzE00++RmU+BNt2rCXOfF2sWrEJ nTu3VyHx9m164PHHJ6B/32HYvuUoGjeui6PHtylM+m++/hoTX3wQv61fi/69BiKqcjBGPfIYVq87 ipTda3Bg9zo4+LeBDZXogl+noGmLFmhQJRyv/bgSs758B03rV0av4Q9hzD19YF9yCZ9MmidgcrAn GEyNgEhEO/oiLS0LmfSkwwzuSMnKwdzly1EvOh7L1q1Az149VTQgnCA4zz77rPLeJcLx+Wefo2PH zrhw/CKSU3cSKS4f+w+dQpNWlVGnTjO889Ys5BtPITA0HE2rt8AO8tFvWbUJR84kITM3E24+fhhC VD2hbxXc+jKxChQ6jmWzzIBlBiwzcPUZkK5hawMdgaJ8NAqPIbfFKUK7FsP5ZBbcrAhtHRiE9Tv3 ID4oCO6+TnSiDqBSZAh8A3xRlJONUQPHonP/tuUnP0pWTWNBLmLJdrl/727F4BYUFoqZP89iVNEJ 3XpS/mUX4ejWI9h58SAaVqsNq4uZePPF5/H8l5+iLLMEO7dsQkLzFqgWFwkbHYfmP/gAb7xSVz3k LHITHFT5jfo5NTUFecyBh4eHKeIU8dDtDDlYtXQJGtari0wq5pWrV6MHPVfafIqFp5ScurZWRhRm p+EFcqjXiw/C+H6d4E/vNdwzhEp2J5zoKZfxAjY25BsnIUwgF5rQCBw7dpjh9F24a8xYfPHZjzhx 8jDhaL3IgPYLlhMv3tMtDF06E+6QSlQwhotVpaUAqTJMn5ZJhR6OLWsWYvXWrfj4pbvQsBINh8Ai PPfRCZK0FBNiNgsOzOeXkfs8OzNXHT/3h29xmhSu3fv2hs357aSMZdif5yvxFhi6MsSERpIUJhuH aNCE+gTAl9/nMvS+hVEDP4axJFwu4XZJP4xj9EE86iZNmjDU78EIxFFkX8wlnepJ7Nl9Ab36DMXc ZV/Sm/dg+L4Mb3/wFl59813OqRM52nsirlIM1m/bjtY0ZooF0IFdBII6J94+2yGUZW1hafsPSgPL LVtm4JpngClHFiKXMYReOTwa57zscIy8HZ5n85GYUB1p4W5YtWMnzu/ci2a9WuALUqe+8sITPHsx iVfs8OnXn2HF5qWEvM5DIp2PylGVsHTedDz50guY+uMUtO/QAdtJyCWpydzCXMyaMwu1o2vh/Vc/ QOKgJpg+5Wf0T2xMIi9fbOF++1ccROv61bCQfO0hIUPLEUGv+Xb+H+1445X6FZMnsICSh3Ykw865 c+epiGxw6WIaHJGLjZu2wN7rLNKzqBitbNCuXTvmUKyZJ/dUBRh5hFUVeNZ7HnoMzauFwpbc4TlZ GWjeujPObP4ZZy8mK2x1g6GQEK0BSM04ST52R9L0HcKmDXtIArOA11iFbduaq/BQC3rXLu5lWDB3 Dbx93VjklgMPNx/qPBvY2znRMy5FgLc3zp06j9defg0TH3scDRrHwbUglXjHrM4nIYzwmAu5SxGJ B1w9IuDA+7FiOGjF6vVo3KA2PKicL2Tn4whzSsS/hYHXCYpMgBOxkyXXn0QueA9fb17TihjtHqSc /Q2DRg9RoSsp3pNwu6Qk5P4lbbFv3178NG0mgv0jEBFXGQuX7saJs0dZExBHMhhnBDIS4CDtgUUl PH8eUwYFCCf5S7ce3bCVoaszF1PI6BYLJy8aIVKJT4VuQ2NIKXaLZv9/9KpbbsUyA//iDEgNDmWy sZCiiTVPlRKrYc/S1QgJCEbVavFYd+4gOvXriS1f/4TlK9ahYfMmdLj8OADitbPep1e37ug9pDsd nnw6dqw1Is/G7q2rMefnX+BPiO2E6jXw1oh3Ub9+AxQUF+JcygXEBsSgZp2amDBsBF6c+Dqs3Jx5 rQS0atQMJzafwOGkE4itWRPOIoNNaKH/4h3fNqe66UpdMN8l1DLwjoGYM3su0tMzsW/PHjSvV41s Yll4+oEnCIluhyefeZ5UqnuQm5XJUPgXCCOof8O4UBTSm104eyaOb/NAi1pVWLRWRFYfOzhHxmL6 rJ/g6e5KfvFD+IIhmqPHDqJp87pU4pupyOph5MiRsLYrwMJFixHgGwlrGgz33ns/5s5Zio8/+QhJ pw8z7N1JFeA99/yzVHF2aNmgMR4f/4BShnkXkrFr82GGtelVk7o1rzCbRAUlaNOhI76fMhcHyNLW oUN/evhGFr+lMdJQnxGJfLiQmrVRowYkrbFDGRemMTkTpaQpzGfF/4Vz5xBIBV/MdEC1hKpYRwUb FRnForsClUc/yaKUKVOmqDy4FAw2b95cFRj6BYSjVt0G5CM+yJeGlf383sXFGRlpyYxosCeevPDO jrYoIBnMr3N+xRlGDYIjwnDi9FkU5BXAyostb9JiV6T19yuEXQuvy23zIlsGapmBGz0DRqFppmOS y3qcxJrVMGXmW8itk48q9Voha0sSKvkFYkVWGn6YvIz1QpNNVKvs/qHMtrVxVAVyxlLKHP7YsGPJ PygY75Jr/b4HH2RRsTvlmx/iK1dRtNznzp9j5LQU+SUFqg6J5XLIJJlLOlvrMjLS0K17B1jTo3/7 +58Y3a1HFk+NH+S/uP1Oqf8vICb/xoRJFWNhYRE6d+rMMHMATp8+h7vuHIMALzKqMUxcu14jlJA6 9I0334C0lb31xms4z3ywNReUp7cfnn/xJRxKy6MySifzmismPvEIAoPC4F4jEDEJYfCMjGCh2/NI PZ9DLvRwdOxaE/v2HoOPWzVExfjj3vvH4OSxs3B1CaTFyIpKKrWPP/6AofAceu/1UYljqFqlHtaR tzy2Shx8XFwx6q7RyMpJRgYXtL2tHQpzs9GwSWu8E9UFeQzZd+zcjQrYF6XMWdfp0BUFVOSPTXwK HuEaLaAzGYxq1Y5j3octdQ5WyPdIhd9ADxLPuKMgNw9OzMvnutgoL7xmYk0qW6nAz1f3P378eFWp L6kBCceLx/7YE4/BztENbiS66Ulu9EP7DiKhKkNTzNWPHRNCPvUsjBg8GMGBUXB27Qc7B2dEU8kf OX4Mo4YPI4tbiDIiStgiKJF4C0rUv7GyLeewzMD/rxnQi2eV0S+AXqBHTA/bNdAXUUERqMYCZf/4 SnBjkW5kUACjrQZUrV4Fyw6fZEo1GNTJkuVjfU8YvvryK+zcv1VRSPtTjo+75x60aN0ay1etJElM QxU5HT1qNKbPnKFkZmdSVgcGBiAkKkRRdvkF+CA4Kgwl66yxY8sOJB0+Tzl8CW2aN0Igqbf/y5vN 1ZT4X4EA/KMJY0+5llPXirHKpAWB/0nouWHDhqxOt2fomq0OzLUEhIYqelNpXWtQp7ZqwapcKYoL o4lGxJKdgdCYKqhm78gFRtCZ/CwEWbNIg+1tTlxAtZu0QkaJNdq1aQlro8aAllN4ivy99VBW6MZQ fTHD8j7wbxDC69lxTEZ6y8VsU4ulghd4OukpZ/je1Yj+A/qAHWHIIyVrc4bpYVuMIlKjFuTRZixI Zo48Aj5hfvSIc6hwi9CpfTt6umWgvcFbtUbtuvVVbUAJawGMVg6q2pzBbhTlUsm7O8PPwx35vH4J 295ceT+XaHXmkle+YV1WiJrQ5mS+JEVg3tMuvfLRbAEs4rzmFGYhji12iaRXLaSRU1pYhri4IN5D BqqQorWI1frVa9XkfEqViy051+tzPyYNqNDlqUg1q0TcpQ3uZgAR/aN1ZTnYMgOWGbhuM6DjhIhu kMpzaZu1odSwdnPEXQ89QFkI3PnwvcqLNmZkYeSYu1iPdIHyLw/jxo6FG3lTC9j6ywwmWrdti6at GqO4gH9QNoq8sWcNkoHnff+jjzS9QPneoEED1KpVSzG3OTFtKVvEXQMZDS3C2AlkcePhT730EkqZ HrXiuYsKc8hk6a5oqf/L3TuXeermCG7Xb3WYzkwFphq6qPg0yjyGcaigJOciv1tJERxDLdLIIE9P vE3Zigvzy4dmJ9Sl2XlUtDQCrMgaJH3ZZTmwMRpQaIJeLaVyzmLI3spIpW0gihpD0Xks7qBbqhRY USFR7OScVvxhXhxlzqovHQbC5ZbS4pPPSvOoELM5XLEAeb78TCCf4C+GPC4egsYwt1RWRIVclM1T CvUqPW2GhcSiNDDKIPyvWbnE1beyUwZMsRzDsQspq0EUOfP+OawcNTKPLrSxOcx9G/hZ3149aKCU UPEWlSvZnJyc3z0aQYkr5RgM/CkqLeTLUsDjSzi1jAIUZyjjIpc5frGnChgVKVOGlbSYVLAjSeGi jEh7GQQy1xJ7v27vgOXElhm4zWZAB8kS+SBOgEK6FBkh/6No1cBiKTmkZ5x1RAY71kgx3XnhUhpG D2qoutnsKd+0tjYmMg32sGO674823anQYWjL96PIohmg/UkRZuDF1V/UZDY2Wshd3MT/cjmQjQ4g IA9JRyi7rl6aUhpX/pg+Kv9c1D0flWJO1TIo5rT3mqLn4qFSkoVlzSrMYhuCuPAp20lPJH/kd6o1 2Uk9/TIrMRho2hlp8ZVxCYoSl1VRSpZ2ayps8G965lyR/JtKnUcr156WJGgwsNJMKXxRfsWqcp9L h4qZKlprseN+NjRIZNyKApBjMHLxWhupRBmNKJWIhInzvITKV+ODlRdDo34t4e2WUuFKXruUx9kT VCEvm2NWnvPluPRXfxHY30ljxkqNVbDjZS+qaSsaMDQiRLFLZEAMCTV7nDsp4NM2rb1Qo7rlfKuP zRT+1S9o+dQyA5YZ+A/NgOgIc9jXNGJ3CIiW4twwFaZpMpd8HZQnriwyHjRqFDJS0+nI0CkzEu3T moiWpfmsX8ql/KE8LaU8prNVRrmjd5f/UUetkqtyMYPIakeRnhS7hTyPoHFKp5PIbSp5kdnl5F7/ oQdkutXLsN8lrCsFWNc1dFEefpcRmFlUplY3K3rS4iWKYlOerjRzK1WpKXb5f3a3a8qulGEgwTS3 5iISMhiqVRsrFmGI+hLFKSEieslKMdtonnNZCVvI+J2VgQpTQvJlTvydXqyE23m8NK5J4qdMWZWi rHke/m5FE1Q8XPm3WBJDskBV65cYELRMeS65rvwuSlMtK+aFDIJFL4hutCiteS/KDLCy5ykFUpHL mIqYKXT1UkgbnKAkGVgcV5pfyIp76cnXdK5OTiNzY17Apitvoi5zR6n6lGml4pZ5lrdDv385TsLq grbEaxqUUteOMpnPvF0ZE8fK75XRYnqH/vC1uGwHc89e44DXx/bfe60sd2yZgf9fM2BOpiL6wZdg VhJLz2GovYhyxUi5bc8C3Uw2iNvyewmWF5YyYphJlDejE2wcsinbKA8p+0qMOfTuGUFkFbxVMSG7 rXOpkMWJou4R8cXjNemv/VuxaVFba6schuQZtbUWeZwN61IHRkcdYbTLhDXTqAYjz2NqmRYhpDup V0PfkDOaf67+Nv/wyh1ug8eqlLp+0zr++fX11M2VuYTAWW0tClAhldK+U8pGdBNzvcz7ijK3Y0W7 TLQUzKnAMS09CXlb8e8yPl2DwZkWoMAH5rHPmgqT3rYdF5joNepa/s1jrf24PyFXZTVQURczVGOQ Yg/m30tsnKhIHajsuDB4LSsrVy40nltC9kqjuqK0xB02rB43lhVwcbqyelNGlsXFzAVbwpIQKtJi FtrZ0ds3UCkqr1hawKmxi1nZ7iBISWKs0EBwEox38Z4NEoUQBUtvnwaCKH47SUcwZ2Tt6KXuVSIR EpIXgB7w5bCyFi9cyFjsVQGJDXP7KBP8ZZ5bvH6JXEjOnkV8XPPKBBKTSP6TuTYqM5jfKWtWm2u5 x1Iqf6ncF9haa7bkySbsdlpKRlvJ2pH6bzIqGZ9J+VsxXcGXSQwhK1recqwYGde1PuM2eMEsQ7TM wP+HGdC5I/R/NRIqyh1xRuiESLuvFeWfrXBvUJaVsCrOijVHtiJPyuhN09lxcCTxFlOLtiwutja4 qa4mgz3lE8OUuqMmiHFKI1CW2VIfSJutyHEp9xEBJDKOsGMm+SV+m72JrZMytExw4fkj0U6RTtxV mDw11ktB3NQNBMo1cXJ4phLhABHHR4wIFiSXsR5KPH0W5PMalJ5M04peunxTCsokEU3fXM1iuEkP /nfV79ddCEtkWqkT2WRi6anKpMufpjBzCduu7KUSvVgUlDSSiVJjyxcVoi2VshND4aUMq1uLtubZ iuBCxVoKBwLWFDKkU8h9XcVC44UKbWS5SJ6bZ+EDgzFNKbviEhoCVHI2ZXl8aELl6kAvX4wH5qzL vLkf898qZJ3PXLmsJhbgSVie+1gVUfmzwAwuRUyts32OAC/W/C7T2Qh7FsC5FNEgcLRmXp89mFTE BVRwLrxWIS1VceEdyvKZo7eFrT3viQvHSXrpWYVXzJfEipauAxdVvrwGvCynQYWmJKxupKI2sjHU YMvfeV1Z6CUlObwfe+4tYXfxzLkPDZpSXrOM/6qPeBIjr69iGbLglecv08+og1jL3FciHRLGkocj +X717ihceg220YZGjLJ6yxeqFqaXYL4ENQxMZxhpQakxck5trJnGUCbv5ZGFm7TOLZe1zIBlBv6F GRClLs6fwGanMaweEh5KZa4pvyLKRjc6BKy+Vj62SHlRmKUis+Cu4phOkm+nJLKm8yO1ROI8UXvS AaKM5zHitqkQPhWpHeWHgTKqRBXuUsbyXCVKATMOQAdC3B1rQRhlitNIoWZvcOHRZM4U+mqRdxyr YsoUsi4Kfc0wkKtoGtiK8qqQn9uxeFnkVIGdtALzp9gGuZSxdjQwrBkNLlMHmm9yvK7Ftd9VhPcW 2W54n7r5VJh0kJoeqQa3lQcu4WFboTBlPyLbuGzYm11Gy66khJYbQ99MnXNpMI8jOWAJ73BfUd72 tLJUyFkUoXCrs2/cyl48Yqo7LgDxgAvEdTZ4UHHywfEYG1H3Ck+QirqUx9PiFEVmRcUklqetnViK wuduR89csuw8iOewpudtzc+5RHk5LmJbqepkQVsePXKhkOXCKKCStuV+cn3eARceqVmZJxfEuVIx NKQoTrGq8QWQiIFUlVJxiscs91axKa2uvHgrGjHWBuaSqOCtDQR+EOuTkLKyJgWZTzNmubxoLbPt E4WkoxXFLS+hFANa81+tjMTMrFQhEk1hy3gUQYJsvKZw1qv5UFz15gpd+1uUubJwlVEgBoB8zlkl Fa5KZfClkPuzbJYZsMzA/7MZ4Gvt6e0J/0ABlNF0HF9/JVl03HVdFYrSNSjMdkGhE2WrkbBYU6FK 4FScLC1SKIiWRNnUyqiUDNM3LUqo1R9pzqC2SUSwjJFOcS+srTXGONlHl6CaTJRsfYWXXqGQGUXl 93q5nko+ioPFX/Kk8I7H2Uka90qdfos/yhuu1H83H1JFKdafcJFTqWRl58CRLGs2tOCc7MiSRqVr pJISBWZLxSihkEJ60fI4rFnpLaHlXELM5nPhuDkXU5E7qock1fOibMSAKqRBkJ1xWnmPNu4BXFi5 3IfFFsVkKqPBAHqW8tDziTFfSKpWZwcqTUFVE/52hm+k0C0jPRcuHqLrGCLn2skhMI4VYVcFQU6M Cxu2XDipSnkqQipnmwKOsJjUrPZOHDejDlzUGenEqndz4+Ln4uXCZpBKrS8xIiTPrS1cbVkqxStG CsPtKowtoW0WhZTS2y+jhVlAoBsXIXIppHdPT1yUquQwpL9Tilk0b1tsY5odNFDsBFVO5cDFptTU uoSgFEGCehklJAV2CjBHxu4ABwcJazGaQGumlNautVSqli/u8ldKjVbOZ1T1AhI4E354vgyyv2n+ b7eX4hZ/Zy3Ds8zAzZ8Bca5E1lFmFLPtWByiUsoTcWSEUEVLHYoIEE+dypzRSQc7kVdsBSZnhwPR MEVyGBmlVY1IUrMkjho1uR3lVDa7mkAQMSFqEYdDhdDF+6Y8NlAeltf4ylGSupTuIXrVORmkx2Ya 0ZoOomDGi4duJd49dYjmcJssBlXbRYlFoWegNSLpU/lIgrn2HIMV5ZmRHU1GOlJWKtX6R5vFU/+D mbHCJQKqTPr0M5KaZKj2rKeffAIBfq54/IEHAG8CyDz1KC4SdObxp17AQ8+/hiqhgdTFOcRBH4sS 12D2m7th9MjO+ODz71GjamsM6Nie7GxPose4u/DmS5MR5VWMVKKo3XHvE2jbtDbO7N+Fex98FY+9 +RIa1IjFd198i58XLEJUdAANAOC5Fx9FUJA/lWMhvv/heyyav4aIbXG4e9zD+GHmF1i1eDHcvaNw 98OPID7UCZPefBFL9uRj6tdv4sypQ3juuTcZfcgi2czLqOxPdrdnJyItuQDDe/dBxzt6aouei1MM kDPHz2MJUd6GPfyQlvtmCEnRq8ivVLoSrpKPU9POY+aPi9gD3xcpmaeQdikDJbkOaN+nkaakRUFz v19/WwA/Vw+aDCWEoA1DbETk76xNXS2LQpaiRBuu+OcmPolzaZfI4OYCdw9P3H//fXwxGGdQIfgr zVUJiUlvv/ZIJWf25edT0JnY8uGVmL7QtL2q06uwjG++LLKMwDIDlhn4F2aAAkdQ4Epzi/Al5XbX IX0Q7BegyQJJ25nY1hjAVs5RKRWykLZ42Dlj14HtqJpYBwXECQmPDlL1VKLcJZmazLB+KZ2r5DOX 4ODtgeiYSIbVtZC/BOhZ6aycQF3ulAnUNr37rKxLePTBR+Dkwnw7DQvB4bjzrrtQOSaaTl8enQyJ Hop9INHRCgdFRTsltSidU/x/2gU4efAgnEh77UkHTIqWteNun4jjTffUxfMWS+jll19CZHQsnnn2 OSxeukJNfsqJg0g5f4Ywr7k4RVhWFz7MgwcP0fNmOIcPOjc3h95vGl57+2tEBXtR+aRgP3nMj+xP RwcSwZw/m4S09GQ+1Cw89dQb2L5zLd587020bDoTh/buJ63qJSxZTlziGvE4eeII6tdtjIlPT0C/ vqPx22/zaDCQTvXMSfz000y899aneO/jF7Fm/Wbir4egzydv4fnnv8evs5ejWtAlPPvy2/AMbc3+ S2t89eknCKMyrV0tBj/PnIdWsb7IZm/nfffdi3effRq1OjXDhcOnRJ3CwKiEI736tJQ0juEkfpmz BBdO70CL9v3QvGF9/DbzG74Ex9GwTmciNV3CpM8mwd0xCr5BZfh51mxkp3oij6xvtRrWhCG3FDsO 7sWMOXPgwnb/Tj27IDwhjkbGKbxOJL6q9epgxIAhWPHbEqw+tANWfHkeuuc+eAT5aP3rDNe//ubr JLfxVAt5yZIlqEX++TJ66sdPnKKlbI1p039Cs5bt0K1zK8z55Xvs2n4Ufv4B6NClNr799kvizfsh 4LgtFi9agfDQyqSkHUB+e1anqsiBXnh3m8Wz/gUZaDmFZQb+X80APVyRX5LyPE2GNpHXqeezce7s QSJnRiGE/BV5menYf/AYoglzbeNpwEvPv4J7htyFekSMm7NoKXav2YtHn7ybRcFOjMoSdIxyfcny Zdi/Zhs/f5yeurMKzZ88coK00SmIqV0FzowepqVk4fzFM0QB9UBYWJDaJ5eemI9XIF59+7nyac4l /PWFixcVIZZ4+skXLyAoOBinTx0jKmcq4qpUpfy1Q8bFHGSmn2dBsxFRZJz77JOPEVe/Ce7o3xs7 tm6DF7How8OIuslziAEi0Uu9auBWfKY3V6mrOiqCwfCBJFHxDBw0WFlhHdq2UnP181dTUa9+Q0SU uZPidBO6NUskzKmHyZuViIq0QBTjIyrqyrExGDSgFSrHVaF36Ivd2/cQW9iFIR8rKhqGqwtsUbVG TVqEn+MMec/XbNyORyfei6lzdxDyNYtELo5YtnY5ucbPcwwGNKhfX43hwvkLKvfj7yeLxw5nzp7D ncMGIj31OGFc92F8xw5kWAvGe/TUJ00/TiCcMuLXZ1DJ1uYCCsSp2duQ0KMxbMmz/tnnX6Jrl05E VirGxvXrFXmKq7cX6sfVgZOTi2Jb27/nFJ54dDi+/GEZ/N28sWfnNgwcdg9fnCyyDwWjbasOJLTx Jz/7PLQm7ntRlif52HciLDYMNmlFOHXiDElmmiDMxhVH9x2Gd6VQHF21DqMG3YFle3Zjw2pSr67e iBrtGyLr9HmsXLgUPUcOUPcocLevvPwKPIkpH0XiGGu+uPv27CSWvjP2CPnLuRT07NkbS1dsRCCh IBfPW4Rxdz+CpYtX4NTJJHQiJG5kRDjmLPgOnUmjm5tTgpzcfN4bUwSqxa2iveRWfBksY7LMgGUG rn0GVLi8pJDywQlJ55Lw3ZuzKfOMSLd1xiPjx2LGp++hlIidSyljGnSvg9SUDOzbvJPO1VJkUD6d PHYOc7//Dl7xVVC3Wh1Mn/EdslnvlEpOjRlf/IjIxpT33q6Y+9k3AjGPqKOV0b9rDzz60GvwC3Ik hnwBHrjnMYRE+5L5zQanKftefuF1pjxZw+zijk6EHp88+RM89OD9OERncM2aVYpmevpP0xied8aO vQfRtV9XfPT6JKY3M5FOkLEBXUbSUbpEeXsOn0/+mrjyF4kvn4c77xxFqNtwpZ80OXbt83Sj97y5 Sl1L7LJAjhCB9HDzpbCrfCvFkpVr4ezhi/SCUziybyc6tmjMkLQNnEyFhlIkJ+HdegTwr14lnhaU PXKYk+/UoTcO7tyJrMwMGMnwY8d8ibOrG3MthWRJs8GxA/uwfP1WBJJ3dxdZ2vbtags7YrpHERv+ +MmDLHpzRq3E6mok9szRSzW5hKGLmWt2dHJkxXgxnnj8EeK9N0HHNrUZeC7A+UPHaDDsUQV10hJR wuSMZLSlonwHqQE93X3QqFVT7FqzCHW5SKKiK0kyHfauzqrQT4r2SjjW2sR6rxRLSNeChRxPHBo3 b42ff/mFbGuVUbchsZVJcuDt6QQ3GiyOzHs7k7s4s9iFeX4nFuKxV540s07evvBm/32KewqyCWub knwJNRs3xVHyGGekZcPf0w91GzTC3oL1yD9/Ud1nAfvjvd08EdussSJW8PTwgDs97Dk/zyDrkQNT GlUx57d3+DJIiwgrRslaFx4cjRqEpN25dS9KiXznTIu7UqUI3DFoAH75eQ4NbR9C/9ZRxXbm/aI3 epFbrmeZAcsM/PszIDU0UgAnLeG5hIP1JxPmM2/ehydefgcXzqSgOD+H0ctK8A33RlxsHJo2bE6y lWZYtO47JLZqjgjXKnCxPq0gwiWPXkyil7otm6KGeyiht0tJkFWAVQvWYMy48YhIiMbYx+9GnWpV Sfbig1defQIff/ABDh84qZS6kfVVAvldv14D8mCwMI6EMf6kZa3G/detW48sMlx2JzPcwgULmOpN QbNWtfD5N98jpGqIQuKcMOEe7Di8GxfOppD0qznCqtbH6pXL4e7ihjgSa3lQHkp7XBG7nqQo+Vbe bq5Sl5lhQYIo4zZt2mDevHlKOS1dsghNqlfCToad+9zRCBEEavnq22nYtPcwMnPysWPjOmSlXCKb GYvgCH9qw2prCa/ksMhLiFg83J2QRTz1DevX4R7XR3H2xHGs2rgCRxnOr1U5gd7vWpQ6uJIgxR/x YR4Mtf9KZeVPIpgAvHL/o2jWuBd+nPIjjh0/jJatG1DB+eC776YyPGREbVL/jX9wAvnYD+PDMU/g zKVURPi4IC2DCjP7EpNDpahRox5Wr11LCtkTXGR1aGVewqXzGSoNdD75Akq4eNOZNhCMeKcSD/gR yCGPRC6CbZ+dSQhGFvIVMA+UfP4sQ00p6NqtG6b+sARnzwTj/IWLZJs7QgNA8PGLuM8RKlMbrF+3 FvbnCkkQY82eeODUseOKvSieizEsJBSzf/wR+y6dQ4carXFy/S6FqS8FcMZ8qflkmx2r/3II6Sgl dDZkzcvNI799UCDOnT6NPELTdqWHXpUvSMOGTXHybCqjBV7IuJStiklyMvNYwOfMBV+CzZs2sVsh Az169MBPM+Yz+nCEbEt1bquc1K38wlrGZpmBW2UGVK0ZxYdNsZSqg1TWWi1NPlN5Buaw+40ajl1H zmL9wnVwiNUwLOzYWiwtbwVU5CXkpjDYEJNDinuZnhPlns2iZ2fBvhBDgbl41ZnD4jrZJL9dTMfH hXTbshWyO6pMucxEFGWBs693ABkym182PfXp8L1CfHhfRh8HDx2C5cuWIJMKXnBBmjdriqCAINYQ kUyLOqRIwWs78bw57BYqwqChd2AnHbIFC6ncSQ/eonkzhuCJ+slQgJUU8P1J+dzNfEY3XKnrUQtT N5S6dwF8uXPsGIZFZmLViuWonpCAsOhgjLnnXgwfNkytHD/y9DqRjm/IkME4fuQgjp08i/6922AY wyIH9u3Cfk5+/z4tMXrESJKXxKIWCyRs3croTYZjYL8B2LZjG2xZoX7PuHuZF1+F11t3R7N6NdCs diWs3rwd7r5xBFGgt+nsgRdffBb5BdmKuzwsNBJPPvkYfpo6C/37DmR+KAKxMZUR5hvIsPMiNO/Q AxG+lVGZHuv4sR6qDWzo8OFqQaZnXsDgPp3JdV6CtBIHHNi/A08+9zRiSK5Siz/6ln0ml158C3jH BsLfVzDbDejVsxs9Zn8aPI6YP38BupNasBa9+FMnU2HPQo/4qk0QEhaKZfPXomHThvh25ixUcgtA 7eYNYe3LcPnFFahduS4Vcwiq9+iJDya/zzxRHdRvXgvGzBy4MiRerVZ1FAVnsjKV1flc5A1at8Tm bTsYWdgLB34fHhKIHr17K8PJzcuH6ZGBLMKbTcu1Lnz8fNCNjHCSqqjfuB58Q+3g7VPE/tVM2Dq7 YuHCBSRkSETdeonqNiX8LmA5+u83c9Fbrm2ZAcsM/PMZUBjr0qOu4DekOI3KnZ0vbkzXFbOIefWy +ch08mT6jVE973Csy92LRQvnAm5W9Ko9sXDjz+jRJgq/seh468pNbLkthR/lzLKfmXp09UVElYZo 164dvvjsc1bFW6FK3Sokr4qhg7CbviA7cqhYBQRMru7g6Mz8/V489+RLRK/TmoK7dO6CGtWqqet7 eXvTe7dBx05dVG5d6Krz6IS4EKO+sJiAYlJ7xwp5e3Yz5RfaYsGCJQja5UcM+xIFmuPlxeOZohTg HK1o+NYtnFNK3byyT899/vNH/udn0KdEAQEKYAGF/iDSg5pvsdUbqT8FKbbfgEHq95Y14y7bp1Js TbO/i6hwtCpH2Ubefa/6954HtX/1rWuvoerXEnregZUS0b9S7fLvSolW17VbR7O9Naic51+sph1D xfQwi8vMNyN71uNrNlQ/ck5Z6+PuGV++i7Rb3DlyRMU1RLmpTgiWW3Bf1yBn1A1pob6PYqG6ke15 rVuxop1V5wOGjy4/TtrGevbpcdm1+43up/5+ioaH+VZlvDaXKsPhATxNilr1N0EaGnZvqgEACedw PE0m6R3loDuOuAPmdy5He9chHCQ3I9tXqtWopn7U3xx743Y8D8dYp1kt9Vk4x65vbVprZ5K1daUy v50qSS+bVMsflhn4j86AOUeI9v4KPgXbZD3tMPqJ+2HHgrNaEbUoz8owYfQdTDd60nkJxiFGDMN7 hiOAUdB7HvZHHluBvfzc4eDmgYBn3Nnh5Ilw1gCVUW4GkFrV0cUZIQ96sa3YCc4+HoxCOiL4PmeV Sk2ozWJgKtb7nxiuPPiRo+9UvOwi07y94/Hye08hOTVZS/VxhMHBrINiPvTNd95ma5vgw5ehUlwc xt//oKoBiqxUiVFSb4y9bxA8vNzR3Ls1IwRsszMmoBHhb8U7P3T4ILp0YcEx8+lyvJ20u122BlRh 2C21KsphYnXBe+OLmUw906IoTJ6cmiRT14JaQMyjq8ZEU1uBhFz0oxQWutbsrbq7heVN+0SOkd8E uEXv+5aPtAeg0IgEwr285UpbqAaDEBTo1H0aBam2iDUzRAVd9HGUA7JIH712DXVOuao6h3io8q9M s3YOGa/qkOT/6ShEAuSqjVXtwf8XiFp+JpjKpvNqGlLAbDSjQdt0i7HiWPWVTJVpH+k9V2QLsrd8 rjDstZ50KT6RTaHV82XRrqVuUOXBtds0mV8Mkcn3+gsjp1R/8z7UmBRjk7avmvPbqAVEn03Lv5YZ sMzA72dAj7KVY6ibDHUhURE54enjpQ5y1thRGQbXwvAeTCvWF4x40+bL6B61aPnfUbGaFxDDFKH5 Fskoq/lWKS6m/E9B7fDypDNCUeNKumq1iQwnpnxUdIT6uXITT918CwgIhPzom4+fNl5nG+mdl82J mCSe6rf6poJp+V1BZv/u7LfeB+V86tcdHvYa7v1qmPOXfVaukNUUqwerKXTtb23KVXO3/lG5EjI3 FLShmBTdZQqyYpDm19Uu+/vHqe9T8Y1uMJiuoI/L7Br6uczPZr5U1O9m1zM/49XHYX51XZNfrvfN b7H8WvplzG6tYr8r58bs4ZmVfV42I1fM0XXlD7iGtWTZxTIDlhn492agXNbx/RddIQBXQvmcz7y2 /H5DNnEkpPdJ9zPMIuCKUJODEEdFdEIFA+WfjexaoF0rHLobco//wkXKlbqcSw+V3gwFbx72v5YU gNrHNAGiT3THUGcHMxVca3uYvrzyvH91nT/6/q+O05/LX+33R/f8V8f93ed+tfNer2v93TFajrPM gGUGbt0ZkGiq6Ac3ArMI+uTJkydv6GBVFNTkYknXkJL98mPSz1qy1Ezb/+norsXvvtZz3dBp+NOL KT51XaEXEiBFAPBvtJelEIho7anwhlk/sx7ClUV0ZV5W9lckJGKdmRaaACDIplmSghyknU/fKvbT HpTCL+c59HObGzO6gSPf6ykJPSyvHydjELpa87GZh53le/PjzRXoleFp+Vtob+UYOZ/se2086te+ mPT714+Q80vXwLUYcTI+hctvVvB27Ve27GmZAcsM3M4zYP7+5+bmKlngawJ10b9TMtkkI66Un/9W Ok7Q47Q0ppYu1Tb9dxM2vFm69M/mXNqo9fNoTqCJyOqyg25DT908rCK/i5C/0ZtcU5SfKEgxKmRy 5XfZdCNDV47mClUephwrGOUSCpLKRFHmBhWf0R68KHpt0Qm5iGY8iHJTsIOmsJFcQ84v/8om38vf skClzUKOk+/kGPlOzqcr7By2e+ljkzHrC1w/p26s6MaDHC/KW/7VXwL9BZBr6S+FjEO+tycm/r/x TPR71xW5bkBci/GgGzXmz+Dfeklv9FqzXM8yA5YZ+N9nwNyxEdlx4cIForIls11Vy5HrDo8uH3UZ d6Vj9b9f+cojhIVSS7kqWUYZKQhvWrSWRbnynYTfr4isX01eWRNKVpPBVorvQs7z++029NR/N2Vm nu0/fwDXdgZdweiLQx6WrhT1/I0oVEWjR8UpCtzBgVWPwqhDBa4B+kshgxTHEfhfeMD5UHkapeRF 2YtSN/dK9d/NvWndY5XxiIKVTTd6dIVurvRlATs4aIV1sr/uCetGgYxVPq8Ys4aspghXTFECcwtY V+q6Ytfn4Vo86b+aaT0SIPetGwoyFhmbbnj82TlkTiSSI/ubR07+6rqW7y0zYJmB/x8zYO4AiowL CAgg2BRBtEwOiHlUUper//qdm5xyUy1vuY/+d6+j6pGvJbX+dy9wE4674X3qV7tHfQGIghSFI4tH PGD5XHI3ssnfokzc3d1NuX+G6w1GeHh6qiyLMPQI8IwzIQuFyScnNwuubi4EccnhOcmxTjABT+6b np6uzm9HrGFhIpNCjzyiIcl1zI0LAYbRF6sz+y4d2VohSk1CTy5kGJK/xbiQz2Scgjgk55U8k5xH jpG/ZX95ASRUpf8tx+ib7q3LMfIjcyBjEuWrh+H/jXWhGxNyn+bnlXv/q02PWMj47OwJ9MNe/Gsx BP7qvJbvLTNgmYHbcwb0NJweZRWFLpt8LvJLnCBdzonc+DdSuoo1k61p2nW0eZN/iiSyqvcSqUp4 /vyFp64ZBbqDJd06KpGroq63+3ZLKHXdwvvyyy9x5MgR9hcGYzgBXKRPcNIkEpi4uynQmRMkPPnk 448xYOBABAYGIjMrDW+//QZR2IgqR5CWgQMHY+2aNYgg/njd+rXxzbdfoFXL5iRkmcWFRgQjevrj xo3j9xE4ffoMcYEnYST7x2MJYfgLoVhXrV6l6ExF+cvn9oRHFfq+ZcuWEu1uPtHUGmHggP5Ytnw5 Zs6cqazUESOGE44wgAAx87B161Ziod+tDIg333xDGRljx97FEJUfXnnlFV7zNMaPH8/rxSoPXn8h 5AVITU3lOH/CuXPnULNmTdUbKZ870TiQMIQYCxKdKCXqnKKhlVQDKVWd2Eci15PN3PCQF8nV1VVF N3SDqIgc72+88QbOnz+vATJ4eanx6JEBWeTyLOQ8gihXRCQnMZL0KElmZhYWEyiiRYsWao70CIQY Bv/GS3u7v0yW8Vtm4L8yA3o4W2SHODdTpkwh2dZB1K1bF3369LksxSkAVYoAxVTcfGV5mh7a1+fu yr/1Rl8Bj1kyfxHmL1oIe8J1ixysUasWiVf6E7pb2mqZZlWevPQLV/QU6efTZZQodCNpvHPJS+Hg SD5MGgoS0f2dJXCbPsybpNT1mkWZ+zLl1b5MIpGsrGwqyRFYQLjYjOQzxP+lElk4X+G9d+rWE3lM ef8061d06NSVYAAMx2dewkoqmftfeAu146LgRjSgUd9ORWBIOKpFB2LF7J/JllaJ0IDbqFQnYsvW dWRWexE//PAd0Ye2Yc6cXwj2Ek984OoKH9hYYodHHnkYo0aOZa9lGEbdORDHTuyj8v8UAwYMwMLl cxAQE4Wk42fJ5NYd382ag59mLkVipCsGDSTgQkANPD3xGbzx6kQq6XTF7PPjrwsQ6W2LA8dPonnT pvj0k/fx+EtvwdGqhFGEAt6/Vqw2Y8YMFc7q3r07fiSk64oVK9G2XRtM/uhD4tZ7E3xnAPZuWgkn IuS5keDm7MVdcAv0wZaFuxBeOYCEBvYKmjYhLgGtWrfCpbRUfPzxZALCRKBr127qBcghre3JQ0dw z4QJcKahJLzvO0jyUjkuHjkkoSmhcZDO45auXomOHfohKioAK4gKtX/fOVQhtr5/gD2Ngrfg5uAN RzcD1q3fhMSa9dCocQPFp64VDOrtLea9Cbfp22EZtmUGLDNw9RmQ1J0qVLbC999+Sy71MjowYzFr 1izMnTtXyTGVliQctY0L05BlRbAvI1dHEfk9pL6J/BHElyUAHYHHTPCvAl3tQUdENaUxhZonlKmM qArmOpOqsOU192/agsY1a6FJp/bIkkguI5vFhYwM2DpQjjKtSYjrMoKBychyCb1tT44KG8mVS6kY L5kj5F2MVh4+vB+/TpuLic9P5BgJM0uEOmc6SEUKw0PD67hdo/I3Xqmr3gOxpET4C5ctWXnSkrFh wzo88MDDqF69OqrExsPGmEHa0lmoVS0BWcUGLF+zAdXpwbp6+/P5aJCjLgSa8SDCzyHSgnpY56NJ bDCqJdbFhYwSHN66HuFudnzI9Ly9owkvWAnBIWQWW7haeczrN6zCffffix3b9tKYSGVI3RVnqNC2 bt1MlCJXkqaEcpEU4fTZQ8rb7dihA0lg6I0fOYyJd4/i0LPwxvdTuTAJXJB/EXePbI+lu7yRm56N i6f2o3JiazSqXQOvfvkrXEit6uDpi3pNGmDBjB+xdf8RrJ83g0qUJATefowANFDe9AQqW1Hwd955 p7q/eXPnoSA7nRzzxZj723qk7F0I30btEMn/lq+eDz/ywO9bdQrh8X748bsf0LVTD5wk2116Sjpm zfwZbu5eOHz0BDaQPrBBw3qwJ8a+LaddLGp7FycEkPVty9YtcKJnnnr2Ao7tPUAM+ixE0EBatnAj jK3i8PXXk9G59XisWrQOTVpxfqNrozCjlJGJGWjRpjux3U8hoUp14iebAB4UAI0od4lvifUs4axr aR2xSE/LDFhm4HaZAXmjbVmgnEouilPHT+DZF19gas4eo0ePVlFFIZH69JNPcOFSCurS6O85oAum fvwLBvRpjfVbNsO+NAiX0jdh5ZajuOOOntiyYzP2kBQrsVYihg0ZREdsBZYsXQw/0p6OHDkSLp4e vB7hZam0k04ex4Zdu5DPaGdifBx2rdyFwpw8dBsyFK99MAntmyYyKpuJH6i0Q72CMWj8GGQdPI/v pn6L3LIctG3RAFklBVhO9ri2jdtjGUm9ksjT0YARyEF9eyv9z7p4yi7RUdJBpYOH3R5P58Yr9avM i3BtS7hYKtULC1nIxd9Bq241vVU/etL52YVYuWIZajLUIkxpAvmnqippHIjyO3siCeedaRVGBSmr rVXLVjh6fIMiYBHFbGPDf2kY2NsLmxlw+Mh+7N55kF5mC5w4uQB7yQDnwVD/3qxDeO75Z4l5XpUY wc05plIyobmoCssSYhqDEIK6I/rc4xPVw+/SuwWifIqRb3sJi7bu4rDtSK3KnDMNgVwqaoE37HPv aLzw4RS8+PTTyMhMZRTAB30Zospnvt2ZLEByD/IjCl1+JHIh2/bt23H/uNE4l1yAdRuPEKfYQS1s e1saCQwbyYvViIZCC3rmp5iaWL5yGRVsNUafDFhPatfYypWQw9D4xQvnuT61lsFChuDPnj0LG7LO OZHprW6duti6eQucqfAFpvHHKUtQ18WB2MiFiL/oh+joaAwZ3hWvvnSU4X8nRIRFoT6Z17KKk7Bj 5xZ68/GMEtB40hV5+fPV20wsCv32EAWWUVpm4H+YAdF5QsJCOSdV8HoHjzfR5OTnc0Y3o8ij/vBj j+MpcmnEHonC2aRzlKVgFDEdbvwviT3u3Xp2YSqygCRVRzHgjjtIplKI8+fOYz6jtUOHDyVR1QZM /uwz8m9MVIOzJtb8aaYP7YjdXshrp5KJrVJ8PObNmIUjB48og8KHLJVvvTsZve8YgaObDuGdb7/D wMqNKGPL8MQLz+KrN19B8x5d0LtnHyTToZQ6K0mrZplYQiVVILpISxtURJX/h9m5qbvedKUu2OFe Xp4qPy2KqFatuiRKIe0oKdh27DmAGi6+ZPQpxabtuxnSOc6COCpL8n5nU2HmFUj4xga9mWNvnBCC spQzyMxMR0igLy4lSWh5HzpTeaWln0d+XgH279iJ0DBvHDy0hwsqHYcOHEV2bgqWLl3BEIw1OdQb oFffp9Cj2yB68uvJvHYGPr5OcLR3Ih/vYZK80DIk2cxXH32FlavW4K2ffiUJDMl7aSWmpOchqyBD 0FYREByqFKcHaVXDIsKoZG1Qq3ZtmiCl2E+2uNLiPJXDlxy/h4cXevXqpV6KRYsWoVWrVviEFm48 F2pUVBQX+wlau3mMJNjDUGSLbKYojmYeVVSHziQkyC3MQSYXpb+/PxIT67Hm4BOERoYSLjFKpRWM VPCCW2xFo6GQ7HBuhD8ccscguBOuMYukC/JifPX554gmcHvfbj0QHBqKhg3qcw7z4e7hxuvk05Ai Y1J+NokOfBgSyyan/GkaAIGIrVKHHPFfIY6efWJiDRYc5psWs16ielPXtuXilhmwzMB1nAEpJvb1 CYSXr4+izbZnKHz3nj1KDWaQCU3IVOwpf72pZC+lpAontSpOdqAzUZAhxclecGQNU+061ZCalU6q 01WqEDqQRcWHDx8h//kaVXQXQpbJEipkIVQpZCTwbkYDYurVLb+zUjK32dCx+PLzz9CgTXs4Mve+ e/c+BIRuhFWuERGVo+kY5iI+oQo86ETZUx5n5uTynCXo2Lc9iui8rVy1Gq68bitTe7UGda1l82+3 eqGbr9RpEUnR2AMPPoBJn3yKl156Eb5kxPF3q0LO74Z48dVXYCRH+MSnn2VoOBvVqlTGd19/qfjE h3RtS2+7Br775APMcijFsF5dyK2eiLAgHyQwH510/jhZz7zJthaAjz/5mBXxmZjwwDCsWL4BDz3w JEaP6YdGzSpj9aoNCAurzFRPGSLCK2Hw4AHYvGU90wLn0X9AHwwdOozK61PUrtuQ1K1VsfCzbxHC /b798GO0b9cfAU1j4BMUxRA380BcYENH3oXX3/xUKf6RDz0NK9tCRQPrTuazu+66C7HVq6JelWeZ IxJLUApNCtG3b198+umnWLJkiVLCLVu25PXT8NZrL8PLJxTj73kEWac98f6PM+BrHYCafBFsSELg aOdJaHwbUgTuxlK+FDUSa6E62dckbzSJ5/Pw9iIVbA3mvKFC5Pb08J956QUyEhE8IsAf9953H+oR 3zg0MBiRZLcTjvgpU6aierWmqBcYi/CISihkcV4l1hJERkTjZDit6uNHSL96AGeTWU9A3vk4Hqf1 65sw8C3O+XUUpZZTW2bgVpgBDajFyc0VTZo2w1tvv4WalDNrNq7H0EGD0bhpE8yeMwf7Dx1CBuVY 1dhqOOR8HN//+APW79yJTs160ylj5xBv5djRo2R3TKEcicOO7TvhRwdFnJtgMkxmZmXy3yDYibfE LbsgD19Pm4pqTDMWsZXZi2H5Lu3aUnbF4YupL2HE+Al0XLzQuVtXyrdAOObZwInnK8lgsXFmJs9g QDbTng5MOR44ehAzp8wiQ5uRTlAl7D54QPFZSO5eBKYGZaNIOm6r7TKYWBm53jd9/e7CBPKnehI0 qFcJiwg/91NPPcUqRAkvk96uJBfN27Ylg1gZQ+oFeOmF51VoumO7VihiAQVjP3AsyccrdRshxdqZ BRgZcCRFa3y9dix0sIFzcRASG9VCqtERn332EYpy2KtuXQhbp1RUqVwbtmW+SE8tQqNGDdG4UTMO wokWWakqrnjo4fvVmKzJHsdIOqomJKJzl8483oYeawEX8Dv0vvOQYbBHaZE9CvPOMy/eArWaD0EZ PdmAwDDu87ZiNiuxdYFDYTo+ZxW/LBJ7YwEys3PIf8LiDN57cbGA5VgpmtfXX39dVZJK+F3+9ffz U+ehfcupcoBPlQS8/EotcrAzf23I5rkJ2JPLu2ae6L7779fOxcUv81SFVul7772jqkBVeJ9xL2lH e/GVl1FAw0OIbUpNBCxDhw4FuwMZrShkpKI3Ovbqynt357rOx918SfKzS9F3QF+ONhPDRybyOxoj Nu0ZQRHL20G1rgh/cikLVORetLdAfxNuszfi+i18y5ktM3DbzoDewibV7lrbl7Braoq2KxWoC5X7 ocOH2aU0FLVZyCabdOUcOXoEo5kTD/MNR79BvdlhtAR9+vdBzYTajDqGwoU5c386HkePH8XZC8kY c9doFgz7MfQ+BL/99htcWevUtGljpWzlau379sTaDVtUdFLkqTu7eCR627xNa3wWHMbaqTCh8qJh MRq/zv4NBkZZu7JAOetMMoIrBTF1a0DfEaMQSuKXgt7FpNKOUco9OfkC7h03Fk4CDKbDirOg77bT 6BxxuaeuI//c6FCDfr0KhjYb5n2JrKYsDKKuqf5B5s6ZCxYToDhfyuRUkyHxftkLWUxbr4xKhd5q CdGEyhgSMvAhF4mlJUV59L6LmGcXzxSGEpWzZ5c6mGpXleelikhXziGhYyvY0kAoFuAZqyL1nTCs lRrlOyLJFTmSIpbAOOR/l5yLFYFubIRJjUq3VABwqNykwKKgSGBeaQ1IGp4GSQlZBowclyxCsS5t rbiXiX1VKjvFkBJFLHMhtQWi0MsR4OQ+Sd0q15MKUAOtSt6FYnEr4XWEFk4q24s4JnnJ5Hfp6Cgi R3B5C4eEkKSNg3eRzxsXPmBlg6pzEx2P11ZATDyuQCpIOVfFRvbS81z5+TQ9BHZXKkI5brkvoZ8t U2EqAelhNasybAkvrOjn5MFZFPltK70tA7fMwFVmwBwkS4PoNigkTyWmKRtasshMfmQrEWAt/tuy VUv1I1sui87CooMxJHp4+dn94a3qkkRmde3avfxzOZ+0LEtUU9+KBR2UEiyuSk31Y76VUvY4MYxf p04dpZBFtvr58vjR2vHyt2MojQf+R5GNKlVrKFncsUsn9X1sQgULnG48KGZQTZjddls59rterKXD /V23OynvdBIVI4j8Gl67iuWoSaRCoCIvFY9P/4hBGn6ifWU6Xv4pprI0CGWpVTG9VVF2XGhUbjb8 vETOYeTSEuhAdaIcXk58Y+bAjbIYqbglJl1CL9ggiomKm946Svmd/G3N70vJJaiMClHyVFpGHksD oIC/q4GIGy8KVbQhIwzW0IBcjMpW0rS2gfvKWKi11fg1I4XAMuX1F6b7/4MJV1PAObLiS1Ek98/z sFNdmysxBso4VrnH8qpz04lM82SuXlVUxKzuw+Soa9NcvqMJhpGGkrQbKvuJd1hm4mllVkvtLEaF 3Pll+vvPb+W6LSnLiS0zYJmB6zsDOnS3Dq2tEDlNWKzKizdJbxmFVsRsvlHJ0yHQKFLpwfNHJLBE B6Wzzc50Hq3qXDv+yk05IKoqSRwnka8aSIzSGDxeJ94mO4WJH1uTdZSOJFLVLm0QFSKiWH6XSMNV pkyuU7Hdns6J8tR1RX6r4HlLaFgwggwq5ELP0aTdFUe58tMVq7m2jzxeml+FKj8tj5shYPE+xRuX b5VLzP2tM/lERRGzP7vMjr+LAhYFTw5dAxWVlSgr/i7fqc3U2CgLSLxueu7aOBg94GqUEL+1GAWi Yq2YLqCis6EilDEZZQGblrk1PfNSK1uOSQwA3pd4u+JzV2jRqyytio+Ubpb75hiIWM/zsB9cjAo1 P3I+evi8v3Jb6QrjUi368i8rbE+Tvq6o7RT9rewoE6mB3LMsfUY7ZDZVuE343GnUKLtAEcKbwg3l w5VvrnwprrR2zayKiqv/6RxYvrTMgGUGbu4M6NDQOpCLgFclnUpCVnaW+DNKduiKXclkk9yxVoa+ EblMFTopX4gpTIpYO4YG7UuskO3A/nX+bqAMKxXwK3GExJHQnTeTbycKupRa2UhZbWO0gW0JkUcp g0oZfS01EKJbdDlltw2xRgzC98HPi+gYlkj0U2Qzx2FDMSbOT7ENJZo4SiKtVV+6ruBFxmlRzGsU zzf3ofzB1ZVS10Pvghz2b+CM/7mWMgl+3bNU/er6LFKBiAI2IQ9JzlcmXRSZNtU8VoWMNZPPisAF BoEI5BOT8LqEkB3s2LrG1jMGudUiEW/Tyig5YEFdY9iI3ncZPXUjH6wVF4cVPfMya3rkXE1WzL+L /iozML9uzV/Ea+d4rGyYt6Fytyq156KQXDSvKz8MUTM2wO8c1SLUAja8Ln8rUyF9lThQitzaNGZ5 AQwct+qELNe2pilQIe7LfWtR/spj5vnknqyVUhdlSqNCbBQuXi5ZZeLoKlW9ePzOSENHpyFUSlyN XeZNTCNpCNQMOplLNRaTxa2NRlfqEnJnlEK9ZDJueTPlaI6fL5kcLmeqUNV/oNTLrQv5RYd1EHKc y5n0bsm3xDIoywz8x2dATwfq//qx3keQJ2UTL1nkiggBkQSlCrZVSRXKKJHpTOMR6Iq1zMrbzqes tmPXkx2FYY5dCZWuKFeRlMzXy3Em+SVnUB64RG15/mLKwBLKIhtGYO0om5WMo4NVatBil9YiHynb DTy3OF4SBRBJU8xjHSSLKIYHLQblilGGWkuoQGQ0LQL1nxgQZj6I1s4mm5lXpPn8ps9MOknGKE6l SZZq57nSmblxC+iy6ncpgJCf651X16dCmywqBpX/locn+WE+XIa1bekp5ts4qumzLy2gHuFiYA7d mprboSyLR9I7Zs+ikQujiErVgQ/JgDQYqaBLSp1hz6IxeYpFdmIRMmhj7c1HRDhZZLCoyxOFVNTi Rdswf13CtjQrGxe1mEpLsxgqclVtaBwExyXY7lRmxe7s7WY+WYLtOcSJF5QjhzwuIHvYF1KR2+ag iD3kBlqKXFoSU2JvOI0LPmFHq0waHIwCyGK0LlZpAQMXnyh+cXiL2ZqmQ7EKU1ApawI06FZZ4fI8 9EUkH+gxbm0hajWakpwQg0XWmvwlip5V9TZ2EouQ2AJtAvmERXS0BDQmJXnDTPWdPL92LjEPDLCV hU/ABaX4lXcuGAKaBV0iLylfAhspklHvMZ+BnIffWfPFlU29CmpNS1qAI+P9WisDS6IdfJbF7M1n pMQgA6Z1bcVIh1ZgZ9ksM2CZgVt1BnSeChmf9HYfO36KiG6SrqSctXZgpFISkWXIpTa1obCwYioU lLPyWbGKdmqSyrqUDgllqnxeRHkkjomkN20pS0UplxnyeUqp83FGLvP3zsyQGlnbY2UgNCzdbeV/ KNkkmlpSkJSRwr5pLTVOdMgo6/ip8rYlaltEGWrHSKlyeyjrlGMk0pDiKo9yya6E0NiU1bk0Dgoc aWxQHzkR16SEzmAJdRJjCDxGLALKRBZIi74pY8RAyVniqZDfkz6WgyquFikmGCVSkKeUu+b3ay7p DXL/r9rSdj2tDO0WNcGvLDIJqzA/o920FHqJkqd3SyuqgNi8AjRjywcvxVkl9K4lj13GRVQslKvM kStrzZphF57Llkoin1aa4ADbmSZQjlPriecvIJa5I89Vxjx0sVh6UjBGRSOqjPVsvA4fjlUBlaoo YNqUogC5bykfuNTZlZRSwXNRqWFIwZ2jFNHxodNoKKWSyi9zZFhI0FflHoQtjr3lotgYJSgTzHae p0wVuXHhKg9fCvskFC/whbm0fFlJz2I7O6ImCfOceOjSm1lhPuqzp732ui0oS4amAu9ZFC5VuDDD 0Sgp5bxo5SUmm1PmVQrpTAVy8rucu4BFfPaM0oita5S6A4bKtPOLcufR0oEg1fMC+qPdkbZMqdzF Kpd5VPz1/FcvhdBOoF1dAwkSfnhR4qwxkHeRskDuUeH+K6PuVhVllnFZZsAyA9rrrDlf4nBI/7iX pxviyGMh4FzWlDfikRdRllgJjTZlhcgVyaUrR4VyRFOlojQpR8SNFj1JUVNEWU8UDXrfEj6nPLCl 4U+FWVLqxN9FdjAiSsfHxoYkWSa+FS3eJ9DUJcTOYKEceTGMDMMbDATlkty5KgYW2SNXFVdFdIyp al/knshAjrtAIGspjxypwAsp2HNsJe5Kpc6Bicwq4iESB5WoqBgLUmtVQifESL0hTo6BTomBv0sK toBF28rZEbkmspCyW5NrEq2VfTVH7HpvN71PXV8kBVRmQk6ibaJkGWymh+7i7Mm/6Qlzwhw5H7ZU eMXMxYBWFYw57PTyhaAFa1kcG9ah8z+xkpgy5zyr8LigyMlmZ+NGvHVaVnaEmFVWBR8AvVljcT6c 2PpALc0Pxbell5tPz5eepywNO2LKawUUDsikRnJyUk+amwstSWbubYtg50SENhAJTrxejlsMFgM9 fZqoLJ8zwslOuzeqW2WpEk+H+2jhH3kZHAieoDO1SStIqUQr+DJorXWaR65t+qKoWBwqfSIGAxWr ajexJl4yDQR1lDpMPGgtvCQes3xooCcubHYlvB9BpxMwGwcHGRfvm61vcl25lAqvS66LBoZuaNoJ 4p9pk1kvEHxnVQlbEYMp34FGmrzY6j1S0Rg+Dz6XIr4gNpx7sX4NV6Qhyo+1/GKZAcsM3JIzIGLE VilqKj46WE72YtTb0fCnsC0pJIQr64voVDgxmipCRNSr9p+oSPGYRfBp8kVScJRGmoxRwT5pl6MH LWQxUs8sdTym9jldpqm0opJl1nCwp+qmnLGjJy8FfPK5Si7KuVUNkzghUjQtZ5b/o6FAb1rkn5Oc V0S+kvzM8av8K/+QjiWVvpRjtOioRIvV0OnIaDJL5LdEFBgF4MBZda5uSBwxxWKpxqzJRJF9ajzl cvz6Pdabq9RFLymlQ8vI2Y2kKuuwZ+8+RFaKQYtmTQmhaoX1a5fDysUHdWpUR37GJazaugMJdRvD y4medlE+Fi+aihMpWvtVp3Y1cex8OhGJ4hFBBrIt6zcglEAsG1btQPbFvVT29ugy8E6VLy8kWtza NUSsa54IP08H7N95AJt3bqOlmYlA/1jCxLZUlpwoqyRixc//bRXqNEwgsEs9nD6ZhAUL5iKYEKnt CJIAW4FKPI1t+3LQhGhsDlSoJcRQX7JyHZo3awI7VxusJJbxoaNn0LFPM4R6hyjPV/xeWXJayL2U zG8zcIlYycLQFhwccllIusLC09rQzFMkslCEL97WXnucxUTa27lhBypxvNa0bOQapmJReXW0fRi1 OHrwKDyJ5nf2zBkkEGNfWNfkRzZlxJgZldKyZ0UjJ+XCBSxdspRIdlrVfWJibbaS1FbkNHZEi7p8 XCYjQkagTmtHZKmzSLuYgxiS0MiYTW/LDVns1+81spzZMgP/vRlQbcji1NBQ37JmNbaR0yI0Igad 2zaTTluRSspxKaMnLurRVPyupRXFzZVctqYnlRerAF/EXzMZCts2b0VC5SrkqeBOjB6WEhdDZf1U x5SWdrSivBJ3Ii0zBUmHLlCOxdApkdC3VjysPHqJ/ko60dRpJbVFBjomhwWwa/MmeuF0LAgDHhYb gcZtWnLM1CcSepexqB8p1hanSGIDvBMOUql7RQnHT6R3XzmixXRYtNbqctlmEqKq6uj6O+lqEd5c pa6MGAlT2GHm9KlYuZqkIU2aYg5BA6IJkRod4IR3X30JOc5hmDPtK+STavWxxx7DpGmzEBgbRcWc jbdeeRVtB45DXHSYIhh4nN9XjmmKN596Au+9+RqGPfU43njrPTwwrDN27tiCnaeJ0vbiU8QJXof7 7xuP5ydNxsCurfDL9J+wZe8xjBzdD5Mmf0Xv3ArtO7RBRlYynn/hRYQGxeHzL9fhvgcDsOTXqcrz nPLDbzRKnVC7GtC5e29kF8Xj6P5luEQku5FDRmHTut04fOYkjpOS9YNPvqexEo0zk/Zh4lOvklHu 8ic8c+YPOEPlGkKGuc8++4Jje0Ap7+PHj6Fa9XikpqThdNIZRUzjF+iHSxeTFSRj1WpVCBEbiPNn LuD0sYMEbvBHeFAswRkySeN6CuePJvEFcyZkbGW6x/nYupPHxFdFbnYeJj7xJB4gaI3qj6fXfOLo MRLCnCSWfGsy5JXg9IVzOH7mFKpVioc3kflE0e/avI1kL4vRY2C/csz6DDK8ubo4I5PIUa6u7sTW P0KM+0wC+zSgss/DOc7BmTMkdqhfHYsWLsKyBafw8ecvEgpyN1IuZaN+vfoEr9C7Dv57wtFyx5YZ uP1mQBwFRjDplW5YsRg/z16A5i2aYum835BB2TNwQE/WOSn3QFQ0lR4pTvWbpAOj/pCIKv+RQKqR StSKnrMmFVlnI2Rd3h5wpudvzRC82sSjFopUkzMg+4p6/+m7r9G4fXN4uXowrE8lS6dKXZnySljX JDWgOUXaCAppPDhQWy8i4t0Z8m80atiYBoORMsyFl5CaIimYLqFzppdnixOlySdxxVg6pe5dFQ7z 93Mkg1m5aDPuGNpf7WNrqg+S3no1Di3oqbb//546b1IsqhKGaqZNnYoRBAvo3LkLuvfuw1AKFcia uYglJvypQles37EP1YPdyLjmrcLUspUwd+wf4EPqz8aoQXxfF8d8VKLSu0iFd4LsZF5eZPZhMiQs 3J9IaUOJOtQIw+99nLi/JaQN3YJ+AzuTKGYd+nVpocL51eittmvfmjCpc3CRJAWynaZCukCko4/f /xaPTByLLdu24577HqKidCCF6cs4k3QRxuzD5GiPxsVMYhRzvW4hQ5yTvSPiwiJhdLDGDsLSVqpe DXePvROPTRiBdaR9XTNjMQF18hXXekMyqCWdPoXHHn1SXfOLL77B5k3biV+8l/CJF5g26EFWtAUK MOebs9/hyaeexOxfZ8PZwwm7t29BD87Xi69NQmSgC3PzmXh4wjPYs30fSn2K+P0uYigfwKMPjqFl SpIbW1fs2bKTqHoaVvuRg8eYAipFXOVYTCXTm8AwJqdlolZIHF796F0ExoVj6+I1uPfR+2FPmFmB UKyeEI9mRGmSToDUS8n4adqPGDN2DKMZsxWe8659hxgNISAPLeDC7DP4ZeZs4j9HEm9/P/IIBCSk PEsWrcTq9Uvh4xXBcZSgW/dWJupWLXd33bswTC+Z5R/LDFhm4H+fAeWjMvJpVZKDhb/+hD6jHkHz xCpo0aA2Hn7lCzRrUg8bFy1App077ujdkkRRP+BE0gnW7nji7jtHkXnyEL7/bh4hQwhc07EbGlep gl9/mY0j584hIdIf7fp0RfLFNOB8PmatmIEs5s7r12iMds3qY9I3k5CbmYsqtRoSJrwuPv3wQ6QS gbR2cAuERflh+drFWDR3GWJj4jBsxEjs27gGq3YdR/JpIY3ph0hCfcvm4uiExNhKaNisGXOIxXDz dCUb6HIWzYHyrRV+mr2QDmIg3B0NmPTFDwglp8fQsXcj9UgSlq1YgaNnjqJbt3Y4ev4sPv5oEupV r4112zbhwJF96Ei666aKklqrG5O6IdlUJf913m6up67uj9YUBb1w4fr4eKvbdTQVai1dtopMY1Xh yza0NcuXo9adQ1RFogJy4WZDxZnDPsmvPvsY8aRrHXdXd7a0OaAVLcbdO/YoOFMr4dZlVWZWOvF+ ndyY8ynE4X37sHX3Adz90F147e1pOH3qODx8vTBr9iI0bkJc4SpNyJfeW10jl8V6UnxWQPYguWwB C0REoc/66Qvs3rsbjz86ltjEjeAR5I/nXlqsCvradeyOquHVMH74A8zBEyyBSrOY4etChqjLmCSy Jwxst+7daDIWEY/dmeQ0WSoEr29BxGHPySlgMYqR/O6PEg95lSK86TdwEF565lVVfd6+YwemKqiw VywhBWobeLp54+kXJuK9N15hWP0ssjPyUaNmVUR4hyI+pjHq1K2JID97bN9znHO5Ci1atUeHNl1J dVsHa9auwA4yzEVGRWPg8MF46bV3EQQPVI6vgkeffhAv3P8UoWLzYEOl7kRYWCFeOJ/D7BPDUAP6 9YEnX4YNa1ZwDC4c017m5wtIZOOFdRu2IsLXHo3rN+XLNBKvvP4kWrVpQgs+ltcKxd4DHoxMeCho xytTCtd53VtOb5kBywz8oxmg8BYUz5TTsCvKQ3hcPOVZOhnS3Ogp+7Ey/gLWL1mAQU+9hiUL5yA3 I0sxU7760mfYvWs/63AOoGXLFihhfdMPP85G5ChvLJw9B3dOfAyLp3+PsMRYzJ49D48MGYtOTEc+ 9sHrSIhNxLGDTM9GhNDZi8MHH8+EX0BlOnV14evvhTXzdsPTB5i3YA769BrClOcqrNqwE+e3bsLR pCy0bVgdc2b9ignPMLTKzYEKd8a0n7Btz36ihRahRYsW8PT14HkWoXp8IlaQIa5a5X74ecY0tO/c Hkmkmf7sx5loGRjBe1uD4Q+MwdxfZ6ARZXGbJi1J470T+3fvR4ce3JfY9KBSVykAKahTOYcbs91c pa7C76WkAPWkQvchz/ch1K/fEPv274cXQx+rNm6Di/cZRReaSp7y3n16w0ClLRzqspWyOEHCxs+/ 9CpC+FBhTCVofxZZwyphDxXPnj270E+K1Xi8i48LudHPIJSGQ9Lxg1i+aSfcp/6KXVuWYcO6usgj XFtXWldVawbi6Sc+pCXJc+Vk0LJkNSVDLyVskRPimTAyoK1ftwrffvU9Pv/ie4SEiiGSRRz5TOQy ZF1IuCQnNydFgpKRn6M4zJ1JPpN14ZIqsHBzc0dhVg5++3EuczclcCfxSt9+vRSpS2rqeXq0gaRc 3YHWrTrg4IFTyMshXj1z2UWSw5ZiM/53/twFRUXbkNawDZNXudnZLBYRutYSFOTlqn5NGyt7JNGS PLLlCHp1G0UynDRMnfo9GjTppBaaKN48MVSkuZ8tazaC3a6CWVqlu3WpNUlzPASHj0EMes4mnJki Hte/Vx/0H1cB4ZhHPvrvv/sWI4aN4PhT6O1fYE1AICo5eSL34jli0hdxjLwPlrznEVs/iwZCaFgQ 2rRtSfa705gzdz5zYfeWe+rXu6XyxrxalqtYZuD/8wxIyxrryn3ZHkyZkZFOFrYQdxRdusTcMlkl WV8TEVmJTG0xWPbLh+jSYRQSSL7VrEkruDi5IrpSLGbN2IbTKUnEgKd9UFiKWtVroEn9RHr4s3Ep NY3MlK4I8A3C+jVrUYUskMOG9EHq6ZPYzEjnrz//wijqGe7jQQKvALJL+iPbpQzH9h2gQ0GmSab0 8nLysY8yNNLRmQQx9VC7ajC2ULYyY84KdylSL8GDE8ajUau25Q8qn+nCnUvXYMb30+gI1YOnqysj kAuQksfKeMptj0o1UOJWiJaNWqE+66dWLJmligX9vf3RuV9nJKenKFKuWtRjJZwfadVVUXi9Zu4G LImbq9RVoRwrI9nPeN/995FV7AvSoh5WYP2dWMBm5+KJV954E+5sIxh332PYceAYJ8cG7zJX7kHl 169bM9KDOuOVF1+gl+iGwQNa0zjwhae7Cxo2ro8lK2bBhyw+OTzfk89MVPR+I8ihu2X7VvQfNhzP PjYB9SuHY8Pm9fANrs7cRyG52Dvgh9hF+Prrr5lfPorRjA60YY753vvvQUSlQNSvXQd39h+I7Dwj fvrxO7Rr252UrbGkHXQmmxp7JFVFJO+J+SIPUvmV5hagcaf2mPvqZ/TqH8aAHm15zVqoPTGBoAuq 2UGxpwkr0Usvv0IF7oCYSglIrF2FHvFWhUNfv2FTTP9xGl54+nkaPsdxx6BBygjYsGUTqVvdVcWn C7GPxdsVMpgyJnHc6T2vWLoMm5btYkQhGSE+7owy5GDd5s1wZxGhFVtOJHqwlhSzzs5OqEuO9DVv r8CYMWPQs+8Q+Fl5oijpkCq6cOPCVhhBPL+kFeb+Oge7zp5UrYONGzdE0/p1kc+WvJCQYPiHRuH9 9z7BihVb0LVnD3YKuLDSna2HNBKsaTyEh0dh8YKFWLl8Jbbv3kwDwo7sTomXLXWL134D3nzLJSwz 8A9mQPmdbPElqDoSGzTGD+RPdx7WD8tJwlIlyh/RsWGYxehoUYERVarEkchlBVORRqYVtyCxRiy+ +HwSGjUYhOpeVTHps3mURVrvu2BlluazBZhp00I6A5voNU+f9Q2Gv/4C06oX8evUaewnz0X/fl1x 4NAU1Vp3/twZOJ04wbojFzSvHIMV81Yrh27Lpk2IrdUExawVKqQjkU2HoqiAkVfTfedRZu1jYbYL 06QGdlfZMVcfS4dQIqVvvvY+Xp72ncqzNyBbaMOWLYh3YkSa0RlF2cXITqclwjx8ThYpXOkYnT9z FrvWb0ctGi7xhqqYPnsuU7kdaNxI0R6vyEI8La1//T32G67U9VuqKBzQqgqrUbC/9OKLrI5OQRiV gx37weu37cVwDkFjSvPx+VdfEInIES3rfYkcVlAXEZUtPNQP70z+BudSJE9bgGCGct8k05mttSt9 VSvUabmCrGx2+GHqj7jIBeNI5RVNDzGxUWPYOPszjG6HvsOotDMJhGLnofrL5Yl/Muk9erG5ql/c gTnx+vWa4/ixk4qqVJTU5C++VAVgOWzD86claWSvebu2PVC/WV9+L6xoJYiqTIrYn6fAwcMFjr4J eO+tV1nZnoGYqCDi1Gs0qBKRkQpSUcoN6jdBCHM20q8ez7C3kLXcc+9AjsGeRWcXcY656zMXzqJj 53aIjA3FQ48/SM72MwgM9oUzc0O16/K6XHR3TriHOQInVKsbwflKQffWuWSRs2YtgjO5inszd59C bzqAIXNy2LPa04oGgBgCTkR4mEDD6lJKMmlWY9kSSCrbOtGMLpThrsfuY8ueHXKZyqjatBFejYlE Jl9oyRN50qjw9vXDpK++hj0VvhXn9OFHHyCbXT4iWOxYksf0AyMqBhbB3P3gvYzKOOKRxyPgyo6D WnWqq5RGdHR0efjdnHvA4rH/A6lrOdQyA//yDFzJC6LpJ2v0G343Cn6Yjq8oA4LpyDx0z2AlGxq0 bsHoHNORnXpi6vfz6cEuY2U6C8koawYMuodh99/onLmha4cm8Ar2RMNWzZRDW4f0z0H+kbBpwTbj HCPC4mKw+ufZSI2vhj4DB2Lyt19g3i8L0KhJImKi/ZDRoAWSLqWjevMERNephTa5F/H9D1MQFRGB rm0bYKchC3aBlejoODF/3lxhwYv3XKVhA/yyfBmOfv2VknMRYRFMC0agafs2yGJ3UGJCHJzZuz5w +Gh8QzpqB6Ybhox/ANYXM8jfTqwRRlCbtW6PhKrVcXLrfiXHdx3Yh3PJZ1go3R+u1B0yZ3pb8g2v ftdZ0m6UINWtJa3xTwhCSL9KBS4/skmVoC8rxBUQDUPJbm6OIGo7FLyQj6dpHznaE3GMvGub2Hla TaRgDLvae6mH5xDgQoXspx3DD4SfXDZ1zwZPKjztfNpnRDByseaPPHptfzlnFBWPfoyvv3auimOM XLzO8BEoeUFro0cqaHeePuyb5PGSJvB091A/YjTYSZuHIkTRhittZHKcVL7rmwDaObO3XcYj/WB1 6zVAnXp8UepLnoaVmoxGxLszjyVj5I+rtHxzXweG+5ks4ifkEUYovN0vGyoNBv/y+/ILKJ84dX1P RjXkR90zi0PcneT6DCF58l+O2ZlzasX2kpBKkQi54v4dnISqVbuvwKDA8mvYOGuVqHIeJwdX9a9v kDbfEeHanKrIhqlSVE2JKf90PUGQLp8Vy1+WGbDMwLXOQMV7KbKW7WDMhg4fNuiyw0V+d+/XQ0mn HSxSKyUCmCi/fYcXMCrqjvBgFuJWb2wuRdAhoquSD607d1afV46qov5t0Kv1Zed+8qkXL/u724Ah 5X/L2Nq16KR+lGjhT912Hcu/79yjBwvoRYIy5c3ryI/5Jsd7B/pj6Jjh6mgBoKmSUANvvFKjYjd/ b0RVj1Yyqx1TtrLd88i96t+maF6+nwL6kny6qVdf6bwKxXfZdf/NPy6jXtVPfKMU+5U3cqUQV+X/ CkhAV66/v/WKOdJ/05SwMgtMH5npC+1Bmz7QkdXMz1qB4Vvxqfm4rn6M1jsum/re9PCku1HL/ld8 r/40VUBeGYi52nVkPN40dNq1a3fZ2H8/V3JtHX/42lbPX92XHgZX/+p9lvz9ynWpz4m+j/l5r5zr q82fPm//5sK2nMsyA5YZ+PdmQO9I0XWDThX9R1cwx9WoWasOjhxPwpEjx/DAfeOo0AOuOEzHU6do NIHM/N2RX6m7rhbsFjCvPxz3ZQVtgoL5xyP5q+I3xWJXHpq+EVhy2lhtlCemcMYlDH6F8vm7M3vD jrvi4egPREGf6T/6YG6AiWS61O8KHc0u/TtF/idzpSgNBfZVcI0FjtX0t6DGyTOzeLI3bKFZLmSZ AcsMcAZ05S4y6Pz58+VYFX84OULWwvx4I6Y8HRnNS0vLwsHDp1QkVkiuFFmUgnDVWDb/jU0Dxf7r 3LWOFPfn17y2c1Vwcvwbd/DPzlHuqcvDKiZ0nigQBTV6EzbzAilzD0+GcuV3ukds8uNlDy1Rop6l +YPQvPYrt+tajCVDUdWOJg/3ivGXD4dD+6txaOQrFQhyOkuSrtTLveRraJn4q2v90SP/u8fdhCVk uaRlBiwzcB1mwFwGiI6QmhwhodL51c1TZpehSlJxl7KtV1KIhSzudXIUPgrirykIbvHQJb2oUTuX w16axm8eKdRv6VqiyArh2uSgXom8qYirTHriT5zwK2awwkDQxqTpmAodVbH7rSAriT9fcWvygArI WnajN5kI+VHkHqqwQMMwlwcihoYeSdD3kxy0hH9kH70WQFdy2rECu0rClfLcrEQjTCQlpmvJOXTW If3fazEkzCMb0uIm59HHro9FxqWPT8avg+Vo9yZEMRpJi/yt59P/qKZBxib7yP3pL5D5OPUIi+7J y7PT50//TDfU/siz1z/Xj5NzyPj1selGnv6imLM1Xcta0Re6Hmm4lhfzWs5r2ccyA5YZuDEzcKWy yiNXxAVCRotcEjkhck42c5msj0xkichAhRon6tDECil/iFguLhado0WKlbo0KWSdw13+Npfv5nes yxRz/WFNZNFiFi/LNUVGa/JWQvsS+dT0jJK3wlT5l5vWkqbhubN2SkF6VzhaFTzz2rnM9aku0//y Ev/yDpfl1G+WsNWVjkyIegj8V1dI+kOTB6Tvp+VztMY/qTQXYhAxRpzY/yjsaDLpgtku30nxmCh0 /Zzyrxx/tbSDfv8KjJ8LSTcy9HHpYW/5WxaxA4FYdMWuK1ylCEURC2kAx+HIfYTJTDb1YrBoQrjf ZR/JuehK/48Upa5QZT+xjKWFw97eXl1Xri+f64tef3nkOvK9blzo+2svlk7dWrGS9OPNjSi5lrmB pSt6/Tn8L6kauab+gunY8v/yOraczjIDlhm4ATMgMkHe5awsVpRTRggolmx6RFFXyuZD0fq1hUHS RE5lQlcTuShdMVJca6qCukyxmytJXTZfKb/09KR5dFk54rqzagrSikLX5bpBj0QL1vdfbAKKpjtU uj6w4Zj18L4uB0XP6IaFLnv/aX3AX43tj76/4S1tVxuILBJdaTk6ahXXYgmKAtCViO6ly/eZxBV3 YEuB0ISqKnXm0B0cnKjwRJHJMdbIL9CoTIvY6uZAWj7N2rJWi1H3nHVFI+eWBaovDLluRkaGGqq+ mCTclJOTowwCOU7nP9cftBv75IU2VSl3LlphMjPQqhP2OeEIkv2FYS6X0KzymTxwWyECoMGhX988 d67Pk3kYSa4t9y+fiUI3H5+cQzc25Fr6QtStaP3fK1Mrupeue+byvVxDxiKfiUEg9yWf61EJ+Uyx IV3Dpt+b/CvH6Rb9zVrw1zBkyy6WGbDMwF/MgC6DRFaYK3Xz91o5ZJLWFcUo3jZ/SulB2xHoStgh bUh+Usw2XIUBb1KK5grUXFb9USRTrq0raz3yqQ9dYLBF5mjQrJpSF+UuzpQmL/+8hkxzKMUq0Iqu 9aioeaZTM2ZUPbc6p/w4OZl3Tt34pXRLKHUR9C5s8hdCk5MnTxJHPQKBgezn5oNPJga7cH27ubup hZCUlKTyORJel6awY8eOKgKBwsIy9jvHMH8j1KhOBIOxxVli8nq6u5I45IzCbxc0t6pVE5QXK5N/ muxrQoAinnwK++MF3EA8YYGrlTEUEaNcFpYotb2EPw3imAICAtg3nsFzHla/h4WFqe83E9TFwd4B cfHxRJEjIQGtUzm/p4cnXDiGY8ePIyU1FdVr1uR+VG4yfkXhR3pBRhny+ePtIaAwskDEemVxnOIr ZY83V4wNDZVcIiTlETFOxp5DIAUvzkMe++W9PL20cDmNCFu204lBIuPO5b52jFi40uAQy1VXyhrv ubbQZQzKUBGGNh4vABA7d+4ke5sXsZNjeG+EteV4ZROK2Cyi18nidiXak5xHLXy+tIpdScJq6kXW ONjldzEw0tPTVGRFxiHn0o0XeanU/gRvuBFEBzf+9bJc0TID/z9noNxD5buenHyJcs5DYyszpVA1 eaH9n/KmKSCcKJML84pwgfgaIeHhShOK3FAIlpJfN0X05ByiC1wJeiU/esRQj56az6jIGj2CK/JN CLCSk1MIIhNHuehB1k2yyJlqrATZUsLo6SSg8vZi67SiZf3jTWSS6CY5JpfyVn7XU5ReZLcUha8Z G5qs0+9dyV968y7OQgp+4wq09Tu5BZS6Bn6yZcsWEqlMgS/BC7777js8Q9KSiIhw3PXEE3ywbvji yy9xKmkf7r33Hrz33ntIIAHAuTPHcc/dYxFbpRZCA0NIDuKDxx5/CtVr1ODnwzHx0UcwmghpL7/0 JuFn69EAOIzWrdti3Lhx2LBxHYYNHY733/+IJDId8c4772Dt2vVo26Y1tpK05eGHHkbtOjWpRHPw OgFtpNLTm5CIEyc+jTfffodELkl80Dl44fkXyJa2G4sWLVI0gr1690bnjp3x6ssvYzpxhZetWYmj W4/g/Ukfc/GW8PptMHjkULiS272MC04U6S6Srvz4w/eY+NzTtGQNhLpNJjiLD3HsHZGfm02muGz4 +gQSRvYSJk36FAP7D+J6NGLFsuVUqFZEvRuhzl1GwBqQdnD6jFnwoNKNiKRxFBaCQFrTApHrTKXq 4uiilHAGxy6wtV7snS/iYi2jgj1DStmvCPfqxP3TCPfYoVMHtG3fHil8afMJKRsUEoplS5cT2vUg Hp/4BJni5PN8ePkRcJmITPICZRMT3p3Py5pWuFjlElX5+ONP0atXd1Qn69Lp0+fhwWs6ONrSmDAg g0aCE2l0hWHvj3L+/z/FouWuLDNwG8+AhOHt6XEzOjr5w49x1/hxdHo0fAo9ZaoZ7YxIcj+ROetW rafjFUWyrEsKXTI5JR216lVXqJWllB/W9rY4SWQ4YX20c9RSi+LsibLUvXZxLLTUq2krJZ8bHSI3 d3eiWK7C3LkEtKGBsYT00MOGDSUgWQgDAZrqtqFcS7mUhg853gcfeICtwp7lpzEyv24Qj8p8o2Nm z7HLdoTMk+vXbkDbDm1VpMHb24tjEkV+ebmd3PuUKT8SFTSGiHICP1thNihylxvwyG+CUtcr08WC kaI26esuwYcfvIcOVIajRo3CAUL3+brZYu/WdXDmg87MySPo/gFiqHugwEhlUablNByLMuFOT3Ds xGeRGMrex+yzhGcl4ci2wxh4ZC/cCjORVcz9nCIUJeuBwzvw7NNvYODAO7B951qltFcu34hOndpR eRegfdueeOLJCejfdxghBg+hQcPaOHpiu/LSv6JR8fSLD2HJutUYM348jh45iq8mTyYmehmaEwFp 0JCB+PiLyZi7fAHK7KzIOPQLYWCNKLa3xsYly+EdFoB7756Ap+59CLENa+H45l0oI96xrb87KrtG wZ9wqTsP7sZ3ny+Da/ERVGrWDZ1JTPPTF+8jpciAqPDGCIksxCqyysWHNoOPXxF2biSMbBYBdvI/ Q51WDeCaCazeuwOb9hyCRwbrDpoY4BQShD3rN+KjLybBjzStEwaNx5Jpv2LJqd1wIjPRQ6PGwrdG NEo4pUumz0LrTm3IhNQGZw7sx8rNhFs8tB1zvpqOtNxiNG7XGW6lTgShcUAKPfr333yfHPfZ6DF+ BDzSi/ARYRWLy4rRsXZjtB7YAz9Pna6gYI8fz8bA3jQ2vvsI+w9nwNPBE0NHd8JHk5fQuMjHhAf7 IcjXn/j61xbSvwHvheUSlhmwzMCfzQDFuJGw2rZ0KqzJelnAKva9aw/iyKEd8E+shgYkkzpL438R +cqr16iF6AgnvP7yWxgzYgxqNqyExb8sweq1+/HAs3cQ6S0Q/s6eOJtyDouWLMbWVWvx+DNPEXWT cGNU6EvnL8bFCxfRtkc7+Hm6Y/cW9ryf2gl/v0BFFuXGSOilS/tJ6bwJjz/8NHwD3THv/9o7Dzgp qqztP9Pdk/MwARhyGnLOQYKgoqAYUFQw57jmtGuOa85rXLOAGbOCkiSICKJkJOcwMDnPfP9zqxsw 7Pv67bvgol38hunprq66devWyed5PvhQq1atVi2QKyd8MAMDYYd69xhEBDhLETgo8ZEJ2rJxkz6d +IEaN26vfv16gNi5Wst/2KzNW37QgO5DVadxNhHWFZo+Y6a2wbcRVxOv2jB/WlT484mfs98Wx9XR sHFtzZ0/R4GaWJzN5iB6ErEowxioKdS7b01XccVODRtxpBLBoPfCF/t22/9K3fWQW1N+sFoQpW4e aCEecWM8y7KySli7moLDWwjLzufqhYdtinny1Gkwm40AXY5CN9e7TcgYo6C8IFe3Xne9urWsq4tG DlXtunXVMDlbixfM48YRxoZEJBAZyznyYVMDBw2LbOXK5XCrf6fzoNF7/tmxWrV6mQtlf/DhO5r6 1QdKjKurw4cOdZZifkGe84J9jpM3gHW5XU0Zp4XrLcKQi3Lr1L0r5AJrNH78Gzr3kgvBne+rp7EG b7z2BqBkS9SqaQt9+PZLmgC14E6+VwXMUK1a6TC2UdQH+YsfIyUeft61hOuTUmrpjouP0RWPvKWO zduoOG+nBh0O7GJFgprl+HX4ISNgKGqt2d+M1eFDDpOvJFuL1kxWAR5vVL7fEcD07TdQLWtY/Bg2 W+E4X41H//eb/6qXZ8+EhnWW1v64TqNOP0VlazdqOhjso3q1Uy6kLKWQ4TRo1EC5xfmqyzyOHnOy VmxYoyOhw129MQ/Go9ka3r2vg6V9B4xnC08NGjRA7014XwdlNnPpiLPPOUev3/+EvprzrbaR8rgX nP6bbnwGQpciCBI6qXXDdL0GbO8S2JZ25hboLAyk2rDHGY3ub+kt3bePQ/jo4RkIz8BvmQEH8WWo mIS0Y4iyrUZ2vX7Hqxp0SBc81bHKiDldYx+8XzlDDtEXn32uikNbkDbNUP62PL35wlNKqt2W2p0U zfhiolLrtlR/aFTfhkQlsW4G5CgZKP0P1aRrW5yNCC3AKUkklP7Mi8/pXHgv7rrtcR00JAcirllK T2qslh2ztXTpfJUSIs+oDbJl5U4dMcxDint//FPavDEKzzlOzzz5rM6/6ALgW2MwAnbqs0/fV1JG FDjxK6FHr9GW7Zs07uXp6t09GYfkDY05YxQY9U+rHmiiuaQQ0zJq6YsPJgD5nqTsFnW17MflmvXy W7r1jqsUTbH2iy+M0/DDeykx3qIDUeivD7RjS4Si06r00qtv6ozRo0lBeDVU+3Lb/0r9Z1djOYlk C8dSzLZp02bCHQE4unfBolOkWbO+ZkLqaqeB5qOcBw8ZAq673ylgKxQrJhMTFZei8y65XP3bN1BM 8XYA9neBx3u41s15BwzebShxFDJ0q2kpWcrNWwvWcIxWrl6qWTMXKCXpU8LwU2BF6+8K7A4yXOCE Ck36/Gt42lPJdcPKk5QOE1rA4ZpXUmgRDwb6lrwd6tOtq97iJk+aNNHxuV911bU69thROmnESZAT wNBGqLsIhV5FXr7vwYO0pHQHlKhLyTFTDQ/9qoWZqvGUI0tTYZgjDBRpmR8f6YcUeMsTYWUj3J2d rSHDh2nG/G8xBsBvr92a72NaRBH6iomCWa4YGtMqqFyj4Y7HY4fC1UdeycymagAffEQ5Sik4LCDv ng6ucfwCFv6uYvDX41Q7K0MLl67wilT4F4VR4aO4b8PaDWrZoIV2rFmtOdO+dpSyC7+br1WbclVW VI5BQg4ew6iM6Mn6LRu0ZlOmcpo3g2UpwJxlUssQrRJaVCwoFUXoKiEpg3NluvDZD/DDl+RmaN2m tdh1PSlyjCHnb50Jvw0GYl8+COFjh2cgPAO/fQZctboVvxGKNoFTg5xr2baFTrzsdH2PR14KdnoT 6pe+JzXZskkL1c9pq5x2K9UNqNiPps1X7dbNNCCmMVG/VSqLot4nHueLQuKc1i2VBUW2heMriXTO Ihp50TlnK6tBHV0KB8WPyKUWrZrq/Isv0JOPPab18K+bUk+A/KvGR6TPFazREw93h1Wk9+zTX3mT F+PILXN1TUXIrdj4WF6vxhmZoEOGDdaypetxvjaqRQtC5kMG6OSTu+mxO1/Q3BmzXUrhwrPOhf56 nr75Yq4quObYuGh0RT99NnWSrr76cvXq0pv3fGqM8j/zrIv00j/edG10Y8e/g/PWRonF0Zr97TLY LeEGoaB7X2//FUrdiFNOOOF4QiafUJ1eqAUUah3Ura02YU1df/GV3Kwo/e3m2/X9dwuc0n75pRcg c6mrbk3rQqxSqi8+eV8bFqbqoPY5eNVlSoqPUlzDZho3fqwrlFuzZqn++cJzWv7jYrzYruTMYe9p 1kVjRo/B1y/QRx9/CsVfI1eMdvnlV+mjDw/X4088BnXpUh01Yqia4WnfChNcAMOiZ9eu+vvdt4Pf jme9ZpWuvPxq3XnnnZpBiKYPRsGX077SQUQXCihSKyeaEEvx3OIlizEeZgKPWJ889VDlNGmuQEEp 6W9yTQnxisqrURGKMBmAhsrKYshQSmmFgzoVxf/t7FmQw3TWzM3LXFX69p1bYV2bg1KE3S05VvPg LG+Yk6zXXntViYU+JTWsTyGenxqFr1WGQdORgo7IDu118823Kg+D6dTho/Xugu+xdegr5aEphpbW sJyiiEQcNGQwfMGva9XSH7X4mzkwE/VUHiGspYyjTetu2vn9Qm3ftcMZE0aMsG3NBkdNa3j9lRt2 ugLECo5Xwk9jCmFmT5yo++F3/2r6YnXqUI8w1teEwI5VXe7dZopZKirhlwcTuoqUSngLz0B4Bg6w GbDOHXLl5YDKWKtupQGds5XhSBSR5+7Ur6/aITNffOp5xbVNUjmy2Yp3yymMLUTebSFC2ySh0hXf rt+60bFo5hOxte4gMxL81clwXCRp5bLlOAfwtHM+K0YuRUbatpPIYlWw17wp0cuY+Pma+833pFUh 0HroAVdHNX/ONMVntlG3Hr31zezleNkRKsTJicU5MyekU6f2RIhbKTo2oFxkG4EHnLkq9ilSfHqa ti+a6+T4D99/71qUA+TdOYTueeDvOFKpGjKon5avWKqHHn5U11x2C/n2WIqYIdFCBmZkZsFv0VDt u7SBBwSSMmjA97WXbvPyC2n6c5CBfb3MzFO3CusjAcbPzKhNdfsGnX76GaoL/3l2o8bq0fsgFkuk 7vn7XS5kfc9dd0Bzt9YVPySnZeimm6EjzS1Wdfku1WAFXXvNFXi4jZTcvo6atqR4jmK72+/4m3Zs KoRoJIvcRld9v2C5Mk5ur+Yt6+iyyy/QyhWEvRPqYl3hhWIhPvb4wxSrFap3RGe42XPUuiW0pNOm qUXLZuSGmujMM07TnOlfa8TwIyBZ6UrlepnawAVcaguRm15EziYnp4X+fv99LlTdoH1bHV98HAZI iYYOGKwKLL2e8O1CAKRSQleVG3M14qTjVUm+pnkTPGcoCk84/ji1a9xc0TV9tARmtVNOPYaKzloa c8qJKi2sgZ2tA+GsNJTqGrXpUF/RELzUjamlrOZNFIC/fX1imlIz0pSYnak00g5FKPisZk3gLcfb P/kExVFpn9qnt/ydywjZswhRsF3gBz4tKUbLl/yow0ccg5HSjQeMIpSoZOXtqtAZp4xhnuK4zpak ApqrnFD/Wiznjm3bKYF21aYl+c7aHnPW6WpQv55OGjNa383/RpdeMogHLYfwfJy+m7dOI447Sk0g lmkBH02tWnF0LIQqVPf1agsfPzwD4Rn4d2dgb9ArpycslUrBa0aDbPLFccqEMdLaeZvgWCThDc+e 8omWb9yiOrBu9s3preVfrtKXMycpnb+b1c/W9Le/UIdDoMiePEWLv/1e9aiLatS4scZOmqJ66IJ6 6e10TId2eu7+R/XyuNd12Mjh8LA3p2D3B9KvIp3aAB3gONfoxknVmDGj9PSzT8P+VqKWLVojc7qS IijVuAlTtXmFT+lERFPTIN6ifqdD51YaOnyo3nrrPaKISTr73FNdi50fRlCfP1qZ6IoOvbppHo7g pVdcrijON7DnwUpJJ5K8qxolv5jq9lgKpe+CEIxw/pYdevGfz2AkdOZ6azOueJ11znl64vHXtHTl InXs1IPCZ9TtrwOc/ru35Fe/F/g1Jb5Pe4gdfqrl1D2rzjB/rWLQvLy+FJxFwjJWTli6Bmssm5Bx IQrT2hb6onAMJagNyiTgqhlpJyjYqYYt2qoT1pufQo2qkjxl+8mplNMrSFVkj4GHaBcVYIcPHYLV h1XJ14pK12DB9SL0naSCvApaGwgP96mPFWZVjtUqKa5QmzatPCD/Gnq0yXv7kmrIL5/Ia/hzy3LV uH5DtT0delTGU0Tvuo3bqtjNgiul+K0cKzUaxToQz3dnGS1oRIWOgA3IgdhgLNh1VDIYmtY4Bu1h KYm00TVVIcZLdV166qvWq0O7tuTLy9SLY/eMpgeec5eUbVGXLh3cuCqr89mvWoMP7QfvcL5GHj9S /vIIijLwlhlHU8JIZsXmVZcoivONPuUUFROOstx2DpSC+NWKiauN0RCh/Er6OaFMLaWGoHPHLuSU ejkO9LKinbTI+aBOHMpdihaHUhmedQTpjDKs3d59e+mg/v20E+s6LsmnhMhaVMCXqxWGQ155iauR aAWXslX0l6LwW7Rqq7YdDnLtekVlu5RZuxZevRXHMcd7kx/8R5d4+GDhGQjPwP91BkI92KG2NfOa LV3oQ6mfc9mFpPuq1LVNZzzRSp179inOo23dthmdO4VKQhb6oHi+8opLVIFsj44zX9Kvtg/ciCL1 qcdQyKoQA1E4OyYNbrz9VuccVRFxjOTvm++63Tl+CchJY+K89LIzXcvsqaeN9nRIjdXjSC3bNMb5 u9VhnCRTDW8aps+AIWrdtbcCWAFxSXwfOXMOdTwGM3/MsSM15JCDXc1VLOnf5lTm2zXRyKbz/8I+ 6IBzzz6HeiMKsmmTtop9hCznDmj4yMPceXzolTjm4Nxzz3G6Iwr9FWMU1FYzxvdvuvWvLpJh1fne WPdtPt3O8RNPPdRcv0/h7ULXRG7WgeCj3N2FolyKCFugNtzrCD4vRdl4TQBVeJOQ0tstLfNCL7ZF GzBAeRGKuhyFimJA+ftqCmCp8aksSIRSRW45nyr5iGqUto+QM4vFFWUZ6AGHLi9D0ZL7piSS83LT qHAs4WbJxziqErz3qggZoTiJlbu2h0oWZh5KyjO7COcUF/A71NrgId2Vs4jKaUezXYw/vYxQkW2s bQrj7MqNUtagCoHCrWahcF2VvkR+MAKsuL8UZcz1FVCVX1liRYVmCEVyLrt+w1Jm+dvlVxKhMGOE 4xNocIaFFRPmWQjL/nFC63Qryytwn1kGvQhFajq0nIeBSJh7bQ+JAT1WcfyywnKVw2cfadC9vJ/L 3Pur4xRTAahPpLW/lckQnAu4PrPNmG6V8hsbw42psLLQXXdpOXPAOCAedoWRlYS1SkpzHRgPN4Sx 51v/g6Eou1TA79DSuXsthV+EZyA8A/96BkwnhHAuDJfDcwaDMg8cd/eK8LJJGPxd70DIypSgMnPu G85YNIo7tFmrm5Pj5sF6L50IiKJeKPTalHw0IGL2Y1IQCCzv0HsxrVkBM3zT7n0DBjOF7vYJ/p9M W1xIOjv1s1fnWiIRzdAWup4IMyXclz1llQa+ye4BmQQ14DB+pyQE33cfRouA5l6bnaTapQvsZ885 9n1TWyAEImA3KQSfuk/hYj1Egp/9hOYv9L5Nh4eP7hGZhn6H5tabmEq8fh9K0Y/nVxEwz9eHIuR/ fuy1BXWd1uIu1kSYMmSJVIOAVGPFHYY3bJ/TZuA3pYxSr2bBmcfut30t52xVF4YGYwUYGAI1CSgx b1G5Iv7dm50DRelWgteWVW3ACvw2pUfXh8erawrQFCurs4o/TKk7Rcy5Knnt6Xh7zTUZgAs/7jju ZPahndsOZq+DWPaOFMFVh7jzuLnie+6c7vzGgcRCdOvTmRIUu3ljsQE6KgV7w4yP4Pu2rxWE+G2w NlZ3yd74bJz2wlnu9i94bXbVweDL7uM48Efukd0ZByBhdxPDyntUuCdujkMQut7Yw1t4BsIz8N85 A/YMG9BLCJEzd0cudT7m+Bgpi8nWaJ5vHDFzhJA51Qg6HzLLH5RNJhE9hwY5ggCy9KMPGVPNa5NT 5RaxRWTEcziTi8XmY7FvnOe/qIwvOGY308ou4mtCxx0tKDsQVLxv56jyfCscPCQ734tBINo5TSRF 8p7JX5NLnsy244UEuu3jtVmbfMOUYQ/+t9OYIAyUIN9ikIMeYE5kFYh1tPGa8+SQw8zDsVM7OWnH N1cJnYJHHxTI+/zm/gT7PQTLuk9DBLvD7+6OhMyp4KTahJiwZxqZWJtanyuEMBVvN94UoVsa3ler ACXAkwz4IX0xJCNuQCCijP9NqZm1xQ02VWIKMGCK2zSs5WDs5hAVqMaCquFvH0rcVoKz+NjXsIEd sb3dbN4zvHYK02qcEWHnZsHa+dFipiTtptuobHxe5IHlEkQrcguMff1u0dj4vQVr363hhUUVXOjZ 0JgqI2mtoHCMivBIViVwLKyRSLeI7UyeMYKCtAXkHhxDZAL7nTFGME/ew2FzxsMXXPN+jm9jsUUb MCOBClEbT6Q9TLZODa3OBmWPBtcZ4ItmDUf4zRRgfu3BM6pXjuEHLMZnq5vxBpj3GsNzthmzabVL 8IIf7tx2jXYfLTxloahqNx/cGT/FcU7Z21zbvbEp8x6csFLf5897+AThGfi3ZiAEKBNCTUtPpyXX QKxyC12U1G+d6hS2VUXuJC8dh7iB14KIXkwFHiwcHNvj8NLpCkotAZ0N+ZYbW64U0qTJVIbnx3oy qZpC4VJEVSX+UyRv5Ed78tKRvBmKJl0/nlI3Z8zgac0LsSirKU7nwjiZHkBOV6ITTLZEIZgKoyuV SO94WaTJIVPwfiKROGF2LOS5FykMyVNT5pB0oUdqTEajkE0Hmbz0cc7qAOilojqfFKSNJaoylvOV IP/QD+icGtMp9j2+b4ZOhP3mPS9SbDHK30Ii82/dot1fcko95JkbpKcp9n3rqXvC3pSaJ8S9i/Tw c43IxQP1s/fLaSUz/RVl4WlTOig4x7pbVeopiQgmypEFxFlHGE55Mb+jUUwsJOeOegYS6R5ucgb7 w6rmGHYoTgPRzYcX7yc2XhmIhxkwhnPF0ePIYvDhkdPiVWM3wgZGWLyqEpQ0KtKd521qltyRtbj5 CSH5qsowIuzm2ziNhc08fqw0Bl+FIra0gClfWzgGz1odfF2FsgvYOIW1GyBnQ66mjBB/NPmqSK41 imuxFrIaU/ymJdk3Ag1a4Tx6ck5Wjcm5LFrhHjqzLhmDn7FUslj9hPLdNQUNDFP8ZkHaA2fWtY/z mfXqjEyzlJ1Fiuo1Ahyu38/1myGQ7O4DY+KykujHjMBSNWs3FI0w+8FUctA4dq+9OALjYuz2cHg3 1R7SYPjNPUR7LGUvrhHewjMQnoH/1hkIYaw72FdjySSsbO2+9nBXG0kVz3kiTpMp/mKe9wBAYFFE UC0HHR2RQNss6b64AuRSQHG+ZFAnC3BgSpB18ThjdAIh59md45ozUKVYkzvWNoes8lPzE4/sck4e ssp8Ahe/RRZhAiC/rDYLeeKcJwLo5tS5tCKocLyOoGXO0okmi/w4JjFOBhr7G25fUPQ46GwcRWcb 0FRt12MHMdnnHddSDuTfTd5hgJi841J4O9rLPNh4go6djck5ieznOTBu792ScV/e419Uv+/TIjnv up349sIe9htP0iBO7Q/n+VkaALxxlFiFoRWxh2VTqgwj3fI1VvCA+qmpQkGyj3mwlFDwPu1jANaA FUSumKItm1zLJXMDzVuvZuINF15VudaazbHjWUwo1epibpTR6dni4LgcQzXgAqPQTClXmxWGRQlK DPuVqowCsmrQiGIxLMyjL6+s4SZbyJzQE5XzHi0s5CUswCqAdCLoFY/Aoq127Qy2GshxW+DA8tVu ZCW8xbVw46urraiOBc6+VlhimYNqK0ixlc5ijqjhnOb5YiiUWzSAHcif8LdnXdoCc6F8jBpb+75Y Wk2q490cmjVii9QWv/0rt9C/hchsbvk/ygoJsSQjjAuReeUI7n6YenYZLhsC65RZcQ+RrU/71Fvq e9JU9ncof+U+cc+Id6/tVcBl470v2l97VHlon3253MPHDs9AeAb+3RkIsTmajNu4fYe2AWzVBOho SxPmkVarQl5EgzZpoDTWVmvFwPjHDi8jhbSmQVFbatOP4kxEvvqikDIRufKVI/PMOQEAxjZzFiwg 6MepsRhljSl3lLrJeKckgxLGiqy9b5hz4KX5PPfCZKlFEgmLO+Vt+xkvhkk+FwdG3lq6AAmIN0ip D9cA3oexrxElcFFUxmDRx1AENiTDQAgJCq+g5Aop+6AcDHovu/+yXHtI9nm/973z8gul/u/e8N/6 vdAlOcVuUY+gkg8RklgBRABAgyq832pawPwQgFTjHRp9nx9FZPqtiqIIU+Y1KFZfwPOeo6k+N4Xl 6SJuBcmZCAvfWCEauZBIU2p2l/wpTkm6RYMFVs1CcnmPSgvJ2100JWl84oRcqMysIV/io5/c7rd5 zT5C1KYIbUHZGvJZYqjaC/UbEUuVyzWzwI3QBEu1oqyQxcliwgOvJpJgnrLPhacsUWSEKrZs+Gds Py5UzXVyPj+LtwIjwXnppiWtCs1SD0ZTaArVxsl4y+n3tIXvqFKxbm0fvy1eMxLdZNskByfbqVe7 JtOo3gPhBUw85iL71KIl/3tb456F+f+7RPfe///3u791jYX3C89AeAb27QyYzEqvlQyCZ5Y7UQo/ houRYsU8zjGgYNaUOw95IIiP7j3vGZ5aRZwFfBBzKR0ZiZuAHP8pjrqTTj+9iF9565c7BOOEJsMt ouscMwO4QoZ7wdvgZuFOp7U9U8A5WSYH9+287Y+j73el/ouLshwwiigyiExkbDhRoMX5CJnEUmlt CGo1aCjLXVtuxo+VWEqeBnWGxcdqIExcRstABWHneHInPkMnsuVgXqdTUl6hWGneBhYRlmE8iwiP mAYuLEqULhZgDd668Z+bEi2j/SuO3I0hAhnYgLHtmFYtyi8Dic1C/8ZEhDfu6FO940ewYKpo5YrC czeGNpc5oaWrjIp2Q1XzE3ayxVMCqEx8vOUEPB51U6ARli6wsfJ5JdGECJR9gJBSGdEKvxkZFsmw OQqGdvyQvFSSMrBWumiqRGNR5hZWDxWi2rxZCsNbpHtvrvTQe1Dcw+HlksyiNSOgugoee8B3HPc5 cxxmTdsfj1/4HOEZODBnwEXkkMcOrcVqbJCTlciSKqKUfuQIHbikEisVQxrRhbetxcsVzZr8wW9G dubRsWPobykpYFUQATWPf3fsz7qM7NimaJG35szYFkAmhrql7O89joEVy3lFvD7La+MslUE2E7BQ vslp54GZXPQ8cSvQdcFcl8r0KvNN9u3mYbdju2jigbf9/ko9qGh2Esp58qlntBV2MMtv33DdNcrK SNBfr7pCEbUa6bZrL9eW9ev015vv1F9uvE2taPCvAZ3ognMvUllsFq0TiTr79CP0xIvj1KHNII0c crDuuusmDT/nTD1w19Oqn1SqXdtzNeayG9S/Rwethzzl8qvv05V336Tu7Zrpladf0TsffQr2eTrM aAHddMtVgKVgVVaXaezY1/XBhC/VrWcLXXThVXr48ec1Z/IHqp9dT1ddd7OWL5ysh5/+CPIA6S+X /wXDIEYP3XkTHne5Tj4TXPqOsMf9DQAc4G/POW2E+h96tOKiqboPbptgULvlr7foyr/domZNsnTN xdfriOOH6qB+/VD+PACEiKxQrYaIw4b1G/XPF1922PNpmXV13pmnKDMT0Ae3/CxQHqkJ730OnG2i hhzeJRiuCirzUIFhcE+LCsQa+A1piRcAbRg6cpTqAh/r7f3T5bxPiycPvOcmPOLwDPzpZ8Dkhynr 0489Tt2PGaZzTz1bvpgI3XHlTSoD7fKvN14bjBaaQ2F5ONOgXufMO2+8r88mTULBRmr06BOB2u7+ i/mcNW2aNm3fpeNGHus5V7s3q3vy2t6clLI6KWSt1fpYiGDcy6+qA4Bh63NXg/PRFXZKk7VBHz2Y +zZDxBgkX3nhdZ122omgcybv3qUy2HXlOoTM2zrAtt9dqTtvFevrjttvg2O3iR6A1vQT6D2NsGXH mmXauHaV1q3cpXVbdygOi+p74PpK6TO33H8R/eHbYMq5E3a05g0yCK9v03wwehcv2KbBXTpr3eof tSN3C3CCGAx33aW586br7/fdrX5vvqFlCxcD0r9On3/xlXq0y9HK5UvUqWN34Ggv1cjjztKECR9A +HKW1kDU8upr43Tv3Y/p0Sdv1bSZU9W2RWO1a3IqNKjP6MfVQKXCOvZ3DIiPP34XmtF/6IwzL9Ql l18Eit1SPfncWOX2y6YSNEIXQvYy/slH1KhbfxWsW++qxv2AGvjKC7Vx1ToMmgLVqR2rNUtWaiVI bbFxMWrZrJ2mQks7pD+AOUQSXoUa9eBBgwHQ6aEJH36saZO/1EF9eunJfzzv+t0vuug8R4lamYKl TKTgPmhjLTd1+ZXnaeHiJZr48RTIbbbqxDPOVbuWjfQqJArffjtHRZAZjDhpjMa/9prmgdd8UL+D Hb7xiy++4ABlLrjgfKIpripkryV+4C34A+z5DA83PAP/pTNgXUemUJHT27dpNrDU544+W0WAay35 bqFigPDeBtlVJsAzAQTd9q1UwsdS65ToA/p6jhbNW60HH7gfgqwNkKa8qfbt2uC8SMvgx4hBH7Ro 15HoaB4cGWtcSHwDsnzjjl1q3boVYC9+5e8o0s5dm10uvFGjFi7CuWnzOkfctWzRYjWv10Y9+vbG YSnVgnnfACGbquSkVKKlRSoEdyM5JQFbwK/VK9eSmsWrhy1y6YplSqkDF0dmA8ffERksmjMI3ANp +32Vus0VHmhxwS5o8lZp5KiTnOIYbghDbO+8MF7de/RUI1olpnz1tYb36wAGcKrXAma2F6F3sxSf fuJhtQKMf9TIAWrTqg3rrJa+B3YwEWKUGMLxiQnkp2k96Ni5i6qe/afWr9uqqWCmX3X9JRr/0QJA VPIVnxKryTOm6rbbrJAuQt2AGLRt8+ZNLjSTXbchaEEJ4Mhv0BljztAXGB7ptTKBOY1E8Q506YFp 02Yw3u7q3K6V++4tV76m7Gb1lb95u2pl1gNrOJ0WkFytXL9Vi6dMVjWkB3HQB/YE4a1V05YAzRRg tORCgNBEKUDArlu3QUW7QF8DXMfyTbvAwq/Aq+7VCwXP8Q2lzk/Of8HcGToYHviNm9bro4/eV2pK EyXEJeuN8S9BNVjb9ZK+P+FNHqBCriFOQw4+VB9/+KUqdrXQ1s25OunEk/Xqc49pG4ZTUkoSf4/R 66+/DbZxhiNU+Otfr3MFgHs2a9szI/bAWuwH0oMZHmt4Bv7bZ8C6f6ytzRA61wFWtRGI79zcXerW oYsCDdL0T6Bdu2TXVf9DBujmW56EJ+M0lHqspk2dqA4dB4JoGQ1qaIquue5SFebu1EsvP+tSrXkb Nqj9wBFqEB/n5OD6zdv03ltjVUBx9MJFSzXymKHAhT+BQbELoLBCnXPuZYqrVah77nlctSHBWrly FYXIYM4/8rR6D+gO8cpUzZg1S61btQc6trMWfDdPn0/6VLfeCfR4SgbOIYygH0/Tii2rVZMSoSFD ToRN0iKWlpbEeLF0pKtyPjC231epByu1ImmNsNYCQyras1Vr4pfTFZ+WqZ0lG7Ry6Q8airdqPdcY fG7z02NlSGjtISxpD7tPADShwoJCDT3sGC2Zj7KGNrWaQrIowj7x8TCfUYmZjJW3YvFCMIjnql6r ZloAZ/jCBUMUnZCo+hCN/LBoHrmVFMe1bpsB9FfTShZL/trIYyLJF9k2aPAgffrpR3rl1Xd0+01X 6/pb7lat9FRdfNHF7vOXn35Kq1Zu171j79I7RB/KIXBJTmK85NwTaV9rBTZ8DfmnGtIGfirn01PS gaDNgz6wUplgwMegiCNh/pkxebqGnHCUi0xYTqgMCFqbp2gKCIuAai2Ag9gw8ZdM/xYM5S94wBh3 NBUHEAqsXb0WStgC1crIUI/uLV3tgmETN2mYDTXqMmgQtxDub6Bu3Tvrm6mNwTJOgu0oQWOJTCxZ ulpHjwjAXJQD5nzTYL2dt7At92XFdmGdfmA85OFRhmfgPz8DwaJalF4ksKgdIdOa+eVXSkhLV07b tlqXv1FDBvTT/M8+g6EsTQ0a1+OnDsPYouISOoyCwqOU2qP4uDQ6hBI0aOAAmDSLtBTZ9c38xarf qynFyrF6D5rn3J271KXPwXr2uVdhhazvipMvvfRyffftbC1dsELr82YSYR2lAYOG6KHb76P4DtTP nXlqBeR3U9jjNm3dAG/GyUCAt3Z1fLGkB9qiN+ZNWaQ1ixbq8w8+1jFwenww6129Mna8HrjhCuqk rP89mMP/z0/gPjvi76vUnYYwhKJoDRw4UB9+9BG0eIn6/LNP1LtdU327aLlGHN9Vdejrfhk+2tkL l8PiU6rvv5kNLCqhnfhKlFwJHnkyyhcqUhR6fn4B+fU45SfFwpw2XRcmXqWNq1fpq7nTtXzlYnXM aa0f5k+n1S1WcfEpalo3Xh+8/x4IrBko9Xq6+95r1L/PseTRx2nlquXqP6Arx0uDBe0NwjVVhH+a w9DzhJo0SIT2b4NGnjBM4168T6++8Dah8fu0a1euZs+br+tvukkP3v+IKrbsUv3W7TTptbf1Bhy9 tZs2U2ZClBauXQ80LEVpddLI3SdTzx/QNhR03vpC1YcxyDzyxrC5TSmerOz69QkHVcOGlg6hQTM9 8OBDUAQO1gcffKjeXdppzdJFGAvJhOH7aCuL119RoKxMDIeWraGcLYHIpi5sQalas3Iz9QKlsBCB D19WA/Z6lqZ9OBtlHgnJzUK16bZGb48fp5NOOUPbSRvs3JlPOIvoAMWDLvQeMlatNW6fLcnwgcMz EJ6BA2IGrM6Hmh+rLM9p1U6fPzVejVq10IB2kGZNmq/2zVpoCgry2efG6YLz/uJ18ShRHTp1hQhq Ka8HqBiY7qdefF7HHzZQUydPVdPmrfGcwRuBl8LvOoIMCrtMu/J2ATldSlqwN9HHbCBaMyikpqAY bo4AYDCGL5JEFNe2ggIgt/leVGwMzGu5evG1f+ro445xCn0Gqcyv530LJ/tt8E8YmVUJYKFwWUDJ WlRUCBFMC8VmtHGV/D7kXgCjYn+0of0n7/d+V+ohZRCqV7CLscrrc88/X6+zAD775GPlEErPblhP Z557oc4660z2qCB0nQ1veIJGnXCClvzwnRYvXakTRx6ik08/VfO++Vrzvp6tE48fpNPGnEoovoU6 GTh/XIUawORz7NHHEH6ZoQBV9Zecf4mmfjUZ5X2XBvbqrAHdUJyz5yo5o6ViQHNLSEiD+e1vELMU wKULUxCMb9ddd7Vef+1NHTPieHVu31tbcss19dNPNHzYURpx5AC99sJqnXrKEZqCV22LySrpR592 qpZgRBjwweEnHg2t4C4tXLhUZ55/AQZBlpqcfdbu+7h9Q556Dj5Isc3x1rdVKrm0SBUoe1Oibdq2 VEYisIQwwFmF6cmnnKoXXnzFKfScli118NBh2tGpnV5++S3A1osdJ7w/Ih1Fnapmbdrr0Yeeg/p1 ifr2P049evmVkVofjvhkjJU+atujjRat3gUl6rcaetQR6tatA8V8g6Ci/UT9+/dWw4Z1CPEfyjh/ qsIdolPYTf9PPofhY4Vn4ACbAcu/WRtwpIrpPmqZ01KTEBMxKNL4VNp36VOLpU0tO6u23pu6QM1z GuKoGHh3QIOGHKF//OMJwu5X0wvuU2tIpOLiYnFItiomMclBfUfD9mj96YZZMmzoYXqD+qTNmzfT FQQUOE6gOXPGqWHdT+bwDB1+tJ568jV9PPFjfUdN0IjDRikWWuvPPpuod977mKEmaOPmHXr3vQmu X/2BBx9Q19696K4KqEGrVuo/eLBWr/lR62s2aEiHAU68RVgr3oETdd+9fpxS3ztfEMKC39crLDRX Dl2OtodImghPPfXUn5y2Zcd+7u8aQjwnjfY+OxjKvL235jmd9vqzXC3bBpkBePfcS69wn112tfc7 tI0Y2di9rEQDZ7foppNa7Km8rIJ672gqOfdsHlZau7s6emMht3L4gAHuxzZrHTvptNN+cnz74zAW SWgjyg7L2+m7/7b2DQO8scS0AcrVyk5WerZ3rVUMzVBqywn9PPPM80QN+jgkJFtgdu4ALXhnnWmG jrdZoUhGdlNdfu01vxiDtXhcRveAt1WSHmi+e5/BtVOxgit0/KijeM9+rDC1Bot2JD97DpXTqrFr e/spyU+o2/MAXPG/Mkvht8IzEJ6B/3kG9uYI8fSFx0nhg4r5/Kv+olRSqNfcdj2eLS3CyK6zLjkf gVKhes0a6rwzRlEwFwXHuBFJwWoWn6zLr7haM2Z+TV49Tp07dHAnv+r6v+KsLVWt/gcpq0Fjl2Zt 0b1KaakpOuXsv2g10c3mzVsShUyHGe54pWQka8DQQXjpIF2mJercC9LwzHfq7NPOIdVJyL/DaXj5 percs7cjC0vmOL269qCwbzvF1qVq2ripOl3ZDprURI08v47mfzdfA1IGqB0evUPcJJ17IGp1p9RD uL6ekjAovP0ZXA0ChDqscK8X0W0O+z1ocKD0XWVWsFjB0H48yBbrefReO5IR90XLy9s3De/c64u0 PkQP39d2967NIcizi9f+aN/0FqqPtggvZ+zttcfI2UuBebvuNoZMsbuxesPe/V3vREESg1AO2s1v sIqcfd0rO1+wiayKqEWNgeJQhHLO2Wc48gRTqAZgY8d3PZ9BEhRvbKbs7UTBuXPXFxyra7R0E+vN x+7rDI7TEN1CY3eDNxAcG9/uqXaXEN7CMxCegT/vDIT0Q0gvODInC42bTEOIZtTOdKIlsRbUprSD l5aQKkzL1qIFs/URqdQrr77RTV6Uw8HwEDAMK7Q3Bb+hzWRYGnjyffjZe7MmNTtfvfqN3I9ttm9m HW+/BKNTDb7XrPkep8Xei6ZYWEpWRqYHkBPaGjfyjrP73LyIwzjp3af3Xu8awqY78gGn13fzqe9z eNifTOO/+uOXxsRPDIzdCtm+7yG/uRkPxvJdWDi4ZNybnlUQDB57f+85Q1C5735j73P/tAjMO+3/ Mra99vipTfSz8waNlV+OxAwMA6GBjMBwlXlYHMYyyj10b/YMY6+r+BfjdzMc+sJPhv5r3w1F0/dM 0H61637T2gjvFJ6B8Az8XjMQksMhqNgK5FIJOW77MbhqTx5bVwx9QHxWWVAG2ly288gTSfflFxQ5 Z8HJNceLsQfbzRNVvzXq90s5/Ms5+a3H+r1mc9+ed7dSd+rR3ZT97al7F7h32P/XXu9tJe7ePzg3 Qd0dVNoexnpIKYX0vin70HF/7Xfo+vee7n+Vivj59//Vd/Ye868da+/j7D0H5p2HlHkoNbIvWir2 V6pl3y7h8NHDMxCegf01AyE5lJyUBP5HnlbQPuZFGfkX9MLNXbe4okUdjeFxG0xuBp5l2COGHFph OCMWJt1r85T6b1HGIaW+Oza61/f2ilL+pmPtr1nbv+dxfOohhWatUh586W+xhv5zA/218M7eY9g7 PRB637xYz4P14P38AASEjBJ738I8nqI0TPY9Bov32Z4w/95/7x2tcPzf7riEYQymda/v2d/2vs2V /Q5t9rqcBWu/bZymmG2zPscQw1HIA997rD9X2A7aFm89ZBX/1pn+uZHwa4ZAWJH/1tkM7xeegfAM /NxhCck1k2NZdM9UBOWUdQY5uGnkrslK46Hw5KyxPhrBijGtAf1KsVw8BWw/17k+R1n9Uzn7646Q yXOT+SEnzYtu7q1DPLjZ32Ig/DHv726lbpMSUib7+1JD4WaP4czoQ72GfxuPKUn7HVKuIYVqStIA WWyR2L6l1tpAJabRkRrDmd1UT3F6sITWBx+6PltsRoASOm9IOdtv20LK3BZn6Pz2WciDtvPtvW8o umFGkbdw4QcOhs3tGKX0ltv7ISW/9/zaOEKGQMjYsO+EjICQcv+f7snPDZ3Qd93DtRdowt4LP2SU hOZhf9/z8PnCMxCegQNnBkIyzn6bHNwCkufGLZtVOyvLIU5aeNTxo5kDY/l2r+gIRW9ckCaOg4VI Ll1qn/3s2h2DpNGi7tEBP5dfe5w0k2ueU2fy3xF4cTxPbnsp2H0R2TxQ7tYvWtr2t5duExVSlt69 96y1kKINKThTPvaep8BLFRMTy752Q8nhYAVaXsfrpa4MWosec6gpeQv5mFI3BRnyxkOvf+6Nh8Zj itZbRF7UIlSwFjI2QovbscsFx2T7hq7Fftt47XwhYyLk7Ye89dB12ud2jBJY6QxUJhSFCC3M33JP Qp5/KHLwa6mUvS1hO0fIiPotxz9QFnR4nOEZCM/AvpmBkJwIybOG9RoA0drQkbGYMjVsjUgcK6OS shilKRf7/dNA+74ZW8h32c9B5n1zMf/Ho+73PvVfG29IscbGQkDPjxlxhQUFzltNIndjWyGsZKYE kwHe90LjVmxRrZQ0YGMNzg8c37xdhSDHxbl+boN+TUpKcFi/MTEJeMMVDjZ2J3jEtiij4PKNpaey GKAD+7HzmOEQ8qZDSt3+jo+Pd+MypWutEbavvRcyDGw8GaC22d+2jylW+9zGa3/bsUzJ29jz8/N3 K++9w+VmdNg+ttnYzPq0cZni/Wk72a/fcTuXhbWKYbn7NSUdMkJsbHadttl47XrCSv3/+BSFvx6e gT/ZDBhUd3UwsumnV7yyotjlzB1lOjLGeC1Ky3G2kNNxMabo/+fNRTaDEdlQgfBPoam97xsQlsk6 72dPmtjkm53fi9z6fwZr/ee6Of8VSj3kPb/wwgtaSp9ivXr1dMoppygJJfjsM8+gDJM0atSJWrN6 tZ4GfnXkyONBYautvPxcPfzwA8rfVcRCimWfkzVz5gw1bNBAXbp10iuvvACISj+9+eY7KLtSp8TO O+88kOPqawP4ws8++4w7T3NaISZMmKCpYATH0TeZlpYGc8+pHNMUf5wmT56sDz/8UD179tLxx4/U 22+/rS+++AJ0udYaM2aMVjOuZ599FrjWWjr77LNZ4BW6CUQ5W5THnzBSHTt0Blhhsx599BGH196s qdd6Yc0dZuF+CwmNIeJ16NhBW7Zu0bxv52MUxKpT584YJDFuTKZ8rXXO1rFxtUejmEuKS+jzjHXQ saaY3wNYoS997XVBkDMGIrOaKwBvsGNb1MCMi+eef47Q2Vb3APQHqObQww5zsLNW+GIPSQGofF5Y y4tA2MP2W1IAf67HJny14Rn4k88Acsjky5ypM7WrIBdGSECqCIkXFuQjH18h314P8KoWat6ikZNN oWJmL/IeCsWbEPTC8daya3Ls84kT1QcZlooM3tvZ2BP+x2hg3/UbNuopdEEV0QHL2w+C5Kp//77O MfJqmrz7s3fawP7+M9QU/U5KfU+VonHbmld79933QAaw0ynJj4GLzd2yTtWlKfrwgwnE0SN16BFH qQgIoVfGvqnBQ4aqAYq7Im+bPkfZXnLTPerUoonS4mN0+nMvAavaWI81rq3P3hqvug0agdE+S7fd eo2+gfjklltu00swnS1aMldvvDGW4zRXW7CKp06dBiBbja699mKde+7F0KjW0xlnjdLK1Yv0xBOP 61joBT+d+K4awdC2jnxS2w4d9SYIeG1atoEtaJcGHXywvkE5P/TEEzr00MFq2bqpyvJq9Nhjb+m2 29N0BsbDF5NnqXfP4YprFaWtBVtcRWhsZC3HGrRm3XL17NYTBqN5KiiEwa0S8AX+rf1xsd796AsN OWy4UvwlyotIVCbIhSt+XK02Pfpo/tQpat6mkzIAUJj8+SRw7L9T23btNGDgYP24chkQsU20cMn3 4Le3gPWoRIvmLNS5F14AwlKEXh//KjmxdHUC/OG5p55WYWmVhh91tArztyiL9zdt2gbXcS2lZ2Ri qFjhnmXN7MeCanYPf9qW8icXc+HLD8/An2cG0MUGD5uUHqFHnnhWvXofooTUGL0//l3Nn7sU6upj FB1JRBSnpRSHogKxkQi3eblRSePZ+2pK0c4gZVphHUXOlj6NIDc/9fOJ6ti1u1KRNxWgytH/pkii mOV8Ho3M8lsBMmJny7oflb9uu86/5mK+W6w3X39dJeUxOvII6zWvclDYBj/u5diJ6pIEcHgiiC3z 5q0fOmA87XvVHP1Rbt7+V+quo99gRk0xUNjAjdqRu03Tv5qqy/5yhTrjnbZv3VaB6l165+131BF0 n3ygAb+cPlNt23dQUq0ssNG8ivcEgGZSoyO1ehNKKKFGDZvUVrtO3bR5V6WWz/1KjZJBN4pKADO9 GTCGrdSwUYYmfX611sPLPmPmFF1y6cWaN9eIX3IxLBKUj3e7GLKX6MhEoFTrOojCdeuXOHS3YcOG adqsTzR30Q+66tJL9db7H6o+OSVDJWoEmIEPEpWps79mbDXqP+hgHTZogJ6+/wVVR2TDtrZEgw9u AHUg1+2vrdU/LtGjLz/JevUpJaa1jjqmh35c9Y22bChQ7qad6tCltt59bY7aNW2jt956TY079NP7 H01Ut/pxWlOZpDqBIr0z4VOdBeTr3FlfK6dDT6+dpJSaAxbrwgULmNpoldZs44GK1Fz+bgJmfbQv RvWT6yoHqsK0+qlEK9Y7chtVlFChak0l0XrjnU/VpH4MBk5tqFpXqmfv/twr8vwuyUFnBFdov2sI v9XU7EHv+6M8EOHrCM9AeAZ+2wyYXMxp3Uz1m9fWVzMX6dDDm2vBgjVAZp+jr6d9rvpUx2cBs/3g 8y/BNOnTOSceAmrbGrWCPtVftkWTvt2gc846Vk8896LOPHm0Un0o/8IC3fvgk/JvX6kj/3K9yjat 1DbYKk866xw999DDatainfoePlBRZbnq3KidWgHxKu1S3EnD9Pi4lerbvbn++eTftaUQHYHhccbp 5+nLKRPUv98hqpudqUcfe5xzXqjMzNQ/bNpx/yv1X1kvlh+3UI5tZWWVinI0n9Ga+uWXymrUShVF ZZr85RewsXX0KsWNZsf5imbhVWrl4uXKwovtXJ+8NqxsgwYMxJOd7aw7U8yBQDVkABEUoSWIdLWW LVuk779boq6nDdQHEybqh4XfQVeaqh++X6Jrr7tGjRu21xHDBmLpVcKVbrlzckNgvRpbm1ENmjly 2KGHaiLMPu+8866uuPZyPfPsC5qNUn/upRdQehH67PN39fIrL+nGB19U9+7Rats6CkPgbph/CoA9 TNOxx4xwVmtcRBPIVtK1aGEK3/mM8UWBnNQAY2exNmB8TId72JdUW+tXrtHBvUapjHNsjY3iYamr 6Z+8pybN25KeiFd5cR6LNhve87O04PtFRBi2qVbtJE2a+KV69u3i0gi5pdtc8aBZra7rA7O1gNqF Dh07QiaTpzlwy9fKaqrmTduBwf8+x25DqqIBOPhW1e9Vs3qbeen7t+3xt4mZ8F7hGQjPwH6ZAR7/ auFtq7YO6jsUZT5XHXolkhoMqGO3ZnrivrFKDqQRTn8eOuxOqlUvRU8+PU5DBvbX4oWzVYWSX7Vi tebO/xbZElAKmO/VeWs5aKVOOmmMGqTm6uanP9dlpx0Ck+ZXRDI3Q5m9WkNHHOfkrw8vvBRZD3gd 8haZSk1TecVm5FmJuvXqqZQsUqrvf4BMnq1mzZtiTCwitbmJeqJIUrfpqqS4z+dBxv3htt9dqZvH bTnsxnCIz5w5S1279tREoAUbZSVq3oLFahOdRsFFJd7mIh1JaNjCMeXg9pqiKS6jFzIiSieefpr6 tqmnyi1ryCXDioZFtnW9NP/7hToiNhqGn80ufLzgh+9VD57fpct/gBZ1B9zlS8AK3qxJk75UWYlP vXv31pFH36Djjj5Fs7/+GnCF9RTiRSsGasEff1zllHvdOnX08rhx6kLUoAzSgigiBZM+nagnnnxM DxOmb9qwgWbO+UrXXXujbrz6DnXt3ITFtomiN2MPggqWY+TnF+q9dybgXUcTnqqjS5qdDKNaW73E Ij5sKDzDUKAWlRTAVBSteo2aq0+vPqqXkabMZq2V8PVkfbtkvQYOOEhv/PMf6nHw4aaiWejV2rJt q5YuW6bv8Myz6+XAAZ9GrcB0HXfCkS5sZQUk+Ry3AAOgZHOZ5n33nYYfPkivkY4gWgWhS0/N/2E5 NQ31tWbtWnXpTo4qQH7dkO0Ytx1jt1I3CNrwFp6B8Az8SWfADHzrEIoipThQU6bdoUcfXgnh1QAc BxAxYVBTdbJWrV2i5dvzke/1gXatAxVqQ417ZRayLVvNm0Tr1dc+1tHHQi2Nn1aCE5ZFPVCnDs0U 49tKMHcqhFr1lJlVhzTmszB3tlfdRtkOCLyG1GUABe3RcGfrhxXfQ2JVSbFwJJTT6zV7/kotXrSI 9GJD9endR3+/52nopIupiUKHmEvyBy6T/69Q6uZ9X37ZZXr88X/o5ptvVGpSCmHpNoShu+jOe+5U NUVw11x/gwry8+DSbabnnv4HhV2JGj18sNoSnn/u4fs1PqZapx47DL7wdqpXu5ZakuP+EXq/zPQ0 CsfS9NDDDwFVuFMXXzYGr3+m/nLxNTrvwpPVq29LTZsyUw3qtXILq2mTlhS3HauvZkzGe92gE086 XiefNJpF9Yg6dO6kgX3768WXX9btt9xM6L2Jxpw6Rg88cD+LJ0NvjRurTds2a9uWjeSis/TFjGla sxWimjN7Yk4mqHePHlTgxyibNMCdt93tlYtUJ8EvvAMl3BDvOxMKwxxWbJXqN66v1u3baNCOQ6B9 fUXNGmRzzbFq0iRbRTGZ6sTcLJvTWo2gcjWoxhhyRzmEot55931FU9V/ClGI/OKNWMmtlWU5car/ rTo+Oj5adz14F0Qykerbtwfhq9ZQD5Zq/FvvqWzNNjVsmgNTXaJa8n7jxo139+Nb7YOXTw976X9S KR6+7PAM/GQGLMJqQiwpOZHanTT9/d7HNfmTi8yPdpSoFciYgTCsLV+Xp9bNWmlDbr4aNWlI0S/p O3+pevRsoPGkMW9q35bvULUemYAj970efeRxJfnKVCc9oETSoo2atdFt912qk4961p3fKS3qrGZB wZ3xXiOiA7s0h/TtMWOu1cY1q/XNnHk66sRTtYNOp2KouhPgay+Aknvx4nm68cbrHJFXNTI2FPH9 o93Wn8DE2sWFqgX354UaOlA6QP433ngjSqSaFogYrLQSDRhyqAu1VOER33XHHS7UPnTIQJUVF7lK y/jqMt1zby9t88Wppnyn4mlxu6brENROpBIq66pbn87aUROr5557UmUFAfkC5YpJ2IUh0A3ms0zt 2lEOVWkf9UNRR9SAckSe36rMr7n2Stff7qcQxMLU7dt21bDhw1xVZSnQh2fDknYaOaA4YvnV7Hf1 VVfLF+UnclBGyL8SClefzh4zWkWF5LkrEtDR2yAXSNcTjz9KrjqgIsZaQ/TBHoiqiiJXKBIbm0SO /yJHQxsgZ37O+edwLyp15JFHwp0+lHPR1ke46KDBQ9UrKsWlIa696W/ayYNTDR9wKYxI55x/HqxE BVihhq8cpbffeks5OT3xtgNU/xcqkda+m2+/SWV8XsK4kzASqqGY7YyB0LJNO1X6ExSLsfQuBYRx sfGuTa+MY0cQHouwsnsLv1vICsKZIPD+/lwm4XOFZyA8A7/TDIQwNux3CAvDFzC6FU8snHDcaHVo 24NQd23+Ltahw4binNVT7YZt9Nq4t6E1XYqCP1r+qESNOfsk+ROy1KBWrO64ozVFvvHIWSBkE5N1 1gUXasXaVeiAdF161jFORubktMbDPhIe9s6eCMLBaNCilQYffRhV8Jv4uwSGtkswGJowmsYakVeg hYsW4uB1wOvv4cZo5DEtYZyMCsSi1DEMkGl/1G33lYUQ5UK/990FBz09F/7gJxgG8chMLERsoC1W CmcfkRMPgbcbjrD1IpYBJkMY2SANIrg5FYRs/D56HKH+MxCEGsuV0IZV7pAC2YddKyvLFAlvrtXn Wc6emkxC53YCkNsownMrx6ox2SEyEM97MKVFVPA9qiPpf6+q5jMqvysrYlwvZQ3jizKYWGunCGLl V3HCSBZ8AEPAhyVQYiegvSKG15SvcSryTSj9AIZHGeeLdMrRrtcK1GwMBNHtgmy8VpSGgWGtHzV8 xwcvcSnzE11dTBaLHvbyIo7oU1FVQAEeoBpXYwAoj6HvgaZnU2Ztb8OHDSd/j7fNWKICtLUxD1HW QMqkGCBPMTH3KPYrxyCwXJPdj5KSCvUgohBH2sI2G18VVq2rYLDb5V558LzhtPq+e0rCRw7PwH/T DISAq0KolIar4cehcDIA2ZSVWdf9eFo3Wq3adfSGz58nnTAq9NI5S63bdHCIcxHUKB3UIxUZ77Do kGOVdDkdIZrjdu+/fftWPQn3+uBBhykQDWZHsK4nOS1To844+SdTVM65IpFVAwYf4n5C28xZUxyt 6iWXnsP3PYRRY5nzucr4P962GybWlKr9hJDI9tml7q61CrZHuTYpu/ketKv3mpXiPMPQW7QkWKhn r1otL3SNenFtjuUqR1masgmg/P28X8kxqlDIDqiGA9FByeIzTY6yqrZWCXvNuVHU8pnSLuFPesWq +Mz+9pO5qeSzGrN7eI3CjcD7NW8eU8PxoO8GVAi+8FjjvPFXMf4Kf5Viqooc3WsFFeSRRqvKd62G PODBwjMCyxDZxQDm4HJU9n1DZAq9xpDBirWHIKqyRCX+RMVWc0wLcRGCiqkuURmtIY6I1pSvgfIw DmNCqlMnWxUUpJD2J0cPWh3WaUV1OWMhT27zZvvZM8g02KiqeL+Chy6DcH2NAUmY4YKn7qXPbXyc wxlLHvGtWczhLTwD4Rn448+A6Ya9kT8d8JajkDbRtVvwBf20EM0zwsK8qt0bTg3tbJ4lgNxDbtkW QO54DoLXfuZh0BUggxKcc3HcyCPVulVXr2mK/dwRTSg5JeAlBe2HDjo+98bk5BPCrbIygsK4Oho9 ehRGR2YQkjvqJ5wdf7S752YgpMh/DVr097hgu18Ev51njnp0t8h+HLUf7xgMof3t9rGlYNCw1mLF 36gt0IyscAxsd/vUNJaFi/15nharAqHOWrF8VK7Z72rC7uRvFMFPTYL3nttCvdgWasaD5nNPcVpE wcrSfr1QzN712fnwxKvZz/O4QaqzyIIpagwQK+6LCFVe0sbhxocBQqOmx/duhgRWq2foWC+lZ/g4 enQUt1uwbgQYYhY5MMOFa/MFOdsdqI3BzpbuZC6iSCmUOghdN4vGO++4573xB3W0mxo7pgHQGHhO DUZBlSFG2bAcWY4ZVkHLNvgw/R5rI3zO8AyEZ2D/z8DeRFTmrRsg1to1Gyj+zfekiMlN5JeTYdVx nvPjI3JYbYobACucqaiI7Tg6JuviFVVTpFKcjOgKUpgYBU7COfx3k+om15CVFZYy9VMjlEDF/FIV VxZjB5BcRTSarLPjmmNRjnNTidyKIaLqxymrwOOKSSDNWVhE5DVBkTE4adQuzflmrkt1+hTDGayN 15y+/T+X+/qMTqmHQu4GH/prIPr/0UG4m2EmV8hTR1mYYnJ31QtDm/llys3Ul91gC2ebArPP3deD yt1H+4TPwAsiUZ5GmMINionCM+WmVtVA7uL6t/gcZVQdIDdsx6nCG+ezasLQEXw/Aq+9hkI83Hte A1HLgpH9TUhf5plb6DxAzt4UbRVgBiwE6GA8JWsrws7hBm993J516EdJ235+WukiMRhiQaaLYOFF ubRBOYAzINXZgjI1arkdSxO48Lu9Z0qd8bGoPfQjs2zNLzc6w2TC7TYfGB98BoQD34nG0rUZo5HO xmiMRc5IIJUQEcdlGOwuYyHUZJCNtqgDfAe8ODfbkewX4Eg2pxZSq8LSjaDVzs/9MdPFFwlmvqU0 DMPexmmX7AwSz5AIb+EZCM/AH38GQhwcdqXmtWfi9cZSd+MpRVPG3hzUOPwRk0NEJ03KmIxFjlTi vERVJRNVNNlObVN1mkpIVcZY9JIwvkk3+47hYFCdxBETkUFFyCwj3iLNmIyjFpGBWCP1STTR6obI gzp9UO7DMOC80aRQ/XQUVSMHy0lV1kqjzY1WZvnyQdVM4ZjIcReNJo1qFfo/I7wKXkHwZv6603Yg 3OmfVAs4zN4gbei+HPweR89eobqDPLxGoVeNwrDQbwDvuISiBlMf0VWl3Dw8TxaB35CFavK5QShK FJUVqpVzs2JQQhHKdQq6sooqb4Mwwnorj2JP2rHK/OmWMVagYhc3NFXlKGofSi4ANGElSjaCXLpz 5AP5LKZElB/K3sLMNWXkgVCygL5EUmFvh62hoCwSq9GhIUXGoRiLWFhYp4TH/SjBCKgGo+waWGCK 9yvG2sGMwhXwl0gWeRxtYpSbeJ62GQQuF2/5qWCIm4fCHZvjVKJII1mA9kkZ1xlNIVwl12hLLqqm XKUsaKoJnEKvxFK1NjmXJoimBoE8fnUl0QzOZ5GACM5fQXFhwLiN7bj2MEZQlEjkwBkoFtpiPAHi 9dWgNEXzvjNqmENDfKqqxKhxBpRXLPcH7grZl8s/fOzwDByQMxBinrTBG4fGGvrMo1LikDtViqUl uCwG3gm6fKLKylVJ/rsABynRORwmZ4qQXyhqUqM1REkrcSxiAMbaEZmPk0Dk0rlEyDnkpxUjR1fS thwJPkYF0VeTV1aZRK7e3Kco3y6VohsiSs3ZiVEZNUex1WsJcOLAlPO+OSRotgDyrganpQoZDiIH xzdHyWQXMtKimmZ0IOOqbEzmOOHoVSNTzUih6inobIWC+wfOLfvVEsB9CZ0XSpO7gqsgbF+V0a3a 3yg2azVwRQzkyEsJGwdQhpFMtvVKVwZM67Kv5aspUguQH3Z5YX8UN5wgN8rPqrotLxwV7KO2IgyL ZNv5SikYi+VYNVh05SjqKENRcx5xgBYMPF+/WY2lKLAEV2jm3WT7GxVskQMWmy1gMup4wJZzJuxj LHAcu8KS07RKmKq2lRfF/tW0WtSUxhIxwCu243BtFRHxLNQaVfC3jcn1fjPWSse9biQ15q0bBgPj Rpm6cLtdI2dhdvgsxnswnFVs123+tPuqOx5+OJatjd3mkPN6CSjn9ZtidikEFHtJhT1I1AkAdmOG kSUIKjAQAtQamAHlUmFBPmQLvXtxenuL7Dvnt/vijTS8hWcgPAN/hhkIpWcdURW8E2m1UtWweWOX p44m4lkKAFhkFPIJ7xgpIl+MRf1wtpAlSCWVIq+skM2kRjmCKQ65b+F4U+fVyHKX3EOmUt2kWAqY C/lerBUTIwArkWcmN61Qzm81VChyAqFORpXgsMRWpyB0iRwQpbW0vckwi566wK77sRCs1TSZUo90 qcQIwrIWp0T8ueNGkpS3AmkvEYlD4xS/ydRg3dcBcpN/97r+UFWlgcnEQWLibaZkQZnDQ0+I52ah zqoqsAaZ4UiqtK34QZaLri5UREwG9p9bDW6/GPuHJxlBytwcTRdc9uoxCH8nATKDtxkFxKy7W9xg qsKrgUmNi7Y8kJ3fqr7BKy7BuyZcburTzul3jEDRhHPwYC3Pw7FM21ZiXERg+SXQxibyN+WEqm0V +TmuH0QlesyUy6pJg+XNJtuVv5VYKIm8FAq1xgrbjHPY0c26mlCH3hbAG7eHJWDhKqc+eZ9FWIPh Y4vRLVa+Zzasy9cT2fD7qQ+w2pRY86wtrG8nM65jizpYOoDlicI3oykuDqMGJV/ONQSo0o8gmuCK EXdXhnrL2bO2ODc5ej/XWE2kIfiUeFZEeAvPQHgG/nQz4FpciQCaUxKLHLNGIB+Oko8Inz8myUnj impj2oxBVqI4kUEWZHcFx7yOxjmo8kMeVZPkupxMcPkwDCIcw5ulSYkYmhx3dVVWL8QP1cXW3lzB MWMMdRSnq7QqD0x5ZLHSkO10CDkVgqPDMSzqG6qW92rxTMl7cs3r5OGf5ditFIC8voGLmYzb7cEc oHf191XqITOKmxYHitqsWbOAbF2kxs2aq2/vXoClSF/PnCol1FKntm1UmrddX81boJadeigVpRSB Mv5y0ptauZ1CCG7ioQe30+qt+cqq1QKYwVR9O/lr1QPA5evpC5S/+QcWQoyGHn86HjW15XkbNHPG crXr217pKdFa8v0yffPdPNDfdqlOVgsNOaQfHqwxlUXSC7lBn3w4XV17tlDH9j21gLDTN1MnAafa RD379Vf+zk0a/8FU+i1jdfgRQ51HPvb1V7FmfTruuGGAM0Tpwwmfa93GbRo6/GBl18lyYSVbVKhU 0OqWKRb0uNpZ9TBmyrRq9XLXateU4wfisHxtRdpG7snpUZc79yId5A28XD7W6w/zV6lpM4hgQFWq IQ/lVaVadb1V/EOCsHkThkKJ6jdorDmzZig+JQNM/OZauXyFEmtlKCvVUgBEFqxozpULWPjdBfq1 E7Kd9WvXAIjThIgGj+eBZbweoI9neNjhGfjvnYEaHJFVIFha02590C79Vcg0ooBTvppPFLRI9TNj lJ5t7WvmxFDjQw7cdRDjJfstaolSjiTqZy1MpnCrcICWAnFdD/lvLJS0ZrmiZJPt1koMIIdXpIxj 88M3oMU1zlJKLV7Pm6Himjpqn9NUK1YuV35hrjq1oz/d2qRDCtwVEQcdlaA3Ugbo1vIlq9SiRY6i Yi1KHGSTC/n3LsfvKf8Daft9lXrQC/QRPn8HRrVJX0519KZvvPGWo09tWide991+iwoTG2jCa8+r KG+HrrzyCj35+luqDStb2a4C3X3bbRp43Flq0bS+K0676sor1brFQfr79dfogbtv16k3XKc77r5P l5x8qGZ/M13z1m7XPTdfpxVLZugi2MpufeopjTpioN6C5Wc2iv3U048F9P9pvNcaFPsg5RWs1y23 3qbaGU30zYLPYXHL1Ouvvq2akk0aC9LbLXc+og0rv9KKZTs0J3eVtu3YroYgzc2b+60rvPv7xuU6 /vDD9PHEz1Da2brzxpt175OPKskiA2xWDLps2WIVFRfo+JFj9DUELatXsbCzcxQDXryBxsz9boE6 dOhEDKISFR1JTp6GD/jlUzOytBVFnQTlK5EujX3lTXXt3hbF2xi42nbkvbYpOSVWO7fvUGqtNO1g 3+8Wfq+jRzXSlAmvqTCzg/4KCc7kzz9W/xEnqGbdRi35cZMzVGKINOTu2KZFi5aBXd9J27dt18sv v6F77r9J3//wA8h2OYqP9Srqw1t4BsIz8OeaAXvuIwHf2rx2mZ59/kXd9/wrSqYy/fOPv9Lzb03R zVecDYBMAIhtzwFxpcXm3ONgWKMPTbW8SnUGgc+ij7xZXpavV194WVcjby1079A3XP6QeKQ5WFbL hAFQRaT26xmfyb8wWaeedrruvfV2Bep01XNP3KWPPpuMci4DrrY3Dtmee2Ieu43Z5+qEvLEUUbn/ 4gv/1I033w7SJqkBK4K2Pnb3z5ymYLDzAJNyv69St4kjhFwJ5d6rr76q0844Eza0I3U0fOnRhF4W zPjYeatryhI1c/4ita2boJTUWihcb9iVhKczoQgdCCRsh1ZNqHwvVJNGTbRp4yaY0FYD1ZrCQqhW g4ZZOv6kMzXw0H46/dLrlVd0tWbMmKNjjz9MkyExGXl4fwZSrk7wmY8YMUzjx32ijRzDtrXrV/Ma LvQHX9DV158Du9ss3XrD5Zo2+Qtt3LCN86eqY6vROm5Ugh565GF9DQHLmJNO0ZD+gzTx0/F68vnx an7Z9XrskV5aumKBLj57spYtxvN/f6xbqKkp2RpyaG9w71mMpH1Wr1gD81EjTfpkttpBofr2my8p F0rYhcvWq22WX1tUS9mBAo196yNdcdd9+mTsqzrujPMUmxgJr/wuaGY/1py58VAQnq4N2+epIyhM 06f+oBNPHAlvfAt9Aq7+pnXrVbtuHe1KSdfKNetci5tZ0a/DL18em67cvHINHNhNL7z0ssqBe1y3 ZgmKva+SQHx6++13QYdaC9NRUxdlCG/hGQjPwJ9zBirBsOgBh/m4N9903ByDOrXW7Jk/4JwMB9+i FBTPWNKYRXrsmeeVV1yoC08bqW8XrFbznGxFwrL27YoqHXFIa33w/gwN7D1YyVCzWjrz6SefUWn+ Bp1xydVat2qhSnBgBgw+TJ99+D5cHNnq2qsL6HIN9MHEb0AFBSEUxM9CoMU3bF6Ns1OjI0H/tNDk 27B8zieyO2z4Uc4xyUeJv/zS0zgohdBrn6XYGB+w3RRVA1z2z+fGQYiVoUMOG+gKpEOKP+yp//+u bTd3VKiXUg0JSpuBntgWb2gpbBMnTYYAoL1q05Y1FZa2DmeeTDU48Rvjw2ULkEAphCTlH48/pFYt Wur8c0dwo+LUYUAffTfve5eT8aGsfFQ05uWWKpYQfxTAMssXLtScBUt0Adbk3Q+MI6y8SikQprw5 4RPwiF9T21Z9gCU81p2jqACgFyvGAEMYHUx4vMLBrrZp01HJie9qDuQto447QdO/na1xY8fpgQcf dKGjrVs26Y57HtZFZ19Ez2Q0Ifo8XXv13zT4qMPUqll9VRxyCFYjBATR6RCo1IYYxq/p8K0bx3r9 +rWJNNVo/fJ1+uyziTpm1BhNmjJLnUYOVe6q9Vi6tISQo//4vQnwxTcHjpHCvsp8WjiSddlVVzni mnVrtykhIxKe+Llq0rQFVjWhfvL0tSHP2bxqqbKad1Ialui8H5aocU5bLZg9Q0vXb4M2tpNmz/hK cQnVXNscHpARmjXjCzDxczRv3ncwI+3ULbfdEgxlhf30/98lH94/PAN/hBlwFe2GtEn8sHvP3voO Aqyeretrx64KHYL8fe7B+9S1VTdNmgEpS916apuZppdeGgcgVguVFmyE7XmnJk4rVOuW8fqOyN/w Q44ACiQXOblVXQ8aopT4Onr6mVc17JCeOCUfq3OPfvrwA+imz7nYFdTVb1JXKQkJmvzpVLXrCHU1 DG+LVyxWIfK5edOmkHS9r1WrVuqII4bpk48+wiGJAVVuruMM6QRV9ZNEY8+E9rUcw+SO2+9SXbg3 2rQxGtdQczI5eS94f4AF34PY+L/bInMxjirFJabC1FaLMPQyIEp7wjS2VKS5NWXmXMWnraVqvVy7 8ot03LHHyI8iNw5126qtLYsw8W133K16WRSlVe/AW82H8ay5vv9yihYSah7pCiHKlZiRqPUbN6pe ei2tXblEk2Z9q8TX3ta8WZ+RW+8GsEGEjiRK0LJtpm67+R/Kgzxmw8a1WHFxwZavCIeDnpoGEAJU r60sMgDa0bKl27R90wL97foHdd/9d6sXEKsWgr8Mgpoxoy/RsSeeABxrvq6/5gZ17zxQV//lEv24 YiG47O9yBZCsRGfrEkhmWpEP+uTd2TCltSXCQCsasLM1VI6aIZIAEUufbh1Vv113LVrwhJbuKlcb PPCZX36u5mf/xasaJWdVXgYLHP925hYTekpQFsQ2H74/RQMOHsQOPITE+ps3aaz3331Dp197hwo3 L9UTL03UddddqwVTPqZwJZZwfZJ69ewKLjzFJ4TEEiF36QXLUSwAENlQu3bu3AUGuzkwM3X/QwI3 /G7PQvjE4Rk4wGbAuojMKes3aLCefPJhPPY4NW/TVvExAM3g/frB55g7bYqKYzOUkWVcG1t1yKDD iWC+o6i4BOU0TNErr3+irt360EdOdzqedIPGdaClhmcjqkAfTX9aLSCWmjv3a7382vtqC/V26/Yt cbJKlJndBj6MyZr11ec6+eyzlFWdqVcmfAbfeheXily4YD5R0wU4fcXULP0I50axZk3/yhUar/hx Dd467c/IylWrVsDi6dPtRx8D5XUdr7U3pMqDIfsDrXf3942fukI54ykvB5f3Yj1FmGbJ0mXK3b5d R/TvLF9som678x4lQcRywaXX6JtFKyjiitBD996t1HRu/rC+SkiK0d133I63mqSTTxjoaFxTkuLV o3c3fTJpvNLTUpTH8W646QasyFyNOfIYOHy/1nGjR+umay5R1xb1CRlNo6CjPbeyDPKUYXrlxU8h gXmWG74cy3CMBvYfoIsuuRDCgNoU8B2k+x55XptW/eDIAS69/AQ98egt2rphlSZ9/iWWX5WWsYhm kRtv2qSV3nj7TcYWr3c+eFcnnHAiOMZP6cSTR+n6G64h4FBMu10KCrTCUc8WF33rflsLhQG8NG7R TH379YUTeI6S4xOVmhgL61y61u3cqCGDD9bML77AumzpoF6tfS0pKUr33nMPyj1OF15yvjLrl0IV uw7ruBbmA6hyiqUNpZZjL0pPTaQuINX1dCYlxKpTr36av2iV5sDX3iKng9oTiejevYdmz5qNMk+D Vz6GPH9dDRx0kN4hotG8WY4y0pODD8EBJo3Cww3PQHgG/k8zYKLbB8CLYXdmA0edFFei6/92H87K q86BMFrsEuRYm3ZtVZZQD4emgxYtW6WWLRpo7D9p9U2IUt/uWbrriZkafcr5rljOwLqW/bhEX0yZ RkR1s2tzSyAKWbd+Y11x9f166vEbMRRoB6YzKRCTCPtkLb3/3pswWt6q6uJKvfXmDbrt7gHuunJy WqC4i3TsccdS3zTPyb1WrWGkpNi4a9fe+gFabqvgNxKYU0+5WPfc84guuOgMapLa7JZpVuAfLFH+ P83V/v7yflfqoTrC0G/XxIWX2bFzN916SyNthRO8YYN6MJ3VqNvBIxxyUQSW2bPPPwvgQLz6d3lW BdvW04oVpYaNsvTAP57Thq20OeBF166XrnvvvherL9EVZnQZ0EnRhF1efu1Vbc7NxeuNVw68vl36 9KH7LMvlUkadTv57ZxERgFSKMryw/j/+8QiUfYWOK91av3p2649H/qNq16lNJXsyXvllWr1sJZSu dZWamqLzLr5Jo88rpJCvSLUy0tWeorYjhhwCt/s2ct1pqg0N64yvZ6iwKA9AF8vhJCmWAVYZOA3F dD5SAinJtXXNXy9WPNSoNSAgnXflOUpMj9eY005z586ul41lGoCZ6HgNoaAjmn7Q+x59RHHJMK3R 026e+qXXXq0tW7aSgkhSZu10jX/nOcgTmrtq9YqqMtfl3gjGo9vvf5RiOz90iY102003MZZopdRr pIsuulCbNm1Wk+atGGNA5513NobNajVsWJe/Y6Gqra94DIvjjh5GhARghz8ixuL+fgLD5wvPwIE6 A4C7WMW4n4qyI488DsyLDnQHNUenV1DL01FZ9WDKPOhsPfDYP/Xm+EUacvjRyONkDYKONSa1jtrk JOrUXUlqVM+irJQAx6erHQr3gw/fUDIpy4svuNThcHREnnbt3lEdu3RykNmhYre2nbtq5OhiJSen CJA4XXflperapimzWa3Bhx6l7TvK9Nqrr6lZk+ZKR4+MOfV0PfLwYxoPC+WQwYeqVnoWx+2uHDje Txg1XN/Om+uUum1e+9uBV/luY9/vSt2bsNAWbDEwPAC8zYxMwjT8hLYs6y+3EAioZympwR52lIoo jtu9JdYS9V6/uqXE1Hbvx2anqHZ2nd37pGc2dK8dzay/Fje81u7PbNEkJlFAgYW499aiJTznwe/E 0/jeBh730N+ZdTKUqT3jdh9QpFevfoPdh2iYvOe1WbJ2vX6uq8ZY0wwdD4SlpDRvZmqoCk3J8jDd zfBoR1te6FyxcdaT6e2VgIFh+1hfu+vRp4KzYRPvcyNcqJvVknG2dTjzkZzLvuOn5iCVHzt/LO16 sTH0tgfHk0Jbm/3sOVcsRoGXZ7ItKcVDnksiLxXaZ/eH4RfhGQjPwJ9mBswZq46gH904N5CZLVv3 dz+eXPBr0GF7WNL+dsPVu+fF5Mchww/f/fe5ZzXzas0B+KoKpOiKq/7q5FFIS5Tt2KxPP3hfw2kN trSka7WlL972adKqk/txchz/6NzTRgTPD1ANZDEnjznlF/fj2uuv+8l7xxx7vNMxhx4+YC+ZduDl 0fe+qN9Fqf/6yvcU3b/a9pVX+Mvjesr0f9p+/vn/tv+/vKaffbD3cbymCs/w2Hv76d+//lkIy79v 334OwCbEwOegavc63s8v87de1797vX8aiRe+0PAM/Klm4Ocy83+Wof9KfpjMK8YzjxOY7xEJjpq1 ChTQ+vWy1GlQb9KVoIY61JhfkY2u/SwkD/93Gf6L2/MHijr+P2sO1LODHPpPAAAAAElFTkSuQmCC AG4e8LZdAQANOkkjEp1gNeJEqthqKB4p/4lQTkcNChoKAAAADUlIRFIAAAJJAAAAvggGAAAAIYib vAAAAAFzUkdCAK7OHOkAAAAJcEhZcwAADsQAAA7EAZUrDhsAAAAZdEVYdFNvZnR3YXJlAE1pY3Jv c29mdCBPZmZpY2V/7TVxAAD/kElEQVR4Xuz9B4BdV3IditaNnXPOAaGRcyQJAgRzGA7DRE7WjKyR /Jye7e8nP+vZlsf6suxnyZa/LMkjSxMkDSeRHOYIIuccu5HRDXTO+ca/Vu1z7r3d6ASwgeEMzwGb ffvcc3aoXbtq7aratb2R0HDU5faJRD0S5b+o4OL/IvgvJIGwS8JujyT7POIOjoq43BJyefHbJV4+ HIyKy+eSEbwTcUXxTES8+I7f85e48T3uR8JBPiEet1fcKDrqCkskynu86xa32y9ul18iEbQD5fKf vq8XyuUfqC4cDqMJLjzv0frwFNoZFp87jDq9EhSPhPBcNBKVJA9eRb1uQXsjbhFPAPf5HluLPrsi eM+P+vBu1Cv8xSsciWj7PKiDdbnQZ14RNoFl4zOLjoZCSg88gd94LxoStyeC33gCfUHXDS2iLtSL MtlXVOJBmXwPPdH2828X+kCaR6NuLd++XBYRSBOMhE0NrZPtYj+jKB9N1bY6l0MBhwIOBRwKOBRw KDA7FCDakVAwpMDE7aHqJwgAAPICNESBZggQPF4JBIKSRDUNZR71+QEEAG3wjscN0AQA4PV7ZJR/ A0x5PS7iFn2VeGE0MCJ+X5KEQgEFD1E8EwyhbKAIlhOGok/2ACApEOnFuxFJ8iYpfAoAiAAC4FGA qyiBDcCFgiiCC37GS6iHZaNWiQLw8flwKIg2hyQ12QfghTLQB1SDZ9GHkBdd8skoQJ/bh/4ASPl8 PrSJoMcl/mSvgjGDPFza1gg65AdNQoFRA5L8eB5t91m08eN9fuFF/YQ/o6AJK9T24X9elq9l4j/U TdCEHhhwhfvhYECSQBcP60A7eE/bFDRt82BsRlA3gZFiT7TN40FNAIqh0aDW5XZA0uzMCqcUhwIO BRwKOBRwKAAKeCMAHENDw1DWSdLa1qmKPDk1SQ4dOiCFuTlSUlkrPUOjkp+ZIcM9rQAQydIzHJH8 onwR3AcCEmh3OX31At5LlfDAiAz0DEheQaEMDA5IcnKSLFu6GGVfl6Qkv1y5dkNa2npk/sL50tXT oWBmzrw6OXn6HICRS1YurpL0tDQ5cOqEdHb2yuJFi9W6EiJIS3IDQIUlKTVFevr65cKFC5KZkyXF hYVSmpsCEANQQXACIJHs9wP8BeT4mROSlZMjQ8P9kpZeKJ1dHZKTUyztne1SUFCG8nolMz1FGhoO yqJFS+XatWty5sxJWbJ0gbR3D8vV652yZGGd1FRXypWWZinMywIQcsmRI+ektGaONDe1SGVphQwP DYoHlqSD+3dLRW21ZBeXSnZ6powODEp6Sqpca2yU8spKpcnB/Xuldt580Fqk4cJFWbRgviyYN1dO HjslFy5dlQULF6KNOdLd3S21tbWyfft26entkYVLF4HGyTI6EpChwWG5chVllpVLXd18WKIIyggz ncuhgEMBhwIOBRwKOBSYDQooSKK1g9aJU2fqZQhgpKK6QqL+FBmG32r/keMASUEpycuW4a4WycnN k0stnVJUXChFWdky2NktSQBQDRevSVVNlWT6U6Wjp1m8qZly/XqLWqOy8grlxInTUlpSIhnpACy9 TdLT1gG7TxAgJSQnjx6XphvNsPqkS15GgcydWyrnznTDihICcOqT/v4hWEm8kp0XlrP1Z2TpsiXS 1tElLa2dUpeTK+cvN0puZp0kwWoU6O+TvXv2SE1VpSwAeDh1+rSkAgTduHFN6haslTPnTsqKZRvl OEBYcnIuwE+mZGWky86du/B3qly+fBFWH4CX82elsaVPvHjGBUsOrTsN9WelcMNaGRwclB07dsh9 eH7njp1SW1kjWWmpMtDdKan+ZGluvCGN6N/qFavkRmOTpAFY7tq1S9Zu2IB2t4kPViiCsbaObljK wmoVcsMqdvbsOens7lV3X25urly9elUtSF1dXVJQWCA3WlqkqblJiotLZBTWo4tXLokPZc+V+caq F/dPzgZvOGU4FHAo4FDAoYBDgU80Bbx0bREidXT1yLnzFyUAZetNS5eq2vnih2uorf8CnEdR6RkY lsL8Io2jqaieAytQl/R1QWFn5UhWbqHk9PVIa1ef1K1byMgjSUlNkzPnG+BmS5ZhAK+LV65KD8DO px59WObXVkhmVqqkALy4AA6OHj+JWCZYR4JdkpWfDI/cqER8g7D8pEh6nk+OnD4DN5NLlmTMl3LU fejoWamoqoJLyw2YBXeaG4Au4pV0TzLcZ6PSDyvTtcZrMhfWGVq0Llw4L36AlytXLsvFC5dlZEik sqYaQCMqx46dkBQAjfb2Lnn//W2wJtVJdk6+7Nq9A2UnS7qkwXLkhhvMo27BUQC3w0ePAQDekD0A SnPnzJUegJ0bAD0VpYVoV7lsB0hzw4o0PDICC9OwXDp/Xi1Jw4GAzJs/VyrKK2THrj0ygvit1PS0 WAwWwRFBUVlZmezdu1daAIrS0zEW6Ov8ujqpv1gvZ06egmUqXRYtXCQtTc3SdPWaRNauhYsTrjsT UOZcDgUcCjgUcCjgUMChwCxQwEu16vcnSXtHkyxZvlz8AEhnzl+Qs3AD5QCk1C1ZJsPXWzW42Z2U YgKnATiq5syTc0dPIN7ZB7dUt7TBAuKHW6m9e0CGAXgYP7Tl4a3qMjsKV9r9W7fIIADD5evNgFyI L8KzH+7Zq3FIBDNlNfM0qLmp5Zp44FarrC2VxYsXSf25Blmxdg7icmDludQiy1fAitTdD4tXGLFQ XmlD+QOw7Jx/tV4e2bJJCgC+VqxZKxVlJQjc8UtBSQUsUcOwFmVKS3urfOMb35LW1mbph6tw1Zql 8u6bbZIDoPetbz4qly5dgvVqSE6ePCsrV6xA2f3SPxCVkf5e8ZYWywBcZy/+9OeSk50jv/M7/0jq GwACQYvFGzfKwQMHpKS8THYfOgja1Ep2YbG88/bbcFNmS15evnzj69+Qa9ebEMMdlaNHj8KltkB6 ARp7+wbUBUc34kLcW7xkubS1t8vw8LCCpStXrsAV2AAX4GmZv2CefPaZ5yUwOir1p88icF4kF21x I5RKo8Sdy6GAQwGHAg4FHAo4FJg1Cni5g4vxxGlwF527eFkicO34EBuUmp4qfsYQwaUThBXHDZ9c a+uAus8Cnn4Nyk5O9cM91C7hPoAebjILQXnDJeWKBiTUgn1mCGpmcLIX5TVdb0TIjEvaw+0aWN3U 1SZhAAyq9qst7QA8XdgJhpgjWF8ar/TC/SRyvWmPBjjTiuN29ePJiJyAJYXljgaGEaPkRdxOD9xX COxGoDddhVlwv+UjTimMIGcYaqRm7nyZU1WLGrGrTUbRp3SprimXEHbtub0R+dILX9GNfD4Eo5cg jsjtiQK4dEpWdgoCv8MASUFJTUnRHXSPPfGEAqU0uOfSEWtVVlQCVyUDyD1S/tyzoEkYAKlc47aS kjNQb42kAEQmA4TqM3AB0q85uGypJAEkuhCs3tuPuC243/jFQsQiRUDf/Px8xEsVaPB8JeKYCEwZ wJ2WBksZ6QwLWhhuymEAveTkFLQdgeYMBDeb8JzLoYBDAYcCDgUcCjgUmAUKeLnLC4YbWTC/Eq6j ct3NpQFK3MKPX3QxubFbTU0+UOB0e+kuMWyfN5vfrR1muuWf++Pj29TNPjmz3T0KkGFvpTdb/LlD CyVwd5cGHONJ3GSZut2dO+NQEd9h3JTb2u6vn4EUdIcZdndFtDGmvdw8TxCh+78QR2T2wJl/dEW5 3Gl4HjvnUrJMu7HrzY20AfyebUhBwDjfycjic2GAEhcAi9npprv60d6CvBz9HEaMUirADzCStsHF HX34IhUAinWAPJJVivK4RV93smHXnAtgC1dWdpZ5B33LxWcCT31Hd/CbbfxKZ7aJAM36m8DI0NBs 6cvNRbvhLlV6mQwJzuVQwKGAQwGHAg4FHArMEgWQxgc2FoSzMJ+PGjRmdFl5lPRZkzYgfinCUiU+ 9hr/XOK3U303TYPGv6pxOayfqMZKbGTnGsJdxhfZaMLt9Zvn2FoALnOZ9hOA2RfjhGIvab4ibuNn igQDTlgm3Wgu7MIjZvOQpkiuoE0goGOd4yhiiuQDBiwRMCZeLJuWpMTLy9QBCa1UoAgrm3M5FHAo 4FDAoYBDAYcCs0+BmBamUr69i9ajBM0dK+R2y7u9Vox9y6rb7lNC38a0atImzqDtsbLZfft5A6B4 xapMKGrCUvXmxPVNNSbxGmeDXk4ZDgUcCjgUcCjgUMChwHgKjDFVJCrlRMuGJlbERYsKXUCq1i23 j8YLK05i5mf8qLcuDhbsCu3M0bM5BIntvRPlz7itiYmu1W1GIhh3Ga/xVqKJyjVWKSdj9oxp7jzo UMChgEMBhwIOBe4wBcaAJN25xuNG4ObZv3+/bNu2Tb74xS9KRUWFKvq+vj6NkVErBv42yp8IyUpk CB8Ts2G7NGePiavhdSeUP0GFieMxMUwmvunugQyCQduao1Sg6cgCjOwzA7BtkMR2Tda2RKDH52cC qO4wTzjFOxRwKOBQwKGAQwGHAqDAGJDE4y/asf38u9/9rvzZn/2ZLFu2TDYgAWJRUZG8+OKLui39 29/+NnaW4WgOoIQYJEGUMg1LjOthhEwAgTl6PpmChzuTBVoxSULczu27C2+PD+yorFgkEa1ouMkz 5lxWPJOJZbLOm5sCwLHtfNa22N1ei5y3HAo4FHAo4FDAoYBDgdmkQAwk0dLBYzD+7u/+Tv71v/7X 8vjjj8sPf/hDPR6jqem6gqR//I//ifz0pz+V+++/X3JxFIgBJgYE8XiRP/mvfyxtvYPyb/+f/1ve fPMNefW1N7Ss2tqaWJvtHWcfpRPcRWZisqPyv/7X/5LiklL51FNPxgKp7R1iH6WO6d4lOEoMmWbW cu66a0TSzP/8R38kPch9RJo+++xz8swznx5jSSJwtHf68Rkmu3z11Vfla8illAt6j7+0v9M1yPne oYBDAYcCDgUcCjgUmFUKeGm9sF083/nOd+TP//zP5emnn5bs7Gz5yY9/LE89+aQcOHhAY43+/X/4 fambv0Aee+wJcdPDhqbwEFp31COu8KBse/NNOXa9T7799Wfl4K535Hvff0m+9Q/+mURHT8ruPTul Yuk6WbNmgZzevV/6BkeRgXtEtjz6kGR6B+W1t/fhkNdh2fDgE8ji7ZUP3nkHiSqRFyg1R+5buUz6 Olvl3fc/lKXrNsrcxQslMzoiPldYduJcs8KFK+VJgCSJIJV2ZFTe235AbjT1yOYtGyU9MyIHT56X AMCbPylfHnt4k3T3XJU33v1QykvmiCctQ6qKs3GsSqNsWL1cThxGMsiFSyXcjwzcKLtizgLZci/e QbLNd7dvk6qi+RLJSZFNyxbJ7vd3yuXWVnkQ9MpB+oBktKe37ZLs3/Gu/Pb/8x3p726TP/wPfyjr Vy2XS1eb5dzlBlm/abMsrS2Xc8fPyraDu2UTyg6Ptsmbb78mjz3yhOzad0ju27Bczp86LqcvNMni ezbLkvnIt8RDejXWydnNNqszwCnMoYBDAYcCDgUcCkxCAexej289fxKA6NSpU/IHf/AHOL7jgvzw r/9KQgN98vLrr8nKNQAin/o0jsNYanL30I0WcyHRzhHC+W44/LV4npw9dhxnrrllyYr1Mjg8Iq// 3Z/LYZzddiP0M/nrv/pj+Xf/9vdwKG629HYOSCOA0sqKsHz/r34sFy5eki92Dsn8giT5w9//jixZ u1oOneqU7//Z78l/+4//SW70DMnoi6/KH//PP5N11cx1FJSMlCTxpqThuBSTxqD+xEH5m7/6a7nQ 0CL79u2SL7ywVf7hb/8rWbtqg1w8exXJJv+bvPx3fyoHz12TLCRhjBTMl998dr384f/4ufzor/6z /Omf/ql89rf+iTTsfFW2HToq15sj8r///I/lh3/zp1KPo06SRvySsXC59D6yVP70O/9dhpLTZN/Z evnOv/s9SUYgVpInjASSbmTJbpKB3macdZeDpJjn4cJ8UU6ePyevfbBb/su/+C35/f/r92Uw1QuQ t19+6zefQj6mXPn77/+tDMHlmZEckd/9R/+HpBVVSfnJRvlPf/B/SzLSa9/NmCtnxjgUcCjgUMCh gEOBTzoF1N2mu9Lws3XrVrn33nuRyToJR4IslkMfviv1x/bJ5556SJ75/Gclv2wBsBGyaSORoskj ZDmBmAWSMCU8IovmF8mBvSdgoUmRzMwcGQ0NSFp+luQVFiFb9mUZ7BkUV1KqfOO3/6l0nNsrJ6/e kBVVxVJbUSAXLt+QtuY2aT19SZ5/7nPy1W9/QV742h/K2XOHZe/+fVK34l7pxPlw1681I5V2rlpV kBJSsvwunOCGy52KA2MDUlY+Dy7CDhyae11CQSRdLJwj//r3/738l9/7l3Lk1Ek5ubde/stf/61c OvKy/GD7JYArZPP2ZsHSBFrAUDMM61p6VpKUlJUig/g1AJ4TcnD/Yfnez38qu95+S9490ilvvfe2 NHV2SOm8fLly8aIMInN2tiaG9II+Lhzg2yX5BZnyJ//j/yvRUA8yaGdK2o1M6Wjpll04jsXj98tL P/sprFq9cuXCAdTTIDve3Ck/fO0XUl6QIzk4J+9GJw7w9cNSFw6iXVbup086xzr9dyjgUMChgEMB hwJ3iQIKkuwdYtxdxeDt3bt3yzmcFdZ09YqEhrplsPO6nDm8R+YMD0rZnMUITjaHqeJ0DCITuNv4 ISKDvV2yvqJEvv+XP5AnP/8puPHa5NKVc/Lnf/0D+dxnvioZV9okMuzCwbQBZkEUNw58HQmnyU9/ /KY0X7gh8xYuBs6KyILqebIDrq6cX+TgvDcCjBKpqqmR+7dslmacETcP57qZtN9eCY6OyKkDe+St d2olDeBu3zaAmPdOAuwtkUuXryOTNgKiQ349uiMUHsJxIV4cP1Ihr/7sDYl2H4bbMF1S4Vrswnlu L/7sJTl9pkE2trbJ//iLH8jzz39GsjI7ABpTpaykWF7+2c+l5fwl9L9IKqtrZP6Sbtm4+UGcZZck Oci0zWs0iPPU8orkO3/w7yUvk9AtJD/43n+Vt995S7Y89IwcPFov+cXFOCC4V77/d38rV+HmW7O8 DEeZpMoXvvQl+fM//e/yT/7xt2XOggXibrohv/jJS/LPfufbkl9eoJnLncuhgEMBhwIOBRwKOBS4 OxSAhyq+TZ+ff/SjH8n3vvc9DcSuLS6U//dP/6u88dKP5LVXXpJ1sI4sHgxDgS9HmgD7eAyz8z0E 4LR+yxZZtHSJPIlA5fXYFReNFsi65UvlK1/5knR0BeWhB7ZIRmaabH7gQSmCZSl34VwJhvNkQXal /PzFVyStuE4qKmvlmYdW4RDYg7L9w32IhRqV2jnL5du//dvy4stvy8ZNm6Q0L1stXyGAs40bN8ir 726Tv/zuX0p5YYV8+tH75UIzrFi5brmnYgOOACmQxx/ZKlk4a+3e+zbB0jVfan/zm/Lfv/tDSY82 wso1XxYu2yTPPlIvR4/XIy7oMVm1eKl8+Vu/JW1w/z38yAaprpgr3/rWN+Qvvv898QylSNr8DPna V2AJa/nvcvzYMfkKAq59OJuNR69k5uTJPQ9slRDOluP5cF73sKzfeK9sur9BMnA+3gOb18pa0Kbz C33yMwbB3/OA1OBw36cR4P31z39Z/vJ//bmMjgSlCFasgZGQ/Jv/67NSXpTHxFTWcS1OCPfdmRpO LQ4FHAo4FHAo8EmnwE3JJEtKSuSP//iP5U/+5E9k6bIVklM2Xz779d+Szr5+efGnP5NN3aMyp26F hiMxaST3XeH0MFiVkuQf/+6/kZA7QzZs3KRbv7YAALh8IVm3ZhXsKX4FUy646hat+F3kEPJLyso5 shZHg2RFB+XBRz6NcpL0UNr6g9vhvhqUG939ADYPS3FhmdR96Rvy3Atfh2ssime4/z8oYbdfvvpb 35av/fbvyCi2l7kiXpyP5pb7n/w8DFz4nuem4f7ytRvEGxyS/+Mf/ksEh7vkBwf/UkYCPTjINiDf +sKDkptZJH/wnd+TUfQpCS0dDvtl1apFkgb3oXhTJTiIuKS9b8swwEt0wCOffug+Kcorlz/6wz8C UOO2f4BEnKFGOlTNq5Pf/Xf/Bm1EMDvuRNCmeXNXyP/40z+DIciP0vEUgsu/9lvfROzT1yUV4AqB XzJn6VpQyCP/9t/+G7gMQ7Jly1Y9xJapAUZHRnEAsFtwGvEnnV+d/jsUcCjgUMChgEOBu0aBm5JJ bt68WS5duiS1c+fKI888J0NAAcnYYfatf/R/Sk5BqWx+6El4ynhuGfxKTORIKKAHmOGwV1hSgro3 PwQMExZfBGeNjeJcM1idQhIAmOB+uBC+98NFR1CBoGv8HQp6ZRTHqPlQpMBytGjxfPnD//SHMop0 3jkVCyXZD2gRiKBeHhYbQI0+PSA2hDgdOO3wg+Nq8dkFa1Z0BPcRx8MsTlHEK9E16ALYgFMQvjC4 vzwh+fTnHpNlm++XnOQMKa2sFPjsUB638JsD13TH3ijaCfwyGuS7HvnsFz4r9z72gKR5yyRnbpkE wgHxIoDJC5BDMKZHsaGuED7oIbsAaXwvGgXsCiBeC+DO7QVdFLyhfKBBbwoA0CgDzk2dYQA6D4LR 3QBTowBdXro1AahwIpx1qPBd4wunIocCDgUcCjgUcCjwiafAGJBkHztSVVUl/59/8S90x1gQijsc cUlKWp585Tf/mRKMJ88zaJph05p1mhjJA5QDEMQCeeArgZPGOhEX4Xs+61FQxQNmAWr0YFfsBmMO ILzLlAIEAwQ3vpQcqV1YYuoi+GB1/K15mWihYfU+DdZGSQpwTOZvZAz3u+H6omvKgCYXEzrivrgB 2DTAXCQnD0AnD1HaLN/4ChEYjf7ACsU6ktBEFwBThAfVsm50Lbe4UnJLarVGYjk344M02zezZGuL TEoEdYuZQ27tA2693EWnhKC1i+1Du3zMTB4G8GOPU8SjNGE5SQqyTLJOWJ1cPvH6CaEcN9snfrY6 BHAo4FDAoYBDgbtKgbHHzFPVQ1HbaQE8zAStuh6PKSAwbTOgwOTrsVW3WmoAjgg9CIR0MxYecfFV uqSs5N5afsKBrh5CHbyKpAISJerB/zR1olUXbDEACkApLEvrNCCJF+7G2mEi0M1r2jINcrbcU9oI q+1q3aHtyRxLq0/ACharUG1TdscAnFiYghY0zjqMVptp5ytKwC5aY2JwdZw4xpKll7FWsZHaZr0N i1RCnXwN2Cmh/bGeWGU4vxwKOBRwKOBQwKGAQ4E7TYGbQBIrnPCIj9ix9lM3yT7PLPbU9Df0UQt/ WK/FX7rp9VmhiAFI8WuaWsY2bty7t9qgO9OjW22F87xDAYcCDgUcCjgUcCgwNQViKQAcQjkUcCjg UMChgEMBhwIOBRwKxCmgx5KMIno48cR6h0AOBRwKOBRwKOBQwKGAQ4FPOgW8BEgXcASJfYabDZY+ 6YRx+u9QwKGAQwGHAg4FHAp8sing9eN4jJqa2vgxbOPoMf1hGNM/8etDYpNY4OMRVfTLprsdlf7x oMbHlcfsUbr90br9N2+FJnejlrtRx+R9Tqx9PO/OZstms6xbGcE7/+yvb88+Cu0cqkxPvY8uBWc2 r6dvCZ+41RHzerwenLGWgVc11eNNtXDjujl0xPy2VWL8SWuPf+zdxHL4ObaHzCp74npm1r3bferm VpuSpm5L/FukEODRK64w6GB2xhEu/XKv8XS/k60x6QvsHY2mJuSRUo6YKMHldGM88XjY8DORtpON 3Gz2NhHmffRRHQsadd7gFrJoJFBqprXY84fPz/QdmzLTjcFYCo5vp+nFR+FzU0IilzKdh0ebNb4v E7V1MvA9EzpMVJ4twdgqJvHgpftU8aMtm4SlpqpvIvnGsvhOfF7c2kjMJmffblljW2z/ZVMpcU5O 1rdfvT7PlFakgq0RyTM2h0/2/nj9Z+aVuSaaB3Y5M+HzsXVOT/Pp6r2VOu3apqvVnl8Mf6bO4O+p 5ttMx8Gul2Xa46DZCieRWvG5OlZzUhboya+TXmgxD7dlRSzfmtwW1GJ1moUafQpyyzpKV3WJez4O MECD6ThzEVkb5XCPOX6UkVwJwkj7pFmP8OaEm+puHvHb55eEsuxBQpt4em2sTN5Hckdl+IkFJCGR C+DIg0SYgsSYYc8I3khB65HYEpm0bR5nd+0hG8NmE8n5W+HDccNmoIpdKNqk7TbCmCkGbqvoyXSR 1mWUu1EqrD3ZahG/QXJQrZ8slACUNGEox5ljPFGLzHgoEOJ44E9lF+SJiGg+ciSLQHlaDO6HTLop 3DOpJDSJ1C1fk3dS+xijKltlIJpdCwHxpJc23Lr0IxttRkmbj+9JOc4bnLMsSI2lpGKGMU1zMebS ZF9KDG2BdpZzi79JJ4tHrVxfE7XJKkFBvJlnvExesqmYgym87HkeAqE9SI6qNNE2I2HHTaDG1G7q 4ZMcf7s/Jgc/73IMNT+sygtTRzK6FEFyWeZNM9xst5pdtsqhDLHGxFZHcWrF64rds4Yo3s5ERWZ4 EydG6hxWWuKoILaSqUBIY5eLCWpNQpHxl6Hk2HQn8bZYiwebD1S+cV4ijQnzpYEArB0pba00KJxP zHjG3sXLTBxSU5S2zqLpRHyiE2EMzePL2NuZH+ZtU6/5ZPOO3jHDrDogmboAVTOvHcc1zM9Wa2za WY+jh2P7asq1v2UiGGOZTwQNhmvtdsT7aIbYAFCLRKaVJJ61gDXycKq5Pjlt4mVOwATacCo/POXG +JJvXJyb5Ceb125+z8hqq06d19al/G34yhJ9pt2ow8w8psmxcs9M0Jx4qXHakdOUK1hMrJ5Eathy l1+q2jeXfTi9vjXRgnfM8Fizks9ShsdByeQCJojnoGc1b2FA5bvbmiPTJ7aZipchWSgTXTgVAwmb zXj4LVlu6Gp6Yy/wzWfSnJqL3/sV94yq/NKciHyWvGTTxvoNaiXgKjvHT4zPDBl4JU7JsQLLpHSM jwwaEBOq48HQJIMwhhGsgddKxhPp9gSAKcdqY0Lf2KupLELWW3jXZljmUAID26AgoTk39yyRW8d0 cIJ+jf9+4r9Ne/h/M9jxts+ErpPUYWTShDweZzT7EwWSoaOpP5Er7PKnmGyxJiSMR0LVJpdUnOoz o8pMnppaOI7t522MVaJUigl5jg56pElTDbazST0RZ4+109pPGCAxlncn74vhArOSig9o4tycnAeY 18wcNWS4imNB8R8HWxO9yyeNQIrJXH3MVlZYTPA7fcBaGpEeCUXFJQybHC/F5nUDB+KKjwLtJgpY N8wvG0Dwsz0vrBHW0wB436wcbfhkAMv4Us3fdjvsJo9VwRONheFhfU8Bpp2N326ZGdMxbyb8Ef84 2Tyw+5TYEjMOUwGEiUYv8V5cghDAj73sltjSXNto8ctkqtzojXhfx5YZp9FYutsSze5PvB2GxxLG M8YruGdWT9bDk8+Pyb+x+OamB2zBmPiFLaPsnlu8pbXfDNBu0i8W8Qx/xBgsgdOm91GM5REzGPYY jV/P2M+aqiaiQOxNqw0TcIohvl7xEuLcMDVdCTrofSEchv7UxYOtd6d+c2qetceB7eBnMx5G6iZe CeOjKhlclFgtAa+Fi7iY0fyOCrzj44mchRTidiVG/dr8x+d9zJxNwKZI1wJLWgmeVHRsNYkrJE2w yBUaV2eG0Xl2mhlBg8S1bivbtt0VPsuAcRtcMYu1K0FgGhQ6MRCwczrFgdl40hoiMc1TjIFiRDLU cWmKa/zH7N/WQ/ZnbTqSWZqVrV9pQ+HnAjVDfN4aotj7OgIW0EtAH6Y8m81MA2J1aKLOBEUwQTti DKodATpngk2lE8oiXSewMCT2J5EqiXXp+7YuTniIzzAxpn0+n/kKqwdmLme9YPgolphu6zy5CMaZ R8OYpKMJTKazE+NncaYmHrfVnjU/tenogxtJP5GPND4T8ZnqTO0pqGv8lBrfv4nGbzw32H8rGS2i qtq1BJYZBTN+ZqVralX9OoH2iJVjnrJ+4gCWFhO+qzPDIrVhxrjlSCe38qAV8ZbIn2yHzbvKQPw7 kU9tvrZojl86DhY/GwY3bZ9sjmi7+ADaQHeY/Zxt64jR3ponMRra7bSEjyp/ZJNXy4Peg9DBO/Hy wDc6wGY28XvtEhdw/Bf7w2Tm57sR8iG5kH2gjNBuWv23hs1uT8xKwXMTjV9PedV03lJq2mbMY4un 3DhiKdGyHZ8b1mDbfbEGT9+LMYIll6zDp3UiaR+sPnNq8jNOKOA8CaItXhx6HcX4MLs+ZSPFmq51 db7ZHYrPF1suJo4dj2Riwl/tm8131jxL5HebT7RspXti28c8aclXU7+KFKtttCypjOdcZJtBV+UL pSN1hZkhHB+OlUkWbB5gvRxTQxFbz5gxNZThO/i/9Yx5yyza7dlu6G3CHbQPsblh5oHRDZBLOJkg gmOxqCf0pIcx8jRGJcOLsTLiNDDPxye4kdXg5Qh1GXtk6tbFoZ1IWAticmK2gc/bgtRUYHph+qfl x/jVorM1R13gDR0r2wOjb1r0jSmt+NhRNxqdaWpR+vJ9o+FjnVL66GREy6xTKAyt8QxVn56BylfG vjdeB+p4abGgL61p/I+nalg0jqmemKDi93Y76Hcxi8QQAIlaqSEjYuYJJY95drz8vklPxYcroZ/w aSlA4QHz1hxKGF+r+5bexnMeHJdGLrPmjsuVrPxDuxjrC+PHQ3OcOetDGRuaDg+gpAs48d7tQxB3 dRXPHVEBxSEe6hsUjx8Hx/rYGFLWCC0tFuYuDnBYT3kNy+BAD45BQ4xTFhQpzlgb7HMj3ikT7xsC 87BXHTKaFUEY7qjzodxAIKAHuZqRsAZfGR9voWye1ebDcSN83iYmfycKkEQhws/2Dw+JJRE5gcwR IhYwshkDfR8eGhQvhKUXbenv7dXPyampqrDDOGx2dCQkSSnJIKzewCG5EZzpNiKu9FQcYWIGx+g8 nL+GDnIA9DBaTg5LYxh+MoJCy0Vf7DYGgwQ9JtO5zRj2LkP+JoObZ1E2DoeLukeBeJO0nqGBAUlO yrBobBgusQy7XPs+f0+0k5H0N0LHmoAoe2BwGGMckeQ0HI0CmoRCwzIyCIdjGpicR76AE0aGhlWA JSX5ZXgQpk/00Z/sA/9gEqGPPMLG6/dJR1u7KoGc3FxrcuNRDHmYgIvP4F8QfDASwdl2oHGqL0U6 ezrVtJ+Sni55qena30TBbx+jQ8rycwhjxXaSZnzOpiG/U9FtKaEweEH5mMfDUP6DviGc1UchQ4AR BsiPWMs8umQ4liGcRahjx+9DxkHHcaQQtVexdp1sgwpEjL0PR9IoW4MWRvxzgsL8bL1H3iQtBweG xO/HWYY+ngVoC2Yj0NQphXuKY3hcDhUYzwIk74EmnL/kPR/nENo60DOIsvxIJI+ycMai4XnSJ6j0 GQ/IlS9ZggeAgQKfj4NEZGHlU0v4hQM4xxAxjCqMVEiS1+11HAEQ5MXgELLsm/FXQYkHOtrbJAXz KTUFefVRaATjHUR/mGc+MDSK+5hrpKu6q7iYIqAISwAHXCflZ0p4BGlKMMHSklPiIEmFPtqHsTYG daxT8Y6XPk3QaGRoADchN2CJN6CCFhLOr5DKnDDOgmRdQ73D0tzcCrdgQFLQjtLSUsMP4CVePgov uphCOGQatAiAhmkZ6TGFHRgZRqk+tB/jCABhg+rBvhEcYYk+ZiVLMs5uHMBZj+60ZPGFwOdo4kB3 l2SDr12pOKcRO4w5L3X8dOHhkeFhziU4RjBeHtCmpbVZuru6IJ/ngZYpFn8bGUIZyT5xEDle9rxg HzhOfGZoaEifsWWODZzsOT/U36eLFA94gP33JfnQZ+oBDBkYgmWNjIxIUhrGgDxp4QG3HuxtPFGq 4/G3ulI5vzDvqchd5HWe64lzMMkbPsiKCOYQbZVh8GWECg587EdllDccJyotjg/53mcBvMBwUIZG BlSeUJH5oJeo5MI4iHxkOCBp6X7UAdk8EpBkyGsfeJVjRn4jTdkGFtvV0SmdoD/P3czPz1e5n56Z rrOTc8QALcEYcE7i2HHqYAVXBB2cH1CmBLvKb+ij6hi218hPG8BynlIGcnzT09NwSDknlRamx1C5 qJM4ZpAt/O0D7XVFSDKSAhZ4sAEu5ZnqZdTLfvI4L20W+seyRiBDmlpbZRhjVV1RKZkZGWAn46IM Yu7yeCx+HsFB7exnKvhI57clAzmvbRk2hL6b9zEGVG6UfWicG/QOjA7ifSw18D7nloJmC3Qo1AQN 2trapK+7R9Jy86S4tESCaJsHvOMhH3CKYh76cbg96xwEr1PG+sEXI/jMfqakclwNDdh/W/fb/Ks0 4gHwmOtsK+8nJeH82EBQmpsaZTAwgrNm86WwqEhppXZW8NzQcAfkYjqOA0tC/WEZ7g/ijNgRUDtZ stNSKWkh68kDPCsWcwByAlQLy1tvvS1Xm9pkGDfWrlkj929cA2U4COWYJq/89GXZ8NBmqSkuRXwI mI0IFpUFYc0Y6BmQMycvy4Z7VkExuuSll34iDWfb5D/8x38u77z7tmx/74x85zu/D+A0Ih4flb0P xAUT+cxag8SwgRInIf9OogADI5K5k1OSMKnc0tbSJQ3nL8r9mzcooLInvj4PwhBkcGD4md9TsFy/ fl1u3Lgh69at00lD5WNpKwNeMDkpZDlR3nv3XamtqZEly5apMCHBKdQDYKbR0SF5/aX35IlPPyHp OWl4xy397e3y1vtvyFNf/6qMoG/J6BfNiGwPhYWXAmY0AKEEJrBWiKqYVXMSSRtBze/YdraXdaoQ 4kBbDMd+GsVvrEYjw1B+ngxVBCODowAPXnn1lbflgS2PSmlVtpbHMlhe4sqRNGG5vMf67HIpTA1g MhOPE8fP+sn4uNffP6CMlZyWBUEcgALsk5d/clA+96WHlen8EPA739kleXkFsmr9Cjl29DgA55Bs ffgB0A19SWYMUwhCqUP+4n/+T/ns5z4HAJ2F9rHvIiPBgIl7scyvDSfOSX3jZVm+ZrnsPLJdTpw6 KQGfS37jm9+ULB+EHgEE2NgGeRQ+qhxYi6UQduzYIUuWLJHs7GylqQeTb3gIY5SMCaArK6NEVCBy kqEBe7ftk0VLF0lmbqYKNK/fEoA4HzAMBbdj515ZuGghBGouBARohDqDBMsqHFVCaH9YJsecICoc DoovOUkO7j0oRVXlUllcIoOgSQq0tsYq8JxDCEXyJifsKz//hWx9cKsUVxRp6N4o+IegiWUSSLLd fiiHINrD8WO/VOmoEIFawr0rDQ3g/7DUn7sq8+oWyoJlVQbIgs4+d3JMefL5IO4Z4AtphzFIhrBB 1A7OfzaHVPf19EvDqXOycfM6HNCMNipApGXYcs8TTCvwoO6gwMbYDA/LSz97SbY88qgUgVZcbV67 eEV+9Hd/L1/6ja9CKCXp4diK2bhCQ/9//vIrUl5SIbmF2TJv2VwVujz7cbC7T/7o9/6tfO1f/VPx dQ/JpY4WeeyxhxXMcvx27twlK9es1MVMAIIxKRlzDX3paL0h9Wda9TDp4UGXbH1ktYKYEMEkAONA f7ecPd4o92xYLZ7kqLz72pvS2Nwm+eV5kguBTpBkwChBNReAmKvggysXrsiJkydk5frVKhson5Iw Hrt27ZGc7HxZvXqFtSiPSm9vv+x4Z58MdfbKvc89JJlQ4K998Lo88xvflMgwOBg06O3slp6WVuka 7peV69boQdq2rOD0f/UXb8qyZUtkft0cpGg5L++884akQR4f2H8c91cBECTJvHlVyq9J/hQ5fOik 5OXnSXVNqc498g7nBuVBMvjw/Pnz+uyaNWtjYNmoY57vHZBuAIdjh46jjlwZwDg+8/nHeXCnzrUg aMB5/eYrr8qnXvicglVk1lN5l8oYD/ASiIS5TB6BLFPFyftcDDMChm7niOzfvUfcmIcbNt2rMiA4 Ao4jT4HOtEqw/yGU5QKfRCiTQAfbssxxoAjt6uiSvfsPy6rVi0Gban2mvf2GvP/uCfnSV56Tvr5e ee3VN+SLL3wBIGdUFS/laQggwQ+Q0N/fK3/z138tRZiP2VmZshiyIgXgPQOL+VHObcg/zumrV67J 9h075ctfegH6iDqHc2YItM7A72HQN5XrHiMPFAwaWa7zEnX5uEhBfF9D/QU5c/a0PPPZZ3S5E6Kc RThNKvrPszvZLxfGilZ7lpVEUK6gHvPe8q7Y8pvzNRCAfIIe9kPODGN8uMBKsoDX7g8+kP2nT0lB WTnmxw75ygtfxuHwmHMo28fFFUEQ+nbjRrPshVx64YXnldcJIgNoMwEHr2GMf3t7B0CSJQ+TzTwf HRyQYwcOYY7kysGDDfKZL38a8xnzBH1g35NBR9bR3tYq3/2Lv5AFixZJY2u/1C2ok5HW6/LE115A 3xEDBL1AvRvCvPVxDmEu54N316xdKSdPnpHOzg6d67qY0YU2wCj6Tl7m5zQsNiIEq4z5A70PHToM OnohPzfKpQuX5Ed/+32pXb5ELl9tkhe++lWpLCvGQgt6A8aOzpbrsvfABXnosUclvyBVXnvpbalZ VigFBXMkD4ukAPQc1LmCeTwO4wMWruSyTiixXCDq6rl1kgYEfvTIUTl6cL8sXLZSlUQnEOGpfUek D9aTByHId72/DZ+7pDCnSt58dZ8sQ4MIklK5UgLzdLS3oswWyc8tlPMNV2TXvrclC9alkqL5cvbc RfEDtG99YKts375denp65OGHH0ZHD2GlNCAb1m+Szq5WudF8BaDoPplTO09OQVi/8vLrSFVQLu+9 /64KsGeffVaFxqlTp2X//n26IlgDgLd3714VoiTo4cOHpbi4WPbs3qeD+cTjD0MBuuXAgYOSn1cC Br4kdfMghOob9Ofs2XOycOFCCG+PHDl4SK4AkW7YuBoTplH++ns/kHX3bJZ71i1EjBgIDqF28uxZ ObZnj5TnFEpWWoZcunxJkrEiWbNho+z4cDfaMAqBtkxXERRcuTl5YIIT0t7ZLPfee49cunRJwdzc uXPV4nb69GlZsWKFrFy1Snqw0nnppZfVurJ+/QYFa0fRn7o5a6SwLAAAWi+r1i5QpdF45Trasl+F 5IkTJ7Ssxx9/XIER69i+/UOsGtKEBxefP9+ANi3X5yoqKuT++zeB0USOHj0kRzDuyWDgsrIyWbp0 qezYvldWLVsq2947IpcvXZWaefkQd8ly8Xy9HNh7WjIyzIp2/75DcuH8ZSksKND27tmxC6C2XjZu 3Ch1ixfKedC2vbVNf955821ZvXI9VjtBaWprkqef+RTq98kbP39NLpxskIKaMp3Eu3fvUoN8Um4G 2nxBPjh/SdasWiFXr19R61QGVvPXrl1DO5dpnq92ANc5oOMvXnlFvvzlL4O+9+rE/dnPfiZ9UFoP PfQI6HsG9G7Cd/eBDzkZu6WmskreevlN+XryV7D6GJILVxpkyfLF0tTSqHS4dqlV3nr9HfnKV78M AdyPtl2XDRvWyyL0i9ZJCvFuzI/XXnsdk9aDsjfJO2+9C/7eIvMWzZcf//2PZd2Dm6WnrEre2/2h rFu+Sjbet0YF8e5dO+X40VOydu0G6erskhdf/ImsXL1MCktyMGZ7AT4LVXGfBy2TUzxyH/q0e9cB zJk+zJmH0IdzMojFzMMPPSjFJYWyd+duCKgurNzmyJuvvysnzxXIuo0rZfe+HQCDSfLoY4+o1YZ8 dhBzoKi4CKA1E88XiR/Wm3M3mqTraosqspSkNHkPAKJmQa3s3/mhArKVK1fK+++/p0AwjeAE0uRT zzwrWbAcXjx3VnZ+uF0aLjfKktUb0Jb9kPWjEoZ1kUr4XMMFefv061I0r0aywWPFteXSdPk6vgvJ vj37sAALyT9b8o8VcNIyRqFdVlAKProgdWmFumB5/+1tcvH0OVm0fKn86EcvSmZ2lnRAfpy/cll5 bVldrTQ0nJUf/f02efrTD4FH6+VGS7089ODDsnPvAWnrbIViTJY9H5yT1cuXgRZcxQekqLBEqmsr ICgLAUIOyinwSQrk4L333KM0HYZFq7a2Fm0ISE9Xj3RAUZ88c1pKIXwDWPke3H9Mzpw+L889/6Sk Y04cO35CSjAelzr61bIcRV9GIY9eeftVGTrbLGULFkohVsoNJ4/L6cZLkldaLLv37JZUf7KsBX9s w/w5dPg4wP5ilXV9UOxkGMpZjytN3nzzPSh1gG3X/bLt/fcx3wvk9MmLUPgLZXCoDvJwvyxYsEDn MmVgRUW5zvk333xLli9foUqIC8j+/n7IpnShFckPmRaCpSZIcIlFBY0/tCS9//470nKtSebNr5Mg QMcOtHNeaaWcuXZJCgsLxQeL2TmAuGiyV7IL8mQ55uNQV6+0NzbL5dZOmqHkacjdnByjcPdiwdFw uUmeeuwB2bfrA+kZCsvWx56QgvwcaW1plp0fvCPdsO7lltXK+rXL5Ma1i9KMOdvZ2iML5iyWjOxk lAOrFnjqpZdfkvaWgCyCkjt5ol6++93vytIlAKtAApfgGdm3b7+C3i1bNitfqU2WVhf8q6qs1DGl 1eBG0w3Ztm2X9GBRuGH9Op1Te/fuUz6nhbMX857ze2ikT9JTi1B/vzz26FMACvuk6Xqb3A/Qd+LE SaUHFx+0ojzwwAOQt+VqsVQgBNkQCg/La2+8Jc1t3bIa8rUZsrizr0eWr1+PsgNy+thJqS4sg57I lQoAwIuXL4InC9CPveCrDFkG2u7duwcyv182b31Ejp0i8A3Lpx59CO9kKljZvPl+Wbp2vfzvv/qu nKs/Kw1n6mFhGpTHHnlMtu/ZBZDmkkULF6vFZtu2PVhMZsjFi+fhNWDfN2Kc5+oC7fr1Zjl95pw0 Nl6TeZABDz/8qLR0dcrf//DHkK/PyOlTl6X7f39P9UdfSwtk0Vk1SCzGvOIimyBuTu1cae9tUPnr hv47cvy0nN21TdLLy2XlgvnQYdulonqO0qynp1def+0tteLtBpim5fTxJx6VbR9sw6KjV5548gnV 9VevXAFvzwP/tsFKlCVd7QHMt8OyZTNAPV16mGs56Rkyt2YOdEWLXLh0GZalFknBIjEKq3UodB1z PiiNV6/Ju2/ul+MHbkjx/Pul6VqLHN62A96LFlm2bpmMYPG859AJKa2sw8Yb/PEICHjuwlU5sGev lBQD2Jw5Bd6OSheEV3F6FhT7WWmBUgkAzYWBdlOxavj0089K09VmWbFqKQYQWhbKMgWr/aUAWvt2 HwECy5X8wiQoNCBHoL9Dh+ulsjKqFpsrF85IF1ZRSVh1XGi4iAVbWCoq50IwZUNInZSr1xqA8lLw eb8SmpN8LVZbDRfO6ufm5na5fPkaJvwSWH4GpR9uPq6Wjhw5AkKe0hXOvHnz5B4IzqNHj8p5gJch MMVCWAuWANV2tXfKFSj1zvZeGemH5cidKkuWLkSZ5xXEUEDTVPr5z38egqQb4C8TynixHD94WkES NSPNg26sTEMAkYcPH5MSAEIqzvOXz8l777wLuqyTvfsOyuUL19CXdNCNbhYsIbAKaGxslDfeeAP0 qFRQ9OGHH+qKPhWg7/0de2TlitVAvUHphCB7+rPPyx5MjCq4QYNA4Tt37YbVSOTxJz8j2bBsnTje IC/94hX5zBcfVpQ9APcbUbdtbTFIPAo6HIcy75P58+dBAe9Ui9kNMNEqAI+cHFihYD4e6kdi0XNX oLiw2sV7LWCu5txidXHQZTI00C3lBeugcFE+XG/Hjp2TSgCtjRvXQXn0gn4XIHRTMZF3SUZuluzZ twcgaZGUYtVGoX22/pxs2rpFTuw7J61YqWx6dCOETqrUnz0jwyODsvWhB+QUxvjy+asyd858tS60 dPbLLijfDAj8d9/dJl4I4+WYiG9B4BMU7ty5R1dDVHpnMfarV6yEAASBcDXAsjIIwff8Z56HNRLA GwCHQGPXru1wxwhWLquxej4JK8AquFN98vKrb8OalCEnjp2A5ahOfvg3P5Tf+gf/CKvXbgCmUoCx HSroqVzoAjHu/Kj2m6brjPQc2btnP2g7LHMABuhtWr54scyZUytHcf9eCLCju/fLyg3LYQnsUUvZ p595RpJ9qXIEinYJlOf5cw2SmbdMAdhRKMpSWHDnza2Wq1fPAay+KwuXoM1HT8h+lEfrQApM2KfP nFWQVF1bLcVFZdIFy8sy8nPjBXn/rXfkRnuj9nfp0iW6qhsY6IWJux+/0+D+zJdTZzEHhwKSXZIr fV0wRwNQl9aVyuoNG6Qegvb48aOgMVe+tBolYYxTADDSMId7oLy6Jae6CIr5gKzduBZKFis7KI/m xhsQxH2ycM48WQoaYH0Oy3OvXNu+S+bWAigBGJwH8E11p0ltdY1k5KXBigxrFlaIjNvhAc9l1RWS B+XQcKFBhj0R6YIrgda2t94B0F6zQleRb771huSADw4dPijLF8yV4sIiWb9mHZRGqsypoaWlEUq2 DWMRkisQsDUocw2snqnZ3BEDawgWRAHQOgBAQEV65eJVqSqrwCr0qrwPvluysE7OHTwLHuC8Ckr9 yfOoL0dGh3vgqstSwbwECu8qFiptbR2QhZUqyNdjIRDGzptUWM09KVS2SdIIvt44f6VcvHpDWoe6 pRTWtg2r18ohyLnLUOoEUs3NLQAay9WablzjUambPx9Kx63AfmggKjVwpZSC5oyUDAHNnMaCp7Rs nixeuABA6DWVJR1Y+M4HsBkBsOnrHdQFpc8fgZWgF4DbDzl3Sl1UHgDdZMhz7+gweDpVXaRujKHx LjGGKojFTY/0DZyUisICyIzr0t/cKddQfndLr6ycM0dCWAyePH1C1t6zAcrztAxjnAuz8lBvH6zq lEWUe3Sth2QVrH+DkIU/+/FPpKPlKtyoyVI9f6GUFOSog42uudNoW50rQ62wGbCWJ8Oy1IM5eKjt qBSV5hhLLK19UKjXrl6BxbYHeqtA1qxeKfv3HgFozJE3Xn9T51BjU5OsgJWvEDxCE47GUAIoEAgO wWLSCZ66cu2qtLUPyOq167C43YfFQ748goX7YSwaWU8QOq+lqQuLm0VyaN9lmb+wUHZv3y/9Q61y 77qNsgcyiBYezvMXX/wxlHchAMExyOxyHUPqJjIKaUoLZAvqPAqLYjJovmLdatm+c7tkwi1EgLbn 3d3Sn94peWUFAC9XYKXMQ9kROXTgCEBkB7wGm2X322/Ljrc+lBt9fVjYBWXB/DmyPn8F5LIPHpz3 5QQWFoshS8qLy+Ty2fNyAKCdVtvcogJZD53YCavhwYMHYP0Ny9NLn4LRYDf4CPMTOsELuTbYPyin j5xS9+/yusVy8vwpue/BgKRnpUBWrpSCojzJQdqgmooa2bn9kDRfO6tyn3pqMRbVtHwTHAcx7knQ dxEYV+jqIxW4cD0M8Np++bI8tPVhyQfe2AOZ+Oqrr8vTTz8OPs2EoWK+5GVnypu/+AVoly4LwR9n jp8Bb8CgAyvV4YE+yIpcBUlRbK984IF7NQSIF524Ecs9RxnShTCPXuirfCwkOhpbZHj0giSllslx 6OyVq5cCcObDINMpg119EunuwHiskJ3QwSXVtbBWbpBtsJh5g9jX+c5722RBXZ0sXzRPzp2rhyk3 DRaXJKDwaunDyj3Jk4vGuqQQRK8oL1Gz/pWL18E/I0BeEMChHkn35Ul4ICzVYJD//ZO/l4eefhor j1YM7oeIO6CZzC8BBNeVlBVJPywFV7H6vwFh4sYKNgnmvD6AFSLuVMSepEFIFxTmSCWQuMYRQUB2 dt+QippMaccA9/dhMIEM6e/OL8gF2s6BYLoKRbxQTadE30T11yDoSmAN8EIRV5SWSVpmrrrLaoEy X/7xjyBUFkFZ94DYc6SopBJm96vwl8LsCBMtYxWuwOQawgCnZaZBCeXLpbONOhBckwTh8zxxYJ8M A6UH0YcIAqlLyyvk+rXzEKZJ0t7drUFgqUmpWKlcktAATP4woZ3GipMMyxUiAQ0taWwzVzQZWdmY LGWqjGCAFQ8mXlNbI5htVA6eOCIuCLVR+vx9BdLU3CR9w/BzYwzW3bMECrwBzLVE+03lydUQLUpc SQ4iTiSKNjLmID8P1oOM6yocOZk9WOGE0cdDsAaNYvxSfFkyr4ar0Q+hINYrQLh09TBcJejjKFZx Qy6s0A/LaKAPdMDKMzQC8NWuAseDmAyIbYC9FCj6XCmvqlRq8fIiPsCH1fk1AD/kUpA0COSSgiLd /eWBS629pw20Sobw6kXMR5kKwhTwXIYXMSlpvZIKxZyfVyOtnS2wSJZBeGbBKpAHa0s+VsadUlpY Ktfc9WhXSHpB03KAaV0lgw5XIGzororAytWCVakbyisrvVgKYanxuGARiQxJ32Av3JfJqCNfSktK pQ/grAar2WtXwd9QXhynkpJiCK6LAEWXAS6Xq6UkBS5hrtj7ILC4qvMhlioH1h8fXYrodxgxVp0d dP+4ANKaMIHpkoVLiYITgoQCOiM5U9LQ9yrMr2uNF+XAoYMaD8ZYBQ+EQGVJuXSCh+BrxXzrVjdh GngmE/OkCP7+fFhANEYKirSzr11j/yrKC+V60wWY272SDpN2SWGlZGXCBQkxkgO3Yl5utvblvvu2 yNmGJnVl3junTnqhBC9dvgIFVyqdWHzM8RRjfrpA8zmQCxngymyBdwllwYrTCXcsY3tocQc/X2y8 grFok+rqTH2ntLgKQjAf4KZDmsCHIbgtYHtUN+VJgPsh9JFgEzpbunuGIQMGJQCi5SE2ANwmPYEB eRIWkD96400ormKND7naBHkEoBzA/KPrJA18UQAZUFFRqqxGk38nFkED/SlqzelAXFsrQNLZs6cA vABW0ILOnnYIS7g+Yc0ZQlvyi/OkpKIMbl/wKJRFNehNwDOKcerobYe7EpZLVwrk3GXsmaiUIiwc +gYuSROsjNlFObIU4LQdiwgrdEZjYVzg6aRcjxzdtxNWGcTi5RSjk71SXA4509QKUAa+x9j0Ic4o C8orHS6sciw4GMdzpYmhArCyBZcrfU4CTLe23ADPrURowF5JwmKrB/26Xn8KFgjEemioQlh6URYt WSG4e0uwMCkpKYF1vgfW5Kvg4UEAIIAVgMXc7AJdsfvh+m1r65XFdXMl3NsqPRgPH8ZoGPKGsbDD UBr1hw/BjZYPdyDctpDFdVjkbnv3Q6msXoAHBIvNi9KPOlyw7qxZtkLeh9U6LztH5mNR2QLFc+rM GelAOfmFuSh3GOPChSXkENzugz2QmbBK5WRl6FxpgDWiCfMhCsDKxezePdtl/brlcFedgLsI84k0 gwwLjw5gTOlWbdCYqWiQoKcPi98uScK8C8ESko65EYCSLsLiJgD6dGN+5mB+M34oNycflvYndFfI bijdMOLFcrFYyM8tUHdhPyxHV65ehgWjQ+cVN+oUZJdJfjYUcw5kR1qSDHShHwA5bQC1fnyfkp6p soPu33xYaAvLSkx8KsblMqwZDQ31kOPDsFJiEU/371AQdRZIQV656oMA+jHQDcsbFrg+6MlTsLoM DIzASn9YXeyMgaJbvhUGgqRAEuRhhnQljUhBRTEWkwSAjNHxyuaHH4H3Y6OkoZxd77wvbdC1GnYA a29Pfw9k1xU6zmBFq4F3xy+Xr1yCNacEi6HrkD03EG4DnkN/fKgvGwuh8rxiOXfxDCQ9QB6AzuBo n3R3tktRQbYU5RRBt3VjoZYm2Xk5kDkVSi/d/IX6yc89sJD3g/ZDcGOdObgXFsCgpDDmCFbTG7Ac jsBCTffeBnhLrkM3ZGeNQA70IfVIWAqgDwlgujww+eKdq5CNHtxnuE8mjBJFAFinj56WfsSpVRQt UawA27W40J7SqgopbDgnGXDZXTx/Tbr8PYgBzMQziHUCfzDg4iqsR9fh3ZhXAH0Thr7MyZI86E+6 HT2YKgOw+LnAbxgfEPb++4WxHAwy/cIXPq9+3Z0wM8+fVyvRigLJKa+Ws7mwNEC5rb1nva6ezwPk bAWCW76yCwIVKyYkU1oCX3lWRpZ86atflAq4PvohMCMI8qJbYDlQclJGruRBoK3YsAZKAnFNYIxF K1ZJVW0xfOr1UO4X5cEHnsDKrEouXjkHa8JcjZUpwapzHtxi8+fOg9LugwWmXOZipU6zHl1KDDak uX3duvWqGGk9oYWGrqDl+A0PscYP5CNOhf71ajDI459+GquLfAg7xj5lqY9//Ya1VGtgnjw1vx2H CXXTpo1YIQM5Q6msv285JiQGGC61tfdtkkEEDNafvQzrUhWUbiaeyZG1cKNFEEO0A37z5uZmeQJo +fJVxEwhoH3J8nkwz8MtmZIO11AtGLMeq/TjcCPWyGq42PbCxbcEq24NgNSYmSisTk3yOMzR9XCb 9UNwV1bVAUCmyPvv7UUfFwNFb4ZArJD6htOxWK3Nmzer+5F0oIvkxHFYS1atQb/A2ABGn/rUE/IB zJhzaudgsqUBNIRlzbq1WM02wTJUJXUL58D9mg6GLcCKGbEwWQzOjkhVRR2YC3E5kTyYco8Dia9T 69elCxfhqq3Byn0OQAH4AFadQ1hJzZ83X8eIK/370KYkrDY+eP9D2XTf/Zj4AIWgI5+fi3a0o53X L8EVhue8XvqGhwAa4eOeDzOpayncsQdl6bIFUjNSJmXlxXCnPKUm7uUrlugkzILlas1998AiNawr cloT6V5cCndnw1m4XB7bCiVtjuB5+pmnoUgD4MUsuf+B1Zi4AEipSfLkk0+qtauisgLCfEC++Zvf kv3wwa/CSjSISZ4FYZ4Nq9v9mC+03hQWZQNQlYA358P1d0NXfPfec68GArPf5LXVG9ZJB2K57of5 /e1t76o5nCtjCpwtm7fKXriCN669F89hfCB41mKeDAvmzOkLsm7lBsnNygEIysO824jYBZ/s2HtI msATj2GlW1ZeChdSp5RDIDMupxbKbgALEnXTAZysvQeuWbRxHyw7HoBNWt5odVOwBCV53333qeWY PE+LYAZWbz7MpzpY/dbDOhiBgOGYjg4ijiWQDPfPIigjbmIAiMdCIjUjG2VC8KCvdOW9885bmLvL IfDugzXpkLpxF2EhwvFpgbBmICddvH6Ak8OnzsI6vAKut3QN6L4IpdQBc74HdMkG8GTczzpYJrhh 4jOf/5wCIK7ED8FN+Mxzz0k9XDxZULSfeuopjFm9uqwZ7JqDRcDcReBfWCHzcsqlBAuJ5KRMUBSr T/ymhZkxPjThM15lCaxrB+FqbmxulFIoLbpaiyBv1vhXShSgdN/+HTDbX4ML/V4A/zxgjByNp4k0 umTjptVQ/gVQkAgCBYBjHByvhegzLRgPP/qkvAmLsQeEeOzRxzCXbyjPrV6/HNaJQShJrIQBDFbA ksmg3izIjxV0aWLRSiVGVxHn8DLQdAfc74x/2rLlfslJy5fj545IOVbtUVgxa9ZUS2pWLpRXhzz9 qU8jlmYHrEgLsEjKUlc1ZQSDdRl0m5pKReGGvNyg8Wp92JhTBjDZ39WOxR6VaTqAqtkMkA535gLK T0+WFANsgP1gsaIS8YCvYCWBYo4CbDJl3Kr7NsKKCfcj5h6t3ownpdWGsVoEayHMn1WQQQcPHJec kgLZsglWm+3vSd9IRMoA9Cmr58Ji1tnaJEvB9wsxhnl5AI6wqAThBo/A+lRZUgOrHNxWWMimguZD AEvJ/mzojwK5dhkWA/DZ4089AWDYjUVviby/7QOphaWLFicucjKSCzROcu36tRq7SjBSDZdbDix6 kagfcjUb4OlBtWofO3ZI7tu0Qa1g6RlpshbW34KiTFghcwUkxEIgVVrasCCtv4Y6Hwfw7lLPwJNP PC43ALxqcYoF50UJ5ibHdRdc62vXr1GXmRcLqbnlNYLQR8mEMeBxAJtrGLsT+w4A5WfK2kc2ye4D e+AJWauhI+egP1etXm4WvQcPSyNA/m984dOSBTd8AKCvJL9AY7rmrFgkHljCfdw4gqt63lxphtVq McZwMbwuh4/iXciOtXAnPfPsU7DaeAGSe9QqXAygRYDENmflZcjGB+9RS1JmHvQe3InMIpScnIt2 rNLA+9UboPPQr03Za7DgmAtZfFyt1Iyj4rysAC3efustyJVyeeTxxyCzGrGADQCwXJBNkIHV1dXy NqxepAX7VogFc2PTNd0kFcImCS7uHmJoD+RjN7wUWx+GrNwLz1Q0ABmCWEtXOixoCM1oHMY41Evd olpdfJVhsZQGvfLOm2/KQhhNVsNSGwx9gPkWlVXLl2NRUYy++DHmsAbu2w1dVwHcgnaPwhiD9ymD HwYPdMNV/t6HBySnrIYxklipokNf+cpXjLkKncwA0HjhhS8adwL+P4pJ89Cjn9LvGbC69eEHrWdD 8uTjT+rnMILZ5sDdBGkq+VWY3LjngfmeBrAlq9foM7y4bd4LXz6tY7UILuXV09EGt9chmQPCMRiv GIFhazCQtEowqCwNK8unnnpSXXfPP19j6gaAoFm5BO6IL37ha6ZsrEAeffTRWF2My+H17FMl5nsG IsKcSxS+BoLcbL61g8jB0KVYIpu9GpicFUDka61cMeg3LBTFMOlGAJKSs9JkQd4KPBdFfM2GWH1E 83nlBXIOMR8RKK1VyxchgLYSDFprPROWGoAcXnR3HTt2DIIAAWuIpaKQnwchweDZKML/uWtwPeJb HnjyMdAsKFWYVPYVxd/f/KYph21g2zZuvE8FKmOJDC0YWByWxQBd/LEeVSXJmJ4vIgCTF5/hmK9F nA1/zE0AmwIoCe4uAACds7CcN/FDgykvuAlhNrevlWtWm+Lp76cmg8l+EZQPTcucNOkAFwtyFukz 3/yNr8fyj9ISGALTs1GbHtgi8kCsyLEf8Nwc+LDti32je5Q/Ji4IKxi0uaCUCt9cIaxQ2LctW02h EVh0CoruwSYDjvsoLIMIDsXKNA8gIvFashIWIvCRCdx1yYOYnInXRihuXkkIzk+HoOZFwPHkk0/p ZwqZQpijybfsFwGj+t1A93/wG9/SORWA5Y6gc/68OkxkjJeZaJp5MRcBxLyxavm6eLXgq/yKQrkI 11cEfae7kZayOlh+Td9QJuZdHkz2Dz7GsTIbefIx/0IQ8k9+6jN6j3FFHOuyskr50pfMnLly+SoW EG51XTNe6annntf7dPN8+omHdPzKyj9tNdBqkrY3AqsILL2ohzto8rBr8Stf/rpFA5HHHn/ElIN+ FkeKZSHcromX0sW+ME7V86vVwqY70NBOWrOXrYSCxjxaTJ421nTEn+AzaFtAGYKLTVmzEiADv6mI uXPlyWcfNt8xuNwFBYx/lbD22FcdwCTpQHlBAc2fMRfanFOcI2cazqjgXbp6iSxbMw+Kn0+Z3YVz FrGv9nwAeACwMruZYG0ByNwPhUfXwechRw0hAJ6WZUJ+gOdK4KbDRT4rgyuVgbqffu5Z02a8//zz z5hXUB4XibRUPvEE5a+RVaT5o5WUc+ATuHsSL/L5F7/w5dgtLhR4ncVCYe1qKD4vdzShjXXx+cRy SuAhsC/SkvFIXqz2H3/u86atGkwMmkEGM6YvdmEA5i2HVQlXA7wQuTk5sngR3KsA289/9mnzLmgY gMW5srJaqqsMz3Izz1bE9XBgudtJ+bK0XJ7/wle1XwRpxbDSRWGtfexJU87YKwKXtt2HKOKxLHcL aENgwutznzO8zB2Y5JMoYl/oalyGuD9apZhSogygvcxNizc3LmPuFmdr/StWUmZyMwusnwDsi1dA 3mKeYf1hLhRYVlMCwAuZiTqLYY3h+N93n5EPAVRKXsgtypev/sY3Yk1funiFaZNdDC2nWJBeeB2x uqhnNRZ61Qtr9MeuaLUla48fPwJajUgdQHYRdGzFXNNu9iXIRSEWt7o5jjvSUG453M2fxY9dzhOW ruZ8ZcA3W1EGA4h9aYA75Et2Hqz0AEemm+BXyJ5B7hCEq/3eLZvi8iqmPsvVlc+L7jR6Rr70wgux ckmrbHgWeK3GYtwQIIo4zy/FnuFcXI4wA17r1q+K3bexBvXWE08bGWtfHJvHHr8ff96v7aTLMx9g 72vUMdYVwcL1U8/BasjLgBL8j9uSo/KcxR+67d/aSYhtCpINsPz6S6/BwpkCXl9iQJKtKO0th5qD QXdVIUYAQkoQVDlibaFkIDeWG9ooGtZ4m6ZxbjEOI2ZG/1LfL/OlIGCN/kkuObiDQSc5ovgxSHQp 6V8wm2TDdPaFL3MywmwJVw13B+mOK97Rbc4UeCYPk9n5RYc5xJXuWANYwsQ1OXbM9vbEfuh2ZzbB 2unEIGF1CjEyUf3u1qZdpiXQ7ZJqYOWMMv5N3ZkByyzq0i3lcJtofggtk2kFaO9VjzMLU4CxADuh ymBWT2UaAes95jHSuni0Cd7ld89hRUymykDchW5x1EAAPhNFTA9QOnYJBfgwx5dbudmeGB3YVnOR DnY6BHsLZ+IOQLP9P85cmptFy+XOKDQftKPA1vrZF3YYk8LkPuFznHr8jWc0rwnJhPZoxmKCCf6t kQJGMdHOzNgGlgc3nd7X+jiQVp4ONh+venWyov3cKaaZc+3yzTDreJDWWi8nv+ENk7/E9Injpnl0 rC6wGt0BRt5Gv/Q53UHDHUTcXEzOAzjTHR+2/rWQCtqv+V5MwTGi2dvmlUSorBAWBPIif7jBzk41 YfpoukE/vObWtXLO6G+6OZQHDV9zi7BJrWHooTZ6KCPDVzZvmjKoFIpKK1QBcVeI7n4xnAd3KHcM Ms2ARVjcDBGocfs2gBLHgjtvdH4q75q+0Ur7+c89q7tKqQhdaI/5Brt0mPsKz1HYG/42SlrHROnI 3TKmfvZB4+DwW/vFtCBmeioxuLvMKtgQh9uJdT4o8xj6MV8MKcMdT6zG2g5vp3IwtDdzmd8pb1pM YFjNbHHmXDEZytlGjAGBtO6gNJe9jZguYJ0vVmZz7Z2OucmjsgDxe+Ww5iTDTU4reyhCcMun2H/2 x+T6sdjfyBP8zfi0+zdv0l1eKmbsijn+2PGk9DFTQevTrznfrLrtxYbJh2N2YpoYQ84h5gVmAVYu OZ13cO9p6gaWZHasxrf6G/nBWETOB3uLupEX7KuWphc3SrM1bBvnGAEhF5Wsn+5qNtTIY+ZRR1mM m7LeZScJyGpgmSHfa8lGcCsBaGljm6OIP+X8YX4qLnAM04M3Kbs5t3VO6Sjht9kPH8VCSsWQpT90 K77SjWWbZ7nTyWQ5564wi+ZWx2L5czDvjDzBAypqrHxE7DBLwdZ+w2smxQbH2E6NopNG9+vH9Q+C zmL56Zg/SNnSSolA8jG2S2WELarJH6oHzSxlST72Aw8//vijsMjATQhPzDDuIZmBDYnN+OB/DNyv hJUuKT3b6FfoSSMX8R/qGsV7pKZyDPtm9Uv7rPdMQRw1Q3uzi9fshGb/OPc4/pQBHA8rHQw+J4E2 TFsQ5RyAWw+xIHgHC03lNXvnuEnFonOKA0Z5YnOI6iBTXuxKkK+6a55zwGqfzg1LNqicUQHPMWIK ETr/yL9MZ8K5TrkBOawhDkyvwm5az1OmxOhgYm1N3ivyAXNecS6hNG0Wx8UohCeefBxWc+hmWNe9 RI72Nmp9DMxgbx+/ePKcZMO/mleQhm/A5KDFy2/8DH7i++HDL9C+En1rDgoSF4IOxhoFFaoarSRP NlGsoVCG1kRy+oVhbpqsOSl1EmtSLJ065rc1Eczwmyt+D08xsWLsfsIg6HP42xbW1t+a50PJZNoa l95WfaZybaNRK1TgvMFJiy3e+h3/kcjmWatV1h+wxsF6wr4xxonPURB7NZ29EUDsJ1eI/Inl1tC6 mLeCKIZKzaRW00McLHDoZqIr5XgytVkN8EcT4lntsMcvkSETeXMMo3IcjGwde6lSMQLWHDFiJZVz MY0783OwvgRaW8pSH7eIa9NZxQq+j6kpS9eat60/bP2r9yiE2SBKMmwJdnN8yU/2Ciher90EBXQE AtYIWGmODFDTdP9moMyE1kMyrIYaCseIxzLoJ4pdhgZju2pNWr2fyKP6pD7PtvCTqjXOQ+2R3W7S 3KJ7Qk22wNcnJ+ArkjUdu/q0fEv56B+WrrDT+KlIJJ/FAIQBDOYywsPwkLGI6WxVAcZ71lEJetcu XNGbETyay8hOBWeSjZp2xzPtK8ktIWX3Sau0qubT5lgS3qTCsgDcmEz2lgxIJDybl8ByBD5jrlj5 Zsxt/uN24zGdtvjazAMug8bysemNSQiaCYXEDmpSS8oZq6+akNJ6X0mQkMyVQ0NAGtW5ahPb0tjW GCTmezGsacFda1zMSI3lF4tgWi4BJiWLzkw85lUrnCkjnsjPpldcpo8t1xo3VU1UsGYukG8s6GtV aaV7sLpgwQQ8ajcWT+OjpvzgGChw40cDNsylq2nTewv8JXxjf6HPjZXJxnUUH2qWai2ErYWT0TYI aYD7zCJv/Jcq1vHja2SmKdRiGrbJaqkZZMoKu8GUQ2PHT/kJXbK4NP6mJYPMDaNwY4sgvWeAjPKd ym9YvDmOWOim+zO5utAt+2YuGypqHSwH/3LgVuW4a/LIhH5ZKtPSV1ZPYh1KALM6jylf+BvpGnQM rctaSNijaltXzGw3mat0EFmvNRGNjLF/LPLbkzSR7nxq3FyOz0l7/tgz1shGu2Wqh2wlBcBjUhXY AFsHON425Q2tzAgcpZ2tkGiosI+SYV2kMQ0snNeGqzV1JD5xF3wGUmtw/qoliVu/uY1+A3az0LW1 bduHugtt9+vbZNk9W2TZ4mJ5d89hRMzPgWusH5HgA/IKthMi7FIe2Xqf7ITvrrO7BdH/W6QG7iUl hkXpeEfj7WXODE1Qp0qQg0UhbVYnsRcTWDY+ivanBCk/5XPmeaM0OAniQlV36ljfmg/4bnxjLfq6 CI547hPP7aGCtbk21jAjZGJSgH1TyxAmgAo0rO7w2WOdVRZT7AlI2m4pmdFcVnJHm1lsC07skEBb VJmVz+xcNl3jFgPuKDDjZNEHwZ8u0kI1YYLwGd+AhPG3W6d63RLIfDxxPMaKIOvMvxgwNRYCc41T jNZdttKseRPwntUGpVDi2Op9+4Y5TWjintj0mIy+45ElG2PesUGZTmWyA34sQ4CpOqFCU3qcp+Mi bRxf8THmOuGv+BQz+FYLYaHWCjvGE4mI1AbW9mAZi1Bc4MQPAIkvI1CwPQ5q6ePYcEHD+6xyrIA0 Ny1wbfG7EfBj+5zQAqvrCUpqGra6qagYg8WFrWknk2MapWC25tmg367d/s0KY5BQbyoldUjMuKiy VxBnzzdbcdqV2/OWf9sJOyncrXHVx2xgOBYgj+Eu7bs9hhPxOtfMxoIQ4sKDvIU6zMiNB1o2T7Eb dt8Tx8v+rPYji4lYdhw8GD3DRV18ycRS9Ql8Z+wRukaOr9hVPyWWmdgP0yZCWNvOYA93fAYYGJ4g oWMDZs8uYy7gM5z1FojnmXnWXXv8Yqw0Zs7ZNdlljKfJeP6w/7YVc1z22pDnJpbV+mwrnQ06LRLr mX4cOCwH6Y1gElssprls80NQ+AiwLWtHYkuMDOO5oRbMskSyci++4/mWelndSeSrePvsvtt9sedH nAYWCyaIKPIxTaKkr70YZ9b68XN/MrpNdd9afBlfmPZPf3O6al8MX6o8sqzrpjTOacozzkN7oWsP 8pgZZVVuzoM0C/44mYwFzRoXWpbwNf9UazsJDqHtHRzslz17dso9CDjNQKxONwLcAogJ2LVjN3a0 FCgwGupHFk/sEtr+zgdSUz5HzsO/TZNcGIX+4tWXJMVTCL+tD37vy4iTqNaVhC1D7QZp862O28Q1 bRsrQS0D6JhumD/GcLnFCbcyKEY9a902DccXOaaxierYnuQJlqYYQyZy5s1ttMSNKuKZXHHzZHwg DYPbbJ4wM8bcn6r0iZgmTlVbucZrjPfDTJjEWUcGNn/bQP2mmjmkVpWJpI4/ZwsZ8onVrwQpYwOM GHiN9T1hRTS+SzYbTUlk025TlXEtxK0vE7+YuAabfvzivGB3Z8zvREk6Ae/FjNNjvlNxH1Mocekx QWsUzNgzfvIxn6ynE79Bgc03KIzG8eGENLfrt+ZZQp9vUiQxIWsLW4uvpid0XBpM1U1tuCUEx7R9 XAX6nN2/+LyIGw9YhpFpMYSbOO3HzMN4L80j/H/i4o9C0FheYpf1ik05IynMuMfn/djHbcusrlUS np6adBNUqk20B9IaM7vZiYXZzbHqsuuc6NE4l9jtv3nk7aITv0moIl5zAgnirbffsmnLx+NUiwl4 u8CYLEp8byz9b2phAqnics5WxolK2VDgppGK8ZsBpxOOpLKCOeh3zFmcVNDjjhiJtVaZhC+aO2PY P1bJ5PSOc0vinLP0cLzYOHDQwTQ8G3/XHuFE+k/MeVNNz7iut+afFjsBD041d20qWH2PL7Vsnh7L xOaxRPrYC11zL2YcjTExYGE4grT6OKacGdHZvvpzSCyFLfZB+ltTEWA83Ix7DRICmOKibAi7Z7Ky YNrEIHqBgrktNIL03inYcsn4BR5NkYLody4tbhqq2A3LhGrWIFYv6FJJ/Hs80cdPp4kHZaK7N7XE Lmo88SfiLb1nXI04IEPbqCIv9qz5MPZVPKFzFts5lfLkOSBvNVNO3m6z3rCQuvWcTak4xkJb1Ixp mZbt4qaaF1NUGn9togKsfthCVDkeJnXLjDpllZZesEGiMidfQFlxp1iccGPLotnenizM2j1mwEyP x1XO4YnZdcY9ToBqzrYzbhdjALNXnRNZgxKJOmUvxw1m/FkbEuvxz5ZZXj1zE+gNm4PGsZR28uae m3uJdI3RQx+2FXJiH+y+j6db4nwbP0v4XSJv2y7teLDyxJzMd6zVWuK6wOrIWApRpPFZiyg3PTNx DWPuJg6PxV9mgG3XmOXmGe+aSywkoYwxoz1mQOzGcTLjs5LHGokY3W3GtEWxTV9tmEVPS21MUqcZ val4DjnaLECnI4FHeRZVbLRu6sBU/G0RIdb+hJetsUvkv0TDsX3fHj0tKWG8TYts5/d4YpujrSa6 bmqtRWqbsvytB2HEXh+rPxI5duy8SBQZibVMQuubxoc3bIv2+H5NNl4Jh4CPecQiFIrzqnWGnaSu ANVoDpp09WmxUIL8HUN/W74kDutNRI5bgmKgx6bx+G7EBp/tNfN/7CNT8ampeOonLCmm08Mek0Sk xgL4jM2MVmmxQm2Giy/gbhr/WP/j3gijwe1CLDnBP61itCXaJsPUXiYZW4tU9XuQSHLtmvWaNI+7 H0qRVyg9DccTABzlIz9MFOnSi5CfJgXZeLl9b9d+JKBCdPnj2N63/cOD2BJdLyuXb0A+jzaUUYJ8 FTQ5TzgPTAsSqaefpyf4ZKXdvfvxNk7Z2gncUCo0ZtTF6eqIce4My/so1BnHlPY4zagfY4c59sqM xjqx3kS6TV7xTd+MuzEx3PgotJnZuwmjNROpMX2hkwzJ2BfHU2OqAZvpYNpTdLrnxwuyKboUmyfT lTk9WWJPjGW02aG5PXEn5P+J2n7TqFuAamo5N8FbM+r47FBv+nGbrJ7JKXArb8yoq/rQxNbdW6HC rTyb2K7bGaEp+MPiJ/NEQtnTNW8qGTDdu4kTxebniUg/ppwZFzrzQRw/YSedt+PqnlC0Tde++PdG 5ExU5gRlWM96GYC7BuBo7RpuJTXITDeN6EcGVSNvAeIg9KBHq3BudfxM5fO6kGpF+vB2HEHCHA6L F8/XPAVqfpzKznYbpHRecSjgUMChgEMBhwIOBRwK3E0K4HQNbh1mYJ69BdXC6ogMVReFFX9iDtsz W/A1htdCQUVFJTjL5Qv6XC6ybup24akCeu9m75y6HAo4FHAo4FDAoYBDAYcCt0kBtSTpBavQeGxD 3x2j7HkGCi8NH2XQoT5PUxHzzuBMGGSjphXK5DJiQbfZGuc1hwIOBRwKOBRwKOBQwKHAx4QC8f1w YxqkIfT4b2x4ncE+DKyyfWnW9n0m5kNad5NDxcpp4yClj8kQO81wKOBQwKGAQwGHAg4FbocCE4Ak CyDZpdl4SBGSDZ5oSeLf/F+i2cgxId3OIDjvOBRwKOBQwKGAQwGHAh8/CkwAkhKAT0LAvdkOlwiK eIPWI96zt2mPz6Xy8euw0yKHAg4FHAo4FHAo4FDAocBMKDCJuy3h1USgNKbEcRakqbYTzqQlzjMO BRwKOBRwKOBQwKGAQ4GPEQWmB0kfo8Y6TXEo4FDAoYBDAYcCDgUcCtwtCihIMqfEm+AjZ/v+3SK9 U49DAYcCDgUcCjgUcCjwcaaANxAISFdXV6yNDkj6OA+X0zaHAg4FHAo4FHAo4FDgblFAQVIwGJTU 1FS1JiWCJPu0Iftgx9hGNyafZAySdcyKORfLXDydmpc5BVrvWMcWWc9Y5x6NTchtn3XEtAN8xX5n HBnsI57c1inaCccgRdB2+6RryyZm1T8+9Xc8lirWP6saPTeQVesrhhaJn2OtGf/i3Rotpx6HAg4F HAo4FHAo4FDgrlHAS2DkBujweKwT7sdklDSnj+t/PJjUTsCNw2tT/UniTvJJCO+HB0YlEgxLxBWR EI7R5bnGXmTyZpbuaAS5k3AgH983IMyciqwpKWNgw2T8ZipvHgIbYXbvifIsEd/gSJQovg+FUB/T W2rySpTr9ojfiyMfUY5bkQ5++7w4Z9eEXQVxzhzrjyW8tGpQN6MCPpaBlmtmce7SM21iWWwmQZhB f4lJN52UB3eNU52KHAo4FHAo4FDAocBdpoAX15gqY7FJBhpICCAhRAASdIkvAADk90hPeEgOffiu XDh9TnKLK+XB+x+TnKxc6YuMyJA3ID7XqIz2Il+33yfeJIAoAA9PxAfAQdDVh1PRcTpyGOejh0MA ZwRSKThAN4TakiUMEEXwo5YcACtNZ2lZrsLukHhDEfn591+U1q5uCSWj7WhPUrJHnnjsSamqrpNA sF88QQ/a0C/t7f3S3D2Cc+ciUoUz5TweHkgXsACbRwFURMJoXzh21AqBkuYWx7EsEgUQIzjiuXWg QZgZxfGGG0kzefyKGyc4O5dDAYcCDgUcCjgUcCjw60kBHEtiOcWs3zZIslNK0r7kCbthJQKmgaHG Hw3Ivl/8QnpOH5EVF/vlwoGfy3978C156j/+rizMLJNsgKm+cFDef/+QbNmyRXxJONYEICcAuJOK nxCsPYEwwE8E4MbnB6gZAhbzAzhFJRhxy4kTp6SkuEiKi4r1cF29ND1TFGANj+L3tc42+dLXvyrl 1RVy7cpFeQft6W2ol06AlpyyHAniORzLK794+z2R1AIZHe6W6quV8tAj62Vk0CfJfkAvZBMfGQX2 QRuCkVHxueluDMjwcECSk2AlA/4KB5IBrPBbz7HzwOJGIoyodcxDq9N4T96vJ484vXIo4FDAoYBD AYcCn0gKTJoCgG6sEIBAMkCPHy6uQX9URpMi0nutSTp27pWvllRKcvNVGe5rkkBprbzyzl9IyeP/ QIqTKmUEaCogXjl17Jxc6L8kGbBABfzJMie7WIZTRuT85RYpyS+RBXMr5fChPQAtRVI9t0ROnjwv Z04ekXs2rpOSRyutAeFRJzx8F9YoWn58ACpZKfL2rvdlads8+fFf/KVE2zok69hxuVhaJYse2yTz NmySwSBeQ5zVvffdJyMjfXL04Dk5fbFeTh29JjU1hTI4MCwt1/tx8gqsQ96wzK1aKikZIdm/74iU lpZLakZA5teuljNnGgCmhmUUsVtbNt0rGSlw4aE9Lh4I/IlkGafTDgUcCjgUcCjgUOCTQYEp8ySF AZRg4BF/BCAJwCDojcpIaEiGL1+TwaONch4AyP/PNsnGR1ZLTseIvPzWz+TxTS9IXnqeeHxJ0nKj VfLnlUrfmUtSsGiOtDe2y/VAh9TWrZSRgRF56/2dsnb1Ymlq7JWjpxokMy1fNqzfJNVV5Wo+ivLs OCuGyQ2zjTcIa1IoCleaS3o7u+RzzzwrK/MK5U/+6T+VuTk58ur7u+X1H/xI/sWqeyQJlp9I77C8 /4t3pHWwRZ5/7jPy1nsvik8KpXugRVyRJFlUt0bOnjsrC5fOkfrzrYix6pDV69bJieOnJABrVWA0 T841XJPR4DDca0GZU3NDli+slegIXHa0KjkhSZ+MWeL00qGAQwGHAg4FPpEUmBIkMVCbbraQBQbc sCgV5hdJGtxhf/3hz6WvNlWGA13yQN8IAFGbHGpolXvXDEphZp6ERkckCUCiODdbIhkpUpSXCzDU goBul3R29ogb8UiZman43CKDQ0FJSoGrLDtDhvpHpLePKQkYIW3vdoNbDIjEh3gkeNHEC8vUV77x ZVlUVi6Xt+0UD/xwnpQUcY8EZXhwCGDKDfdZVLLgNrv//odk1+kDcu7MRcnJzIXrMEOKikuktaVN 8vPSJTs7VXKzM6XRjTahvpbm6+KFj21O7UI5uOekLF2xVM6fPyc5Oflob7oJPleA5NiRPpEzxum0 QwGHAg4FHAp8YigwOUgCBvBxFxkAQdiHIJ+oV5JGwpKcnC1P/qt/Lj9OTpIjxw9K5MyIpKc0Io1A RP7lP/2/pTK3RtwASOtgnXEhxig5zy8FqxZIWla65C2bL33HD8hwT5csmFctixcskb17P5C5iC2q qC6TUMAHKJQp169fk1B4GPFAACNog1qV8BOiawz3nnn6GViYfPLkp56RXS6//OzNN+X6//uBFK67 Tz71ja+j4SkAUwOyZuVCScv2yQNbNsjJE5dkzbItcur4BakuLpWakiIpzEsS7+IqyclNlTXLKyU7 d47s3r1P1i5fLiWluZKfUiS1cypxQt2gEJ8V5GWiXSMAUfiDAUlWuoNPDLc4HXUo4FDAoYBDAYcC nyAKjAFJdtA2+09YQhcXg6ARZw3AhMDriBdb/oOSVjdf/sEf/zf5/AjcUL6IXNl3WFJhtSFACuMd D+4tRLxRCFvpw64BcedlYA++V/x5aXKjq1iq4OYqLcqGtalTnnx0MyrIlACCpyPRZARMh6W6pkhG hhggTfuRRm0jdsgjg9jd5oOVp3JerQwjBcAArDlrH39csooK5cI9K2Xu4rUyZ9liGcQr7iSPlC2q lkAgIikIvr53/SJB02XOE+XYVBcCyAri9wiATznijUJSkpuuaQVeeP7TCCbHd9i9tgiuwkh4VB7c tA798CA2CZHekSAcj9jZ9gliEqerDgUcCjgUcCjgUOCTSAGv5iRCjM/NmbYJT1wIvwbgIPDRdAAI Vsaz4UAQrimPpKenqTHl3q0Pq8WnPzCscTohWHdCAD12XsgQt8tjp1oIfrs1a1ajJK+MDvVqDqKR YW7z57O0GAEooRx+8jJnko6IcWvx/368Ry9XIDBi8hfRHQhL17J7N8qaLffJEMw9wwAyLtTtkiSJ wi3nYY4mFBgJoA40dnQ0YI0z++1RgERnHhNqsvFDQ0NWLktYrpgaAP8CsIwxFYCWhXbFklWOySn1 SWQfp88OBRwKOBRwKOBQ4NeXAppMchTAwgZL/B2/7JSOFlCxYpMIVIbsuGV87tP71rNWGJG4sLVf 0Y25r1m5NREjbTB0V2kmJPOdjMQ+mZdseBSP+7ESFViAyc7mbZ6269eEkFbjtWwrSaSVLTIWaG2D nJu3p1mZIvUB67N+ZBJMc8tuHzM+OZdDAYcCDgUcCjgUcCjw60sBb3JyspSVlcUOuU10uf36dtvp mUMBhwIOBRwKOBRwKOBQYGoKYCMXMk9bR5KMP7vNIZ5DAYcCDgUcCjgUcCjgUOCTSoExgds3xyV9 Usni9NuhgEMBhwIOBRwKOBT4pFNgyjxJn3TiOP13KOBQwKGAQwGHAg4FPrkUcEDSJ3fsnZ47FHAo 4FDAoYBDAYcCU1DAAUkOezgUcCjgUMChgEMBhwIOBSaggAOSHLZwKOBQwKGAQwGHAg4FHAo4IMnh AYcCDgUcCjgUcCjgUMChwMwo4FiSZkYn5ymHAg4FHAo4FHAo4FDgE0YBByR9wgbc6a5DAYcCDgUc CjgUcCgwMwo4IGlmdHKecijgUMChgEMBhwIOBT5hFHBA0idswJ3uOhRwKOBQwKGAQwGHAjOjAA64 DYqedY+DZ916GK05uTaM9116BO3sXxFzuq2eF8frTtQx+60eW2JUKRQRt/jwCz3gebfsiDuA//GH f/jxQxzKL6N42qNvee4QXe9EnzlWbuUE+zjiO1HLzMrkGck8bFhpS96xGMdQ1/DrL+OKaJsw9BY/ /zLa8Muo0z7kmTLDfLYPxP5orWFJPAbbDKc1t+yPygS3fnGM7OG5lVbGntVq7cO/Lf7TJs68PYl8 YouLW+/J5G8kSus4/ShrrcO6pxC0M+/F1C02dAY/RCOqUyar0sU22eM7zVw20z7eu4/zyRBj+2/p 09kc5I9Qls1z5FnS062HzX88r48THb0SgtrG2W2haFh8UY+4AJSioF0YPyShx+JlMvuYiTT+hj0b rIfG/RlHQqpQzCBFIxgo1B1FnZYM/Gh1TDTe49o5TbMT2mkKu6kfsXuYACSUtpjC0w2s5FIgJABO bsChMP7Pqe1HPxV2UniAMWN0nIxWVh1T0ntcXyend8KD09BCOzumUgvc6YSyQIkt26YiTkIZH5lv rOabcvgPwtegUXERnCZIYbva6Wgx2ZhORe+J+IYkCevYmjcTldTt1DGefafrx0ST5iPTewYNt+sw wBncT/5wYy4k6D2LIJPOoZumql0ofkd0jFE25YLOMTPOMUonIowZzKEY63KsrP7Z4CdxzCek9xhe 5jznjbjMMuM++RyLC5C43Avjo6EX5YH17viG3OocGtMIi1YElAArIKTS0K20nPwaV8TYB8e1c3yz SWMbyETCIXGxfxZxEuelPXRmLtsLr4nncmxq6/BTZ9jUpoy1rmlk2ozm0DiSfJQ5RFJHoEt5ESRa 6yfDd7c6pgnMNaN+TFEHv9IxsuSVob6ZWna7ZsCK0/ZjunZOV0diF6IRLtEt0H2rtJitMUWDvK6o T3weL+0hY/guyQzz1GaeGBePe3mqmXir79zq8xPVPVEZU7XRZp4pnxkvcKIQnS780HJkvJi2QHDp AcI4SFj/n1D4rbbrVp+fqB/TlXE7349/ZzbKmJT2CQLSeiZe3TQVT9eu8XXO4Hnvzc2ZjrPGfj+D Om4q8G7Qe0Z1jJsDM3pnCvJY73uMHcmeLGPk0k0yaab0m+lzU/JAXEpOyXMzlVmJz90q7Wb0POW3 WZRN1/3pvh83CBMPoj1+7nEgZsKnJwZsk9J1KqvHjBt/C3pqJrJgknqNpL9JON3eIEzXtxnxQUJn rKaNEVvT1TETWkwn9W61jonKm66M6b6fST8mKMPbMzIk23YekOFoSDxuryRhaUOwGbAsSWoW5Yvj lxnj79mFT7YciVXukjCsV8kpKWpFGhkejLndZq2OyVZlE/VjMsJN1Q+uBGl1U+sR1r2uYXwalfDI iLiCpKNIiN8l52AhnCR+1OvDio5uzaCaoLlSnoCmiRNrKnrfbj8S35vJmKI96iLATxLGy+/3SX9/ v7rf9JpozG+1jsn4BvdtL4FhQZeMDg1KJBg0SyJcSSnJ4vMnxVZrEV05TzC7ZsKbt0hvrpQzMjOl p6cHC3U2kC7rjzCmk9EzsTt3kt7jhfp0c8gaH9sinJ2TLaOjI/gJxNxaE46F3c+J6E2Wwv3wIMc5 ZCxHmEze1FQJQ1ZE3C7MI7p/E65p5qk9zfxJSSpnhoc5V1nRDJxu2kczriMDkFPhoL4LO4n4U9PE 7cNiyHbjjTeXjKcn3qHcS0Ff2I4RyF07tEEfnY7e4/lgouetPtkWnZGRYQkGMB6KklyQuani9UFu qTssNo3083irwk0yfwZzSF04AEhpaenS29er1mfbxWnqMxOEn0cxxtEQxljbjLalJqNt/lhboglz meV6/X5Jwlzv7+sTj9dYLWMyaDLaTyAKJpRZU9F2In6dQmZFoDyzMrOkb2AAfYEvQc03lqycqp23 q09nyjdoR2ZWlvT29kGoG69GLDpgBnMoRqLp5Pt4ms+AbybS+yHMlZzsHBkAn4RhmZwylOFOykWU 7W0FSPnjH35PeiMUALCDhE0kUtBDIkKt2yZqtQsnjLIbn20XPQljS67YvXEtt77nhAhhcpQUl4o/ yS/Xrl4FWLJNs7NTR7xdKC+xnVr8NNw4XT+sMlhMxAU8Hk0SN2iWHu2T+5flSVVmN4BSv4STK2T/ hT450whQ4U02wNPjl6AblrvoqJqPx7QzUVLe1M6J+jENN07UjylpMa4OSzjYSjC/oECyMMkuXLwg HntVNxt1TEZvW0hCMZJUBCWfv/8Bqc7IkkEoK1dysryxb58cbTgnkgzhCgIjwC5B2idonhmO6aT8 PW48OPZ+CPS5c+bKufpzEqHQoRxkWyfj/+nG9Bbm0Mz5e4IxnY4WMx1T8hL/A83D4YjU1c2Xrq4u 6ezswny25v4t0oLDl+pNks/cf79kpqTBlUlXkV8+eO99abh+TSKQE1S0Onds8TKDOgj0i4oLJTkp Ra5evWJiZWzldRM6SeAbPgO+SnV55cktm6UwOwv6BRAJY//+rp1y/Px5cSVZMYc2yphELtpyr7ys XBXU9aYm43KbKb2nk70ElyiXYRJe+POS4Yp+9N57pTq/QCQYhpjyy+tHDsrJM6cNDVVDWrJQpxj+ p74ia+LfqnxnGXg9LS1VKiur5PSpU4jigHzUcSIoM24T1uT1+uSFLQ9KSXKqDEVCWO0kyUs7dsiZ K5ckioWYgiKdy+Z5/suGwiwoyJf6+gaUa4Ok2ZLvCSjho8xT0I99rKurk8uXL8MAADmvERnTtfMO zlOLb2iQqJs/Xy5cuCCBIGNmLXnFDzOYQ0bbTNcP65lEXTadvJmE3gRJixctkibMk4H+gbghxW7H dHXcqq6brJ0oxxvhKEIgcX0UhtIHLjKxABD4Uf4xy5dORiiVCCZTBBM3mp4Ga8tH9VnMciNnUFwU AdoMiYlE0sQTTpUATG9DoYhs2rRKCrJ9su/soLx/9oi40L+QO0UFYwQAKQqBG4WLc2KTxwwqvsuP UHzQNxzBCpg/0dR0Xd3frYvAgytwsmT36Kj8w68+KxlYSb5/7py0794ukpkGQA9wz9g2BntMtiqa xQYrcMTKNpyaovyrCNh4z2exll+hosJhCcHSGE3DXB4JYD7fHh1IwREI7F5YXb/2+c9JLkjw8qFD 0rXjQ3GD9xAXoHMuHsgzMxoZ/kXbklP0N5X3TWulSYoibhiBVasTVrLffPYbUghg8+aJE9K8Y7u4 MtOBSLgNY/pLn0E7wqCRWnLSMY/suJ3pX5/RExEIdIIkD+ZBKBCWNli/fusb35Ty5CTZfemy/OT4 Eav/BtjZwfYsPBYbNaOaJn6I80LlOn60fxpmkHARxFH243c/Fsrf/txnBKMqr584Lu3bPxDJwFzG 3PbSRZigejQSkdZE8sAdoNtH6PLNr7KP4LEI5wLCWOLmmlmt5RYLAwUxFqRfhPo2yA1FvG5vnt5i 5bf3uGIE0hF8pJa4X15bvXSv+cP0ooIRMWndEFIM8DMT31pdjOV0nWAxE6K9Gkk0JY6x1VqrlZgk 0WWLeCJeTGYv6sOP+nAnsBsqcezBTFCAifdigz3J9+PLmHTIxrXzpjrGvugJE+iEZcQTlJB3SEYh oPbX3xD3i/1SN6dSXj9UL43DmPT+AqWtLzyM1R0FBN1z1kpomjrijDwBvScak9umRULfx7WJcZ9U /jpeHCtIYY8CvXGrr0Q+mLBfE9XBBjNA13TGXozHusYb3FfAlSja8eae3dI93C8rly6XH73yivTC pO3zJQHpq38TvDIbYHtyWtjt0g0HEcwZ0iMEWljuUzOZE/h1Ml6jRppgl5YtBmJzL9F6cJMq5jxK sKjECGhVepPvz+pXYpti7Z1mjk3UL/seWZNjhLnsiWDDAugydk/TRPMqsRFj6e3CQL/6/nvSD3fU 3Np58qOf/VyGAMKiXq8QA3sw1nRzj5EXY/oxAdHJs9o+8i/apxbgicdgzJwj+3Eh5Aco37sX7vRR Wb54sfztyy9JO9xYBMoeoDazZBhP34nkXhjtMO4uQ6dxbqPJyrDHdvyYjuuDD3yJZZha2oi/dgMU /e6f/Ge5/5575CevvCqtXQPih6VOFxN8xlI85q9peHdS+R6nN2UC+2fkukXn2KQxHziXybc/37ZN OoYGZN7cufLiyy/LIBZAPq9fvEGz2SWmwPVxlMv5ZperFJ9+no7lhJnI9ynGcEZ6yLgUldfIZ+A3 23p2k76MNW6SfsxUn45v1yTyhzrd8D9llhnx2C7BmcisO0Lv8XM1Tgtbpuh8xdhPvKNxijGdVBbf Ir1RjkYYe7DyowuFMUk+lR0wx9JcZU24m8WOLc7tb8b/HZtx1gPx79nZECYpjRH88eN/bl15Tlfm zOuIt3e6MicapHH37CUWTdS2JMFnTmYfhLcPoxn0I8YIfXGllcjRphE5caNZhj054kvKRN8w8WGi T4IViSbkMAoJqJUusW0T9S2xHTPpx3TlTVfGJN9Dn8CbggUzBDva7teYBu7OoaJJBLbjx3ziv5Wc UFLuAFJPeCJgQK8EaMEEAX0AkZooAQ/ZaQfUasNYB3wfwqriUH29HMYPlVwarFourJhd4CeuyqNY 1Sv+xN/29uMwxohuDf6t1jz8s20+bpaN9oQoiMd0f2paRTE3fOBbj9ID9RJIxtwJU80J851u2lKL qgG/GpsCerJdbJOX9/jDVSmsaJwfLnwfJr35Wd0XSD9BPtK+mmdH0cUI7ntZPviS70S44MF7froE WSbrseqnxUdnOQZYrQp0Q0EAmJgWA16NG2YKXsR35GnSgjwCcqj7nOOnsVq4aDkYE5yCMfFyjLHS DmsMJGpRpIG2o4xIaqbsOnBM9h04AutRiqSgTUMoirF9iFxBCIB5lkpea8C4U6ZEsRXX2rMzZhJz YRKTN+BfpWeCImZxdOdGCcZAJ3Un6/zEPa4a8dEDN+/+k6flyMmTaonKSIL1GIsF9EDngQJDdRFZ O7bIV+CTGF/pWJp2sH4j9yayyFqxUjElaWQjx5V0wpRB+yBD+T6/sgBPmBYY1o06lMcwzv6sbDl9 8ZKcunQJbfZKchrc/vyeIA1106qjygfj73VxRy5mn7IYZ6GF49luSxeMlYw3yyy2z2vNiyS0R2mq W1lgaSQkREhHkOOIMQh5UmXXiWOy5/gx0MQjqaCn8jxJiDJCOgSI6+QOJ5bLBTy+TALt1a2t13Qy bWyLb35+JmXMpA7zjOplgiTwmw88GYZgMUB0ujKm+358O2+m/XR1cLxBTdFxUXOs7XJNpNFE5U71 /a0+PxG9Jx6jEMZa2wteCSivT1bXrdNiOlqN5y1vFMGHcxfNlX4yNJSVXwOSI2BihhnHV/nxrrBR icpx/N82IRKhcPx5BrbxSkZMSQCrh8ysOuO7nrLMW6sj3snp2jmeAcYrfUtQaJcwZFxWqtJwIXYC AlJX8i4ZDCBAEu0PUbRAGEVUCUDQQPj4fD6Vt5zs7CIVyNh5M1HfpmrXrT4/fjxu4W+0V7d3E0Bj 0rMPCxfNR59oSbLFgt3W6fjCfE8VAjUkWSBC0DMi4eGoDNAdiSs9MgoACZcEJjEVgYa4g5ZJiAFJ SUrGanMY7hikViAQQBsYL5fuT5as5DQZQJBq7wiCQalI8B4VHYFEMr6nuyUIl0kA77r9GB80hfrJ g/epkjTgO3ZN1w/zIEGiFzSZM7caQt9nbYNPFN4385LNlwpJ8KgP8y0Lru7R0aAGKDIwWY0LVFoU alCAPlpQ8Dzbru2mggRwUpcR+sd+mgBZFwLZ0yQNMR2DA30I2MVGApRDF7oH1rbsFL8MDQ/JMAN5 0V4qK/7mfCyAdSGITQdUtOTjKIR8bAu+1dab55QBamYKuCQF8zkp2SslpYUKAth2DQuwlCzji6gM qZDT8GwIsSjDoyHUZwAJFaALwM6Ln9SUHKQkQb9GexEr6QPAQ7BuWhbehbIdCSK2CFAJz4+AHzRb Gcp1Y5zpxid3jb/YxiRYfUYhbxYtnm/Jm/hTzHbGRYsPZWbTxA9eoZWSfKjlAZmMCGIPASR8oSFk PwM/uZKgyJNQ5bACO3Xp2XOFY8KxRHk2SDJbr43cGwGtc3IzzEJjArlnYxLlJtKPcgTjmgF3VLh/ WIYGhyQAxKj9glghPwSTOHbgDzSXPBMCrcjWHBeClWHMD8aC8jteHHfG9hA8JSHsYZRlwKVIOrgx riGCWM4l8LjGjHIlMOkcMV+wPV6UT36YVzcHNE8Bn3mwGQihCf40SQEVI4jLdIGGA2gsaWaAEBfN xnth8isRSIHvOT+t/nOOkVZ10FWMabJqnLZNU7d5urk+3fc6QAljaD5zjMulRPnU4KNbkS93RteR zpwDVdXl4CW423RhkggwblWv3Orz42k1fpaO/Z48kUHXKkJ+KqtKp7YkjSlqujGb7vub2+n1gXjp SZh8XMXS6qGJESGMIBjUbIvJMlbc32olY5+nwmW0eqofOyCGscsNk0oF/i0x0sTMOZbsM2ln4hs3 D7quS2N8BMEHVEuwFILQ2rBiiaRgF0NwsEcuX7+CYGIIlRCEuidT8pLRR2ghCqDu3h4NQM3Fqm5g aEiGBoZMMoCYFeZWme1Wn5+IOaejjfle19sWgvdjYvUjgI4Byxr/o8umRAEwszKJAkKg1coVi8Ub GJSjp05Lui9ZihGUGR5A4C8AZyaC+odAKwbJpiG4kxaJurnz5OCRI1KelQlQOgIl1q87JNeuXCUB 0HQQIOMCgnIL8vOkDzs4uLOnOL9Q5uO9hoZ6CcB9Q0tTWz8ABJW3gQFY3ULBUxjHmHy6fhie8TLe ABfVfIqPkRUsLyHZ4LhZY3MarbRU4wRzC2uqZeGcWmm82ijXEZgcCMGFkwLlCwXBdT13Jq1Ytkwu XbsqndhFl4qYgr6eXsnErjoqI+Y2o2mirb1d5+nmFWskmatwlHP82FHJzMiUPgSPlpRWSO2cCtl7 6IAqzD4oQy92Cg1CWXMnzobyKgkPDUsA9e7Be0EIT7X+cPVPEBTry1iFYPjD9CU9JV0G4M7JTMsw eWIsIwmVriYk5YOwYqRhF9PDD2+V+sbzUn/xMgAcwQ1N2hHJROxMEGObnlcsWXmFEuptlcbOfkkK pkpRebXk52bLmYaLukurCJ/Pnj8naRCkPcMjMjgcgMXWrwr+pgt9SIbCjiDgiXRjEKvpiRl0rlkJ 4JYtqpMsBBFHwXcnztQr6HS7Q9IzhDmcnKlAIt2bCZmFPnkxFsNByUnyoO5BGQIt88B7o9h92dWL zRsAeT64+WzxoeAWcoOyNjQU1F2ZBhjEpasJSY/fscGSP9knq1aukCjAdA4AzclzCF72h2QALv/s 0DBirbBraaBd4zf4zhB28KVmwMqK8oPoS3pGhgxiTmTB8tWPOCUuOIKhoJSWlCIgOkuaO9pA53ZJ RXA7wfUgeCYLvOMB+GMgfjiodqUEsk4sgwgEWfYIwKh40yArsEABKPIGh6SorFpq8zNhtfXKUGeb XO3uwq7FJOnu6QaoSAFfpGJHXB8+J2mAfWdbl4InNXRhwc57o5jTBJZ+gCR75OKNuntycVI9w0Uw aO6D12DUPSop3hSVn7em2+4MSCLdmOpnBP/SfCYujtbJ26ffbNB7/ExNKBNNS/elS3+0X9LASzcZ 4/TV6Wh1O7rv5ndo9VaTt67IaIlV7iMBbbP+zTLHWFNUuliX9beROPF7sVfj33N14PH4tD66Ri3j Mt5LnIRWQ2+zjpvaNWGbpuiX1Q/iRTUesbN2+9B+9sGPHValAHqe8ChWsalSMm+JJA83S2M4U7Jl CAI2S3qgvEcKArCEeCUHyqint1d2HjgoA3QLqHaZiFYzpPdEj01A75nTYtyYWu3T2CNOfv6CAOC0 4rgR7HKSxXcJTTJmie1UXxgtbFQyfvFDmI8ACKyqWyQ5WCUnefKwXvchHYUXO6U6dcW4YO4c6Wrv lMhwSB6sWyYFebnSPTgAOu6X4kzsuBuNyHvb9+Bdr9yzaqUCuOSiKq0nAOVZhBV/enGl5OakA85E ZO+JU9LY2o6+cDVqYhvCsF7dtBAYz3vj6K0ggjRBvcbFn+Dj12fH83N8rElD0nVwcATgDTFtsPCs W7pERgMA0fg7L68AAjYJO3nOSzVdtim5sqEGFjzQv7u9S7JzclQR+dNTZRjK7jRW5ddvtADwRaQB u1eWQtnfu26dpAFM9A6NQFECBnQPyIKMfOzIq5XOvn4oWb+cgbJdPHexuAZ7xZueLH14nyAjCgUf oqsO9GHEFRPK3sSrSh+6Qk1flAZw13NeU56ocuMj1vyhhYPWpUKAnyRMrGrMj2h6vhSXlCOQFPYr pA6oLi4AbwSlGW12Y1cbbIhSVVUsc/IzpBn99o24JL+mTgIEuQBTVUtX65b6lq5e2XPoiIzQhaRW j7GjqW2kskKfgozboeXHdotp17AFHfxYAlC9Z/cu6enqluraOVJTM0dcsE5mgvlDAMIXrjZJeXGO grWzV5okvShb5gMYncMutxRYoIrLirHwG5b9Rw5LJ0BJhOkprEUGXdbqXuT8ocE5xh8WnyTIArqa SDe61mh5K8ACi4uFdz98Vx69Z50sWrRYMlICcvrGoCzP8mJhli2hUYS5u1Nlbm6BtGK++JAeg5bt rv5ejH9YOr0hWblsiRwAnRYtWAALUxJ4DWAGdChNz5JKWuroSaDLGnMoHZbHABp6Qa7J8UbsLKTl 1pKLhpMn4G/Sn0CPC0laiThONKCjDx662PkPjJIOwProqg1IARCQcw3nZfFCehPc4OFWKcRi6VJ7 h7S396Is8AU3ElmuZqZeUJk8Xu/cqhydsh8fQQ/pq+pvVj5D0glDKo0dm2AOxWTK7evTW5HvajHl GHE+qBVvunaNE3oT6f3xj4z5ezpcMNHLfIc8xBAKQ0dNmDN2Sie8OEkds0VvlIOpgx2iMK+HaCKn ocTycatPmOIjbjKwGsbWTqYAbO4b/33iO8Yt5cYKI8zgC0hPdTOMuT5qHRO1Y3yZE9Uxtp26ey3W NtUG2nf6S8OgWS9WjPNKsqCw8rFKxIoNW9H9wy5pxbbF3BKPdHR0yZzaGl1ddHR2YksoVn10ZTJ2 xOwNnYCW07Vzuu8nG4NEAs+kDPt5ExMEaz/4hBLLiimAu8TOtzLxPJmoDr5OSxKDYb2ShtVuek6m ZOQyf0cPAFAKdgYWSMPl61g1jkpFTSkEaQRuhnQZhmUpHbtGBqDg+wf7dSwGYU1Kwcq/qgImZDBv HrYJN12/LrnZUCoACBcRjxGG6yQH1qdoOKBWvQi2v9K2Yc87tnJM7MhNYzJxPxQ14tmAC9EWUH4m JmkmY2pcjpSbAZTRByVcM69GWm40QnnVyfadu5AaI1VyijOhqABcYDmiGykLVoJrjY1m9xiA0fUb N6QAK/8R8B37e6O1RTzYjp5bmKe8mQnQ2Qe3THtfN/iPdikAjPwcze2ThnLdAKDFUPDJUIpBBBJ1 DcHCBuA0HAlIGK4rDVi2gJDtIr+ZXzkn+B+4GvxBWgSIhvRd3NNVtJEWnEaM46qpq5He/i7JQ16l a9eaJBs7xMIASMN0BWGeJMMiNUjhiDan5GSJF38zUCYNVsMhjPcIaJyVm4u6wmqOb4EVbQigiu4g xHfiPZsb4zKFYxMEENaxohsTcifeJ74allHw8xB4pABAJysvWzKQ7mIE99xoV1omdgVBsRcXArzC rcU5fLXpGgAcrEFFHikAaPVjRxe3KvfC1RnC+FCWhoAu484/1UwA8bAUwgjpBp2Mu+3mK0RDM24z FojZFHpHsAUacVkV2BDiSfVLH8of6m7D2AYklJMLQNYjFcUZ4EG4raH8srCD6XprKyynbskBnXsx X7KyM6Wlo13SstIlCdY8Kst+WMA8sKwloe3paEs7gGgSwB7HpLuzFZZGuD7xbBBtje9Anlxmuegy xbNBoLsg+q6fmSsI/RmF1E/GPA4BJHX1QxbCYpWXngLQnKtj29TYhHgppPbAv6tNV2UQFjK6s41F EiAL/BoIcAc2YBjn24zm6dR66GY9dity8WY5q5gD7XOj//TEkA6zXYfhllvVj3RnonGwyHEsvWgX rX6xrOh3RQ/NXNeRjxjaEfKChmhvCPM1Ht5xd8eUtPZ6aHILwhcNZgxDIBg9CIHDgEUV54lCZ1I4 N8FUt98c/47x3yNoXcJYDZqISvt8szHwb2LdO+buZHVM9er4OqZoJ6eitRI0Ni8KNQYgRuVCMxR5 pEnq22EVA9286YNydqBZ2iMZEoCbwB8cReK6UWmst1w/BUVyo61FOiJIIhfkJE+8JmrDL4MWN9NN AzyxEg2i65EQkmXSbUDnLGMe6C4Yt2q/uYTx/WBsl1caL5yV1LwcKc3Pl1Pn6rFCL5bLl67Jnt5j UgJrwXBKRA7fuADgmQY6DsLKEoCSHJTy0nK4zLqlKdIvrp4BGWhwSUFpnrS3tclbp/ZLTUW17Dx/ QpMGVpSVSV/XdbnR3CQFWP2H0N6G/lYJQHkwgNu4kxiEbyX3nHy5Ygm7+Ki5EITKrocRF8NIacZ7 jI0xmWxMWRRjrWjpGpBBgJjma5c0QLGtu1uudLVKCKDx+pU+aem8IRnDXVjRh+TymV6NJWhvbZbM 4U51N16Be5cb+4bAa52RYTmPPDP5AA6nz56WYVjbKquqpL27D8puVDzJcCtCGaUOdUl7RycSYWZL Mlyn1y6eETee5VxMhcKii4XxSQR8JvM1Ff14F1Z8TNV9DpARGgFPw6oaDZlYqESxYVvO4FiXxmuX 5fz5Bskvz1cL1/UGBO5SyqCPHV5Y1jDWXQjGx4yS1Oiw+GEtTIsMSh9cVJlQsgHMvetH6iUFO84o +DNgZbmOBUibewQ6gOWMn1dmzBSwcKy4FRqK2z5HTVUwGjgEpX3w8AGpLS0RHxY79edOS0VlDWLD wnK0/qAU1y4QL1w+vY03UG9E2tG2QH+bhK+NSjtcVYNwYZaUlEgHAMv1YB8sjKgK/Ui8qJhCdNUF GUuFRIo3xSTFVaCCeAWgLlinBuUEtskXY66cv3ReWnsHsGCIYmwB/HN9UlE0R9paLyNNQUjOoi8j GIN+uJ91DHtvYDUelly4z0b64GzBOF/CGARB707ktcoFwBvE3OoAcC0tLpGruNdz9QzilABKsJoh X4cBHjGw08osttcFtMyFCfmAsp0ANBIewSKgSZq82KwBhiW/DzCYHuCcYLMB/MyYo9b2Nskc7Zb2 ESwMYGUKWe5KDexH/RGMEWOWuAiYXO7MVL7fio6YThXF57ruXCSt0P4IhObM2znzOqZ7cszks0ZN 001gd1sIcyCKBWoQG2cmjgXm24naaTo9dKv0npmu41wJDAMXgPfCCMEYS8fZ0PvTUTFeBzzsbllQ UIjgWQo7KAw9D4vb1M1KeTxum67oab8nE6lyBbNjlRg7ZO+mfeAW8tT7lsS4qTG8z6+tQbXHNgZs xg84uzRuUO1ndYYn8Ifet8s1Fbt0izk/Q5HollWsxjr6tA/hnusIOkWsAb5O9mLFRKFO9wNWl6kQ zD3NzZKB3znFSCZnmaKnpdUv+QHjtzbncqmlJCPbspiY8YgxbmxcEpg3titwbCeUq7jTD9mzmwYI DlLUxdZ2vVnSQL9sxFf0XEcqBfIJ6Nwd7tGYFR9olwb6d7Q0wxLgkbnFZdoGBrIO9N+QNAhkH+Id umFJomMgG0G2fU0tGjyfjtXyYDusSFCqc/PLLHO94W26knTBdyv43zCDYRes5M1l8egMxszeXUaw 3dUEpYuySuEGa7/eIqVZRTKCFX0Aq5YMwgdYSZjVZBTKYxR8lgFgEwJPZcOVE0IcDpvtx/sFBbC6 QXl2wM3jgQUkEzTugkKH6UhSoYy5SWIEFpvBrh6Npxrq6JBBxgIxhkLd7G4ZQL1VsOSRnzVoF7KA eXdoOZ3oimVu1oSfUSmvqlVC6pxW152xRhmLEuhNwQdXSjUtQegXYzeCCNanVYsW6xuwlDE2yeNB ziXuygsPwmUNKw/c16P4ZphuQnBFOseMCRIBVAcAADMwz9ILSzWrPWl600WRxjakZ1rz1x5v82yU 85RZfaHQ+2Gho+WqPD1DwgBfAbh8ChjbhXbTzZ4CeOPFczVwUQUAStrAq3QVZYD3BuDGRRSK1OWV aAXkq8RYN1vuMVeTWh0nWWAYCWNYUjcvEFzBktoFCzUqlTxYTwly5sESmOqClau7UwbautUNHWGg NcY0ibsYuVt0EBY61DOAmKVRjS+NyhB4hAtVBmX3tLVrZRngp97WNnx2o0yQgAHypBnGYUER+jMR XccT2poTaltUuUz3G9zfsE4iCk6GYN0KIe61BJbdPvAf8zrlYhEU6O2HlRoZobHBIITP5Vk5sVQB SgOWay3WrJk2xSzjYCfwQCyMw5LvOuDTTdLxOsKudZyemaAYVRvKa1lTVzJeZo7nhSkVb8KX2qRp O2RtFsKcggw3Sn3m8mo6at2Z7+nZckGm1IwL6ZhBbRPRTl2e4+g0Edkm0GXeXJhXf+O5z2iwJt+x DcBcA5mIjTt3GRhGTykHjJ0wwx03pRpFZkI/TdI2KjV1A1gX22mnZjS2AepUC9xxXuhEZ/FWIPI4 liJYUyuR5Rqwp4OWw/gMWhusdpnDInVzs7aRysuWHQYwGFuTWgrYCtMZbQ1NiBReBB1c8N5Jut6J EVMMaQFWpRljkhJ4xIgVm+viwYpjbBAaBwJ3G56lIMZaS7f7U/lz5YB4d003AJVpStPnDa0oKDUe ih5q3S5P4mPXDwUo/da4Qboa76hJ1xDDuQR0vMtYFBv48VkdGysFwC0SLT6/TFtvZTw1Vgc/ds4Y vjyCoFz+Toa1yK0xHPYWesMsyk8JilUpqV8ZvmZ5VDRqIeHuSq7idS6Y79RBYbkEFd7ppCBPAvDz OYsnldbWD3mZYzXejjSeVLFR17kWHzO+r7GO/LFANeumW83DHYc0+euYmIQPdsoALtb4vO4iY8Ap wDNjh3VnFjdIqAvGtJ+8QEuJWmXU8DWxwohz5s0DzXgqih/as9kG8o2Sx2o7uUeTGjCuiDsKKSvR drNJmW0gr+H72LsmPo2pJRKv8S2bjGdsnrd6qfTTVBhsGMaWAx8mkOX2eLigOLYbV63QUVNQZbkc PRxf/KPlZUTHmvPMxKKot9gSbNamSgXGeny0BgJxpAwP3Yq8SqSzTT/KyZC2BS4Utd6aw7/NvDZ0 I7/rHCVdNRzBUCexPFve3DyC5o6RwMadbf0xroTJ3pz4vinP/Kg1Sx8z8XZTtcF6ym7JhI/a/dLx SEiBY9+3da/dBrvv/NvqYazc8f6eiSqM8V5MrtwaLe720xPJlJm0YeLZH3/TSOubr0Q+s8fc0Jpy AaY3rhiwx+TuXLEW2rlZGNlHAUQhR4FJ4z6baUS0i345gZncja25mFBMuR/mkSmq+KL4JiIpTNBG M7ayMCegWcXx3CU6DfQcoFiwphFgNqm4OuRznJi0FNk120rabEfn9mtOZioqPGP5cw1oMB2KQzDj ojD5fThZjeVsypl1dyh/G7VY/bNODzfgCNYLSGHtNbcQ2wJJU+RyXy+zijOXCdU6Q6UpwplLxuzo 484+o+SwfdmC5NwbFkPn0+SDtN/RAmYp87edf/Y2CDRrr6SnJnR8wn5NQxilp3Xd4qm7sfcm6E3i wdez1llr7Caju5EMuudM+8R8Mz7MbyXLBH1jxNWduniAA+UJvL8KwkYxBxj35MO89gPMunVr+sTX VHS97fYmZrHm58T6LTTLfFmUY36NoofFHq5cna8Ak4wLY/yebaCfuB3T89pM2m/ksbUgHINSTUxR 4i3u7PRB/mvsDCx7t7eMVEhHwWCvZ/GZMN+G/TNp9cTPcIey9oUgYyqUdAtV6EYp8HVcH9lLnukK sd24iXDafmcKBDddsb/W39twc+JOjmHP2LLQyBXdxzx9XMksUi+GK/AByxmIP7VKUElyqymD3jhB VFBy1cZlEXM3qSUB9/A1k8MxJkZXRoQnumTB/7jQ4tTTpIRYsWAXHe9pLhyuusiVY4LE+S7jQxiE DDeGtQLX1aGVA0Z96kxwxxWcWpUgdLiqYGI4MHgicc20t1eilgXLrGsmXeHOImXvQFGWH8oy3XFr d5SxARgP3QKvdDYClfRxc5cYg11VyHENy3OYzIT20lWJHw4Bx2K2BM0d6LRT5C+TAhQLNBtxcwTj 4AAEXnr3TVmycJHMq66F5VFtHXethXRVMZO1rWuj8KdH4Fr7yXuvyjJkBF82Z8HdlZ/T9NzeNayC ne1mckzkvEiDm/aVHR9KcW6+rEXGeg3cpbK/g6S0Rf2YXJRm3ag7HSljeR4fYwV/+t4bGOPFMhfn vjFBry+2arqVobZkPO2uYKFBHLILBy8K4ALNArMxl4vdOttOagOpRDsDG2uslek8zsPSlbMBlMwi GtZ0xIONjCJHmnotqE/MLkJ6TNQoag8R/9bPfI9ymBZF5j5KQnA9jxWzr4mA063Q8Ff7WeoW5kOj +5z008SxNqjVobUNJCQmiWpuGdoTkthAW/9S3jHJXu7iZUANZwnMwKFBOV9/FVvj+6QYSeiqK7Dl lqZ4q3lYC5kJhV0bnYilSMXuHO6yojtGjyjABEvF012IBcjG9mETGmGOzWBOop6udmltadVgxUWL FuKAVmbAHrtKMsnMAtLb2SN5BQnxJZpQDysefNfR0StFhSbQtLMNgbPZ2BWEfDY2yW3yETzRbMwD BLs7sa0aKzjuKjEJ0n71mVexLGIKotBezc3tUlqOwzNjRmgCIG7SFWltbpFLjZfEn+LD9t7F0gdh deHCNbUgMRi2BGPlXA4FJqKAuh64KKGLCADpp++/KmfOn5WVK9dADsQ3zt816nHtRZkBs5dmy8c8 /sWOt2XvycOyYvGy2CLprrVnqooswKPrXy4qmT2du+iwoNl2cCfSZuyRLz73OXUDemMxBHep5Vbb 7ISoev4VhDutcj/58FU5ePakLEPOMxdiCScJgZu2oQQeJqGnSxN2HkOwe3Y27NQR7Dr2Z6FsBqIz INx2IluLQI6iurKNbmB8nlq7eZoCnm/DRoctWx4wObbwxaws8NB3bpI4e/YCUoH06WYBbGGEYRDx eGwENgLQIqD6jwtLWgct0xxjK7ngH0JcJzeoPPTQQ6pjEnyM09Lq1/cBHB6NuFQCJaaQYaJUbpLR hKXQxxxP2yNve+0VNtGbpJ4k6jCTSFtTWeiZEHf7UtcVnS4u6etul5+/+AqyqNbJsZNH5eknPgPv XxC5Xi7KkpXLkGisT/IBbDqaeuR7P/gbefhzT0sS8uK4sPNi+ZKlcho5b/qxM+/iwZPiK8iRFcuX SNW8WniEIrL/wCHpRyK6+oYGqZpbKZfO18vnv/BFJBY8q0xeVVWtW3bTkMjs9JkD8uZbB+Sb3/6q XL5yVWqqK5FoLVf27t2HDMZu2b7nuCxbMEcWrlol2998WzY8sFXasGU7HQGoFUXlcgrHZKTAerJk zTK5it0n776/TcrK5oGyIdl0/z1I/kekH4Osd3T1dkeG0xa+WBI2Y6fYgX2n5fq1Nvn6N56To8dO y7xFSyU3jwCUQsQHGr0rHcFBSUpPAlAdkPaWFmQJDkgZtvTnY+UUC/q4I411Cv1Vo0DMkg3pda3l OuZyluYe+8XuN+TNne/I//nV35FKbHhQCxP3xN9B68d42tGKfLGtSVKQZsGPvGjv7/9A3nj7NfnN L30DO+EqYzFYHwuaUxFwcQzpf7WzGUkm/UiTkCN7z+yVn/zix/KlJz8rC+fWmVAAgoE7TMjEYTJ1 GsVz6XqTZCCxJHcLvrX7PXn1vTflH379t6UO+c0YTqHv3YYHVWOtCGjVQIBUCNAd86APAiMeaajH afIjfVKKFA9zqipUHtMyzsz9TKBJhRolCGeWdbxPAOL3w5oJ/dLX36/Da3aDzc5lGzf4u6q6Gmkm kKwUuu3U6QbN1L2obh4W4giCgbuUGyeSsPAfxUYFbkShkmfQfT92Up45fcqK+LBMT3dxbswOJWa3 FIbAEHyWlBQDIKXIdWzeSYMVMAV5xpqxe7IE6WJSkR6GG6+YU4/5u0L8DIscNmUqQKJrP4x8bTzL NsrzBGe3idOXphuKiaItC05NeY185ovP6/bbQwdPSPeNc9KJJIxNrdfAqF7ZtH6x7H3nmKRi50P9 2XPSe6VFimqrkJ03XQ4fOCwl1RWa/M0N6fDBOx/I86VF4unoR96dPqkqr5QcJObbvPUe+fsffF8O 7D8ge/bsQ90+WYHsxJ3YYVELojWcPYUtxSny4QcfYDtvj8ZCXLh4UjpaRyQbEcZdSMR3/XKj3OgK SQqI2gvLyHUkWKvfuVtWz1+Bs5EuSibuh31ROX/sEND9EAYlHdljscX16lVZtmyxQfqJltzpSfWx eoLMN4wt6zu274BQ4RlQIm+/8gs5e6FR6i+3yOe//JykWFmok2Dhe/Shx6SsslR+/nc/h9kb2/WR H4YmcB925kwWXPux6rDTmLtGAbUAMAgf8TWnkEX74AnkT0JSwTfeelVeePJ5WVm7CPmK1M9+53eT jOs1gcRRLHxOtV+V4soKefPVn8oLDzwh9yxaDpeROR/vY3Vh274PWcAbsZh5v+GIVC5ZID956Ufy yPp7ZMuGe7Ezzzh0bF1qO53uhJ17vL62Le2nkQG//vB1SS3JkTff/IW88Oizcs/cpSZpH8MXKSh5 UN8tX5ZrhWBJzQPIjYWt7l1dg/Lhtr2SX5GnSTG7BpGCQd0xEWlFWpZFixZIS0sbThQYkcqyKrly /hJSirTKpz/1IHjSbAqZFetRYn8SusediiHw97FjJ6SnZ0hSkbX+KhJrXoSxoLC8RGM3L19vlCqk P8lEhnSmZMnJzJAQU5eMcSWxAmsxfsu0+3V6wcgTWod27dqN/HCFUoNdcu/v3S33bN0sN7AjdU51 DTwezchE3y/LcGj1pUtXJCM7X3PInYfleh5Aaj+ska1IVHvXQZLZ62KhXuxagTdLb/Uj629oNCw3 rl6T0vnz1cYYgi02hBwwUfyuqayW6mVLpcWbIdc6mmHJaJIy5PV48NGtcuPUeVm79UE59OEOGQYc TMLWXDtomudiKetAeHS0dQB990slygoxhwkyOwewVT8DPt15lSWycE21HD5yCokfsZ2294p86okv Qzj3yIUbQ7L1vvXy4/cOSUUatgn3Y5UBFNqK8gaLh2T58tUy2tIBK9Q1PV+pbvkq6e9xIwdJlnT3 YYvtr/RFCWF+aBYexarr8UeekV/85E25Wn9KcrBl3MOz3Ljbxu4nMijT194PsMuhZi6iYmwjriyv 0NUROeBjplp+pUfo16Hxdub2lctXyt/+zdvSuaNNPrvlKfnM2geQJyken3GHjR83kxIxPfcvXiFv /uX7snP/bnl6wwPyxH0PiAdb5D0Mmv4Y6SS6A3k6sgcWkiXzFsjLBz6QH/7NX8lDqzfI1x76FFJs MK2CiWnRDI/0MN0ttapxH0wqGZWVq1fLT777jjQebpYvbHlCPr1xi1qQNBqEhiAo/ttTTBbysEJN yCuMnWTMKfdKpiBMIjW3UA7Ay+CHN4IyLR+5wbbvP6bnrSXj6Jl3th+SQuRU86flQD0g4YMLLZ6l QO3J5qkJ+RCkaRiWtWvWIxt+kuw+fAjetxQ5f/EGMuT3SSUsIycvN0HvNAPoBmXL/ZvQfj2tLz6I dgW3gy9/HYSI0fSxnpCmGUj70d83hMS1NyQrp0hOX7khu3fsxBFE3ThCKRX53UaxMLssBw8cAD1T kWm/WgqR4f+9nYekCZanXhzXxJzXsetm2o43fcwG9eNlJCFHRivODfqL/993xZcZkScfflYyk4Zh jm2W5XOWyOXLffLOe9ukPGc+jgKKwJJ0VkI9TJLmQubeWtnxzjb56//1N5Kcilw7fo9kg7m5vTgz P1cT3NHkum//HiTZOwUQVCOr1q7T2CaaZBfgoMvXX31DWnDu2uo1tUge1w/kfgkAqB/usVxZt3a9 /OhHf48cKW4g0XIwrEeKi7OR1yNVs0E3IZ9KVWWlpOBoiPQM1B/IlNKqXDm9d7scff012frAM7Ai XZHaeVVjBu5XlRe52s8C0s7OypXvf/8HSM5YIpsefkj2HT4h5eXFMFOHkP2Ze9lw+C+y+r726quS DNpsXr9JWpBNtx7HZXQMdMgSMG7B4rpfVTI47b5DFOCc5pwtzimQF+57QgZxVt0zWx7H4ajc9s9A bog/O/b2DrVhwmKRH6AkNVu+9uDTUt/aJJ996EnJ4pE2tGx9zC5dftIbibmaC0v2ZzY9KvMLyuRL jz4l2Tj/KqpnsNEqYm1/u4vt5/iq9wBty0ci0+e2PiGtPa3yhfufQP4zHN8COjPuZpQnP6BdtweS DJhO1FIuuKlScUZcRmayJqVtvnEdR58UQDeEpBV5m7pQV1VFJRa8rchu3yPzkK+soqxILsLapQli oVfsPHGqgjXNwyzoQQtcq4sQdPEj3qm2ukree/dt8SIEJK+kDDqmEQfAZyHnlVsTli5bslhOnzoj dfCkpMKVqpnYzYian9sN5rqLfHDnqzLWRM2sD0bKBQjmbmwecF5SUiTXcFYg44tzYMCoQPLXdLje bjReh2suCYdOI1YW1sWGhktSUFSkWfSvt7cAlCYgr7EmV7P7II7M7IGwGeT2DLQ4qxxBg2a1kJ5d Kb/5z7+BwN5+JMPDuV3wxW595mlZgUMVC3AEwJLFQXy3CodwAtXjHw9lZNblVDSeh30++8Lz6DyS NsKfS+FQBdMkAz95cGTdvDl6+OW3f+ebekp2KTLp8vrCVz4P61QICj9LvvqbX9RdWRkwXa68l1mG cQQAzlfjJOIhmMWFVbqrwY92MZDrczgWgL+ZzHDlyqVKWB7OaFbB5sTshXNrZRDokwdmnjjZj/Of qsyZeL8EwfTRGZJjbCfQxF41CNqnPvWcdN3bjYDIbO1zxQIcVIsV9S9+8hMFmDwId9N998nSzfdq hui8vDxZtKROlnWs0N2DpPssiJiP3jWnhI8NBTRFhq2AwFNPrX0w1jbuwrLNjr8MvuHiiIr3gRXr 5AFZF2unpiL4GFmR2DAvZQxdaepqcsmm+Sv1x6atySOVMOzUq3EVe+f4wRo4xqFSmhBoPLNic9zl p0E2xpOKg1Vu+zI7xoxFKgLAPTgwCv0xoClgHnxoBc6qG1aXLo85ok447wlKETL9FxUVyGBhpibo pC5hkG/O0gqAyj4ZhndjFGdA0sVFFw6v2QBJJtcRAtehixgby8+FiNPauH6ZxkllARxVF6ZKEs7Y u3IxjE1FcAUl4dw7ZJavxGJ9sBfJQRE3NYps1GZczdh/0i/q2QC8RIM4komu1oWL5ihddKcbwkDq AoUyuggxYMgPqUlK8W1JZqXUwcCRAmPL2dP1cuN8s8xlfHN1GTxBHcArCYfvjSWxzrSxNJ8FBK3N ilXkUabkjz2RGRxHgMSLDJ2Xlx9rgw/Mk4qjFexnGZA15lJmMRNlyZIluhJgdLtdIe+TOPb7BED2 lQoC8eLRDfb3+WBM+yJLE9zZF5X/zRcC7ACa+MMdFGvXrrV2Q9xGFOIEpd/9W2PWZNaWSg8sa4Yu BKiFRYVgxlF57LHHVJDw4uqHxwzYdCSIKoa5OEZLe3vB3e+QU+PHmALjlY8GdH8c5H5CG8akS/k4 tC1hPLU5E8joqdr8y+hC4vJ6fNb+j9IekzjYWHoIvLnDrR6bakgS6hVNuorvuzpaSSjEjfpwFmS3 9HZ1qAKlRacDx/5Q73GXNcESZVo6Ftvc2cbLBvSzMY0IurjQvnLliv7mxR3bvN8Ci5edX88PaxbT GXR3dkgRvCTXrlzWcQ4ipCE3N2c8B8xG035ly+D4Ui+14Zgq4gVznmZM8ygPkK793V3KC3opf7il B+chZmGT1ab71kHXhxB3DDrzrDtl2BgWsoBRAoiJZx2LJ/+yS57t3RG3gtAnfday6qh5FxODSJ1E 0UmSIECmq2v89zObvOYpMjl3IRDkmQAyBEtak+xXlvvGNdwWRgSiZMQcnAFlX7xnfz8Rnaej/a8L jZx+fDQKfBz55OPYpumo/HFu82y2zVZ6/E1Pw5YtW6Ykjf08ZfRMdq7div6Ybkxsq1ddXZ3MmTPn JvCVCGxZr+oU64d6xb7sds8mHadr+8f5e9JtwQKTu4w/4/X+ZG1nED/BFQ9S5q43s5nEROzh0CJm uufWWmtXgWXpiWVdIDrnuUb0FdMIZLngNIngLFiW7gTBbQIpSLRWF7aV407UN75MGyAktuNu1n+3 +phYTyIwcpJF3o0R+GTUkaj47Pn8y1QIiYp11nLm3IWhTKSjDQp+mXQc3+XxrqzbaVvi2NiL5MmV onVMFIDHdAtYu22Jcu122pfYlkTdMBUfJVrHqPAT22qDp7vAPr8yVYxfnM90nLjQZxoIm6Y2tOHf Xg78CE6rZ9CcW3cpmXghRj1FseWWbqMQElvR5MTjOQiSGJfDE9f0LCnnmpICNpN/ksj0SezzJ2l8 72ZfbV6yFdRMhd6dbKOtjD8ObZlpP+22crFmf/64tp9j/VHcWo78mSlXOM/FKWD7ihhAbJ2uqXFe AKYERFEg1Gbkizh/+SJO/WbmSf5w2zxO4S0uldqaSmyZR2Azg59MWJyGnY13wN1Zkn/MoiRn2Nkx 8QAzfOdX/bHxff7VHLlf9VH41W3/GH7BH/ZKXne4/ZLi2WIRCdaJ1lzRm8zNsxPIeydGy26zHVKh dNSICsZ6mficj8PFAFrbvaEZ1z9i28aC2HhsrfkUD5zQszf5n4Zo2JSw4uDscBXLpBDjwVkm2BgX nrbPviYP8LA1rw0G7+Q4mvaNb8t4vkn8fux3NvXvRltjlJvQw2W3cYK261cqXBTbxEASbwMowZJk 0nVfQjBYazuOmkDCNJcPWxIRSDbYOyqnkcCxFrkD1CRIFgN6sv/dnrstkWlxLpIvWYOmKHBMynAr IZjyKvyw6ldEJmcka2R+D24TNqc3GX8j+2TOvWE6emPZMm1l1kymATBEsQeJwk13KlgCQu+jTC8y a7Iweh5ZDzeimvCmj4cgmeW5eRvFmYBI9bYqiKZ0MUcA6AnZqtmsk70xLjwQkpeXO5f4HGPCIABH seOAO0+4A9H2GfNZflZhyX941YvdQ+qDVylmy3b4h3m6PcZFhZYOjYmMc0bpNob0Y/YK+UsXYhxa nt2me8Hdsg0Z7OvmzZNybIs218wiBGere4xX4FFI/C8IkePB2Ujbtn2I3G1VyM5fE9uwMFv13W45 ekYl5w8Dl1GIh+ez4TfzJ7mxZXznjh1I3ZEndcxDZ4G9261rJu+NAbu2DrKGz8TBorWU1aDn+++9 K3NrarFDuUrpycDp278MfwSwsKesMbubjGxx2+d1sXbVNRQeiWdJmne17VYsEHUGd+3O5mWDI4Yp cNe27uJU2li8bbUpBvi0vbaMNLxI1eRD23w4ly9+zY4ktPvOfHcmVCQBvll6VtscA9128+M7VcfT i7FU/Imr1Nlp69h64P0CPePhHwmU0aB+o3dsUutn/dNOi4G+Iv+UK3YsGY4l4cnaYeSo4ASbWzNH 5s2vlSRkGU3B1sP2wYhs37HfQBIFIlRaLNPaFn4bAIJnqxGp6bnU4RG5dOGGdPV3SjJ2ndXOL0Oy QeQ1AONEMDj+JCY980rfQFCGBwKS7B4Sbwbyj+JZLw5tHEFSR2bP9iMfzzC2Qnp5YCK2dg7j3DYy W25+ngQAvni6NP8FsJ2zq6cf29ez0Akoa4ChJBx/4EJdvW19yPKKwwYhDjOzsT0whPwYyHR5pxOJ zebEuzNlIaMIjiPBngvxYTiS3ckSRXbyvtCwJHtAW6SA70ciuJRRkWE8lxbySi9oHElLliSA28Hu PsnCzsHzVy4gkZxINQIVo2RACgEcH9MbwNEweTlIyxCUZAJTBruDH7n7gLsXo8kAS0gRn6Qnl2OX BzKpj4J/MpCUkpBsFMI0BXUGNL+KfTr2naGEU+qdo4AtuJIx3/2Y/0PYVRLAsTav7/lATl46ji25 8wC0sbiBdZvceLeuMHiVey6SYTQKQOGGMv3y5qFdcuT0AZk7pzq2MeNutWeqelxMyAjSDPqwa4r5 4gIAmpBtgexk2XbukLx/Yr987vGn9VBZNzdcoDCe42bOx5x96Bm2DDSqLVA+dQfvMaxDwkzSGJIA kjq+u/dDOXr+qNQshWzAHOY+Mmbnvq1Lz/fz6Y7bxhvXIEOwaywMnkrORkgJWhDoFzcVP/RGyJOM eng616genMwDuHkyKNdfDODlYjmAY0lasVNqCY7BIlCarUUzu8eFf0d7hwRgHGBaGQ8W6h6cTMBz 2aI415T6lmqS8cBcSDLPFKmC0/h0QcrUBL3dvTiOa6VZpJLGPOBND3n7aBf7OTAwIN3d3UjlAl2I xQrzC4aRH0yNEcx+z+Bm0g3Mw/4w4FmND/iPhg+mVKD+JOAaxpb8QSQXXoFEy2Hc5xWlW2uWczsR Y7bgvFb+9qLNahShYQV5/LjLGvDAnGtLl67VNiaaJj2j9KKhP6Q3OxSNIMyIx5IYoutIsGf45TcK LMLDXUe0INtIaTBuXEjx061fxrRKInbjOJGf/eTnMnfRXMnG1sbMvFRpbcLZNckZsnjuXDl35rgE ce5OyOOXkwcvyuIFxVI4p0waT5zF1sc86bl0Q05fOC8bN90rNfNrdLKfPnkSx5kMy2FkLL1v6xZZ jJTj17Gdsr25VapxbtHLP3tJSnB2z6Z7N0BYROXooaOyaP5C+eDtt6V8YY109g7Ius0bJSOWH+jW e/jr8kZ8vc7VKaw4mCSdmNTnrjbK/OVLpaf1hjQ1X5cSJGArxPEvbm5pRfDah2+8JXPXr9XcVO+8 9ZbkYAttM5K1AQFL72hAVq5AbiWm4gefvfLjn0pOVZlsuudeGUJ29Pr680gJv0AOwHowjIRv6zBO BRXFcuLQIckpLJOOxjZpHeySxx/eCgVA2GWEg2NL+tXmOtuq2NQFAZeP3GMA1h8e3C5vvPe2/PaX vi7lBaVA4eYYkNuROrdLHeqDlr4uKNlk8QK07ziyT1558zX5+rOfl6LKMuh6Wp3vrmVrsr6o0IcS S8LBtm3Y2t6J40lScabigfMn5O9f/ql8dutTUoedVJHhoCZ9vdN01ET9NHpQKXEVzxwqWFRdR2hH Rg621ad59dDdt996W77x5a9KcUGhorbbb5fRZowj4QI4A3KntLwIOgTn711ul+7RQakqRv6h2koJ IjNpEApQAWJoyHhHkHgyDBTHHHfDyEHEBMVRLKbbIPNmCxyNHTvUCYVcVFyoCZF5dtvZ+os4uy0F Z85VWelrzBEb6ldR9y4XCMY6PzI4iCO5evE3fSvmmdmSg7ali/maCpA3sB/5CTu7upA4uEqPcEnL ztBcecREzDXI89I6kd+Q9RNEDQ4NSElZmR6uzPZxcXv27BmrrWYxeyfCdczxRl5NU8O8i804bD0V iVWZ4qetu1MK0KYUeMkC0EPJtMAR6Knlkh/hqcLfBFYEeCQnD6n3RoACGbTNk4X9KThvLA3Mi7/9 6FsKkjIhqTuYnMF+yunWQNyuyDHv0R1GxKl5KNApWgwKcb7KsSOnpREH0YorSyI9w3LmylHpbQ5J djUypA57penyDRxJ0ipXzp6XymWLpHjEh+SPA/LeG+/KcznPaabnpmuNsmzFCvng3XdxWOApkwgs NIqzgo5LIwY3NDCiz+xCDo1RWELOI3nUFaQqdw/0SmZukfT0dksrjiXJzS+QUSzLDPM5l64GQLOX X3lZ2mDBuw7QOXj1uoRxPt15HMfy2Befk0yuZF0BcUEYeSwT7dDIkJQW50tWEIeWIrtpulqA4Gbl IgnMGOgblEZkJt81OCpz4VKpP3ZSGi5elIyhiFwPdMu+bTsku6pIGvYcFEh8ZE7H9k7kN4kCxGO5 ZQkFO9bCGadfVQqQv3wenxw7f0aOXuvURdD7b70mX3z4KVlZA1ANq7YrAuXH+Xj3DEk4BsInZy9e kNMD7ZKJzPLvvv6KPINjNFbXLYHsslz8t6/VZ3W4uBJ2wQqbDgBwsKlRdjSfk6olC+XVl16UrUtX y9aV68UPRUyDiopzi453qvlqQeIiXVWj8fAxRKLh0iW5NtAqOaX58s5rb8jTWx6WtTifLwrLsrGG 3C5ZiMpwVIe6g4wLn5uPenEe2rvv7oQeKVLQMwqQOAJPxDBAEUNMlmCBfR26gYvrshKc3Ybx7oae eeKxB1UPfpQg8kl7kmAhomJncsuTJ08BkHVDHyLLdkYGTpy4ioVmkfbnRtN1KcM5o5m4D/OWZOM3 PUAGUZLIFqFtEHW7JEx4j/Sjq43YrLW5R157/U35/Atfkrc/2CmLly6DZfWyArrCnFwYNM6oTi9C puoL589LO+j6mc88I5EgEghnmbaanEUozG2OCosnKp6FxsaKIK4ImXZDH+34cA9AXpFU4kD7D/fs lXsffgAgr0Vq8XdrSzMSefbLAizKqYOykSMpiWe3gT9roYuG4K7l4t6r5jmgohEQvqUNgiAzXW0o yWCODiDHERxqyrWb7WgzXu7bR6wm9oQ750wuHZowi4uLkIAwA51zyb0b18vpc21y5cIVqZlXLd7i PGlovwDvGJDzUEBqkAPBH3BLE44XKfLkycaN98lVdGoAWbt9KTxEFagWPu7a2jmyav16OXXkGDJo I5smDsi9DkYrx2pl5QP3yp533pFLnU1SiGM2iMNxLDCEhgduRr8MAlh51ORmT+/ZHMRfzbKoxJic 7dqVq1IBphrFKiYNZxutgKXnw307cXAkTJtgSpLSD/QdCQb0sEA3LEtZOC6muLxMLl1tksZrV8GU tdgt6ZXh0Ijkgv7LH71fDrz3IQBqDyZ/ptTjJPjsjEJ59LFH5fLx03L02FEBxJIkuFlHYE3wwkSv vuWPyQr+V3NEPz6ttrft0iy+FElgf/iz/y79Hd3y2XsekUdX3AOABPc7VnJh+r2g5D6KreGWew3F vaxusbz44p/L5YM75NnV98mn1m2W1BHIo48ZByKAQFe+buSGWzB3nvzkxE7Z8b398sSCVfKlTY9I Mo4liSLoUo8HscWbCW+5I5fZ6GMuWrm4IGasyMIFdfLG330oTfva5NMbtsiWtcjOD3pGID8ijDNV zX8b0A0VmsU8wzSopkwMJY0CjIXJAvDOKyyRA3v3wq2fLINRngiQKbv2HRA3rA7+pDQ5s32X5FEH wsrkgusX2XNMnFeC+8/m149CNFrYjGvKyhKOhvYP9Mv9mzbBHZksO/Yf0vafqr+Ms8d6cKRGiZyp v4QYJFg2AiF5ACcaBDCW6hqKqWNC0dlbQcTTRjBWkImfcezWmXpJSs2UG22dBmRH++TMyTM4m7MI rr8eCYZbtF0lZeWy/wDkNgwg69au1tMWNMzM9gt+FOJN+S55gKRjTLEbyaNxdhsOLm661gKwlisX Ll2W3bv3yqKFCzXhsXG1nZejMKLAZaVnt2UVZMu2ncelCYlFB0YGoaswW8IASFWV5QjSviAnsJL3 ohYCo1EgqXnVlSqY3IxJ4phqcK0d8HYbjEy60u9HZWr5eI/j9OMsxKUQkzBbdQrAzlyc2nvk7AfS cGS7LNu8GgcTZqLDiFWAGa+1owVWhSRJwnk8WH5KWkaqHoHBbNl+HA44grPVWjva5cP3P5D74MbZ j/Pb3AjmonUoAJfOSz/9mdyzeqVUL58vB3fukxpk1qbrhgHcXT19mMRIW48JbcIfnYsUYJBeBlYv a9atlQacdbNqZZ0EvG3K+FlZmeLH4oCTPgjGXHHvRnn13Q9k14G9UHoL4P+PyLYd2+BtS5e6hYt1 WRlAnBHBcggC7Sc/flHuX71euhCH1IyzcnKwMuFxL2+89rrMLauUJ554Sg6/+Z6apEtLcYSAC6d4 Y6x0J0zMzOyM068qBWLb03l2G84H/NKqB2UIboRnNjwiKWHEEQAgjTLGAfrTB3nFs8nu1sVVflF6 rjy7/kG5Bt78/OZHJSeMOJcRxJFA9mC9djvq/I40n96AAJUvQEE2zsX83PotciatQL6x9UnJcacI jLOatkXjSk3YhVny3iGgZNejh1kzxIK6A0CoJCdPHt24WZp7OuSpzRhjKCeehccjsnXjzO22R4Oz yR9QkJqqhu4sLPix4ufCrRvnnzUik3IuXEUBWCW7u/rxE5DqskJpae/CIetdUgNrYQ3O5Dx/7gx0 xbCkp5mgaPv8ttlNm2A2HzGWh8HXpaWl8vrrr4sXcbL5AEXNsNanpWfIEDrRhcPUl61YBovNWanB c9R1wVHE3iptLXa6bcJNzI52/iaeheyF67G6ugLHtAwj+D9HUmF1uYhM4WnwDvDvdrhQKbdTU5Ml EzHCFRUVcmA/4vZwLBeziQ8zQaONzO323il0ju7Q/Uf1kJMLrxQxDixahYV50tKPWFfgCy7gqyrK JA1nsd7AOax8NjuvGBYvr1y+cBVHphVKWbEHYBAHCtOQFASoqCwvRyDiPLPS4GoNTMbgNW79DyMo 2qzePnqvjOmSgVRRHJaaJd/65m9IO86h8WPQMxCTlOJJQXzRMhlG8O+eY0Epn1cmmzdvlhw//NXR AQkBF1VisLJzcwVnOssIOrB0xSLshAmrL7IOCHEEZ/R8+9vfVnMZz7yZgwMBhzp74a0pgMkegcaw jhXkI1gY71SVAznibLiU8Dq5gXNa8gpKcAo0vtOoQ/olP3qf74hEvMuF6uoJnPTwI4/IUgRj5+Cw QM/wEMzROFi4JFc++PHLCMDv1d0WDz30iDz3hS/g/Jw+KYG5mG7pAvjdXTislAz7g7/9gbjhE87M yJKHn35ShnGCYD4Epwuovn15h6RkZkGo+2X1SI+k8kiAjGQpw7MuX5pk4aTuUS9NwIyXs3nSBrOO a/Qus8XsVwcX/5PLN8PNjzHFipngnPFwDPY3190d4wis7IFRHLuzcI14FjCeUqC0KBthOU1EGrNP iVsu0QPScEfgKF1E2AixqWqhPFi1WGNZBnRXMBSVLnLNZfsE7hTKYxiHPWRqRABAYhvpRXh4+QbE q6AFBEdst4pZ84KRuLcOhLmDDT58iGwfXC1wqTGkAkrdD+/A448/JF1BnPsJV09x1hwZQezTsfqr OMg0V6rh9uO5k0F4K7Jw+C5BVg7O5vSC70axCShsndqgYSLWTtzZAEssg7vH2M4gxqcS4IzxuH5s jMnISJNOyFieU1pf3wBLUrGkY5F4BcSqriqFbO1F3MyoWuZMjJKlp2zke8vcM/YFto1ls33DsKZk 56bIqhy4mGm9gkGCVpryQhwoDw9NJtra0d6JczkztRAvBH5HZyfAkg/xVrkyNNyHskYBgNlWExwf G+JZVq8uBMMHAYhoKAnh99JlC9TYoTsDAUQH0Y61SxdinKFPmEgUbS2FAWY+MEVyWjbOWz0N8NeI s1kXSu3clQja79INYQBFaDIIMhrqB4PAnwe/Li1Ho4gD0tN0lXHHGblvnYetUTAvchAYJJUNQJJV CLQHYgUi/RhsRJNDGadkJcvzzz8nPqyIfP4MEz2PhxhsXQQm8cDHGWL6AljLogBHJEIYSrYGB8wG 4C5LBlJMdqehjgg+g+mqMmVkFDs6QJS89GTURSDoknwccOjjwGPFWpSXJXnIC8VdFxxM49n+5F6J Q6w2GxCDFjsGZA9zh2I6hC7cEWlpKfLIfVukD2NDhvTDdZoBi142YsTCMFeHaH7FyghqBTschtWN 5sK9VJiz0+GKy0CM0SgUUTJ4rbC8FLyHlSD4sTC9AAoJO4owUbNxRhx3VnhgeXIDJLkZbKeCwRYO szzbPrnD/kvuOeY4FBijFriLjeAoCsXgIUjXWJq7O860zDB2LmUIAZ1Qmj0A9KN+uH6xsuYuzDsR fHq7A8DdpzyLMwgdRDq5ofQZjNqXhITBlKmgKwGJfZGSuqtNPQS3W+vk79mxRVxnUou4mGqFUZ6Q 2/5RusKCsDzzS7r/TGoPj1obGCN76+2h6ykKkETZzbQx7e1tcOG3ox4fABniYqAsQgjSHmlthI7z Q+4kyWh/N+JSmzRZMhdw3c3cDWXO9zK7onBUBayYs5+A08gugq4GxPB4qMPQaTd2t3EMW2hpBw26 27BjGPw21N0hvR1tUgwdde0awk+g13hQO49fITCIG1c1+uvWiTfuDQ2LQQOuX78OoNCsFn+OoUmz w1hd+ycqzTCq0BLW1XHd2kNjYo3zctIQV9WgCx3KcAJQI6+xKUzrG5ta4CM3WnEFD7gNyrlz59RK RxpqIlowOq2ULsQYMpSmt+2GWYDRKMQ0FExD5GvEYfchuXcD4l6D7XLpbKeOPZIsoBSewBwdxY+1 NV+DtTXTkEbbRaycNuyg8VNCcMUCuW+1aybY1sTj+wF0RoCOSHcSD9sveYYKqmUHs2DyQuYiZVT+ 1u2qpCtWRgwCDGgpjPrnVn22iufbmJwgo4r42TYGcvHoFQb0kSlRP4nF6hhozHKtnBQuWM6wyVH9 lAyvUfPwXTTt3yol79bzbkxe5QbSmG7XyKiyOseDsQacOOmFuYK5rEGGAe4SQIyX5trgdKCJn1su MZn8iBcrhgtAdwSBQQliI3BdqPBkMD9zhvA7much5BmqCy7Gxiaa41WsaIxiRE3qTBmPdkHy8/PH SWHdrbH5dauH8zjgAmAOe8SPH25UD3CLMXmN8/YujzJTlvixhdwHGdOHPBdDsGRnjkBwwqTdD6BE cc8V6cfhCnF3GwiVDFEXhswe4LxA+zygYzImawTKFInx9CeEBU2ICgRPmJ1uREqz24sYICPoYdE8 vFVlP2S0tgFxjsA0SZC33MgRYhoP6h0ueG9ja7gR1ZDf0RHIGZcsW76CZiv8TXlCZQdFTzc9c3BB JoU15ogxstwUwO7zOWvhRdmlYSEELgYkJVqRZkMv0NJRXlaFBWQZ6obVlC0wok8XimoU0thYo8fU VIG/tR3aWmx2YMoUVYr6tTWOH20g7b4yvGLZsmUm1xTLZt4te9u8ftagJLNzUQGqbdk339lxV/o9 /jG8hjmMTDutPs2yfiV4rK6uNrm2lJasafxy3yKXpd+N7uBizNy3DxkmyGB/OT+AYtEh2mkTytL8 BjbldQBse5I9kfDtbbuirGWL5qWIV0p3DHNH6D1wLRG9olYeh6JcTOsODqvlpFZeNhObb+ijRNR2 iWyeYSsT3GbVE/9kcZX+stvB0kkYHs9iBtykQHAupaaSwoRL02BKoeuCoOOEJWAlP1KwcC2nSR/J cHhSx4oTxZI/RO/2qMeYkI8ksJSu3PCQHyNCWG0AGSu1jPJWIAVrUQWqQ3Qby09naD9WFCAQD+ux 25zeDOQF6EbeNlqSkvm3Au+7d3HVSfU1nGS2iKdCxtMVGMAECCGBig8NviO7n26ji0E9LYE5nWDp wiovpOkSjLWd8UpBroep9PGbrmrOJ2MPsGb1LIs6uzid15a1ivNa9wwD+NKDQTkSRNgPFz5+/Ixg rMkD/tsxJdk0sypO8gLRWhd5yauJJc1ubraBsbdGX5g8ekZb3HzFA5iN0lTe/Kh6gWBQD13nlnOO AKSmmkpN8kvqOiPPbODBWhM/m3bqDr4EF5v24KO2zeof+2gOiJ0skWZCe25u2k2E1HbSdGl6aP4/ C20dXxHnaeIhwBMM6ZhbsabHMV584x3ueX0YJE8qkjMyOsu6xvf3TqVkv5mKcfLFk0yxNbZYjLdx /LtTYedZnvvT0fwT8/1ENLd553ZprsGelniw5pMBVLdb4CdmNH49Oko5ygVaMJWWYp7AHZU8KBST vtZeP9+9vo5CccFuLcmRVFWmypsUnIhnpAUiVRduHw/mpHU9FpqCNiG83FjfVO+CdnAVGiraIHQc He9GNyyhwUWPB2glg2ETQEpMREswmkJQh05ohvPZvFCvCfg3i6rE4o3MGndzNuueqKxEoRazmiXq OmOUcK5fPgWwZuMREX5pQsKshktXYsiOMXVMT1mFrdv///beAzCu6zoTPgCmYNB7B1FIsPcmkiJF UmwSVWw1S3JkOc4mTuzEWfv3bmIncdZO4tiOdzfZlM2mu9dYVrFldVLsvfeO3nsbzAyA//vOfQ8Y UKREADMjUMSTYaLMvLnv3HvPOfeU75uCLxMy42UW2ngnMJjLxfbKTbrEDtUFp7qYrrH/Zrz4YMJL 40nT+zae/jDs+DsXme1522HD4CmwWzuD3/9u93r/p+/9HoFiwpqiOKt2jYWZzG/2M0TNVWJRIxjF xJC/OVXyxxvKltPIcDLn0T612bqDf5vUG+/3pIf187WjmYtEczUBZmjEhZMhQ9/mxD8yeB7WweDm bkRGkSRAygUozlh8VEMuLGBkc0xkQqPQE+NSZGCIzQ9xBXj41RoSFkWb4gaNK+H3kKqmtcwhhKkS I9t3O2iO5wnNnsX/sTbEwpZihLAfZRMelFow6uxk5BmlEG7+nRGxMX5gsA5nFCT4Z00PWaZiqLVv yJ6NdEqub/MPTrUF25gxDnMoPUX6lZHxq9Gvp3AEMeyapPd6Vvt119tR++frI27hGOv1c/Butn0s 86X7itN0+txFuVRRK/lApGSZUjywaNoBGthw9Li2ypkanetdo/FZLA29BnH0mEp9pm2IqcBCNovT y4py0WbyNXY7pt2iqFvdei3RMm0hsZA7Bt1XnMjgybGNc3C3gj3Z9mvtTRI8vnGHWMcyQxPoPUOh XdvBocJhjpw1BJiXWBRLssVXU6ZUzjAiLszjIPPD/I/FcawJYOibqQArVByc3+eKcuJvLBQkDAPv M6xGTP3T5PUBlQDtqBeF/vWt4s5CVyMKjlnB7UXnjBMYJ16PyzgnEXx8rmdwHklPZ5e4cwBTwsMA 6D68aBl3JqPINp7xmvHpwVA9DmuMGDRi9C22B6CJTW0SnZEofXGGyMVf1yrR6EAKuAGZYjt3lDnx haz/QjUWvY/l6djHaq3xYH0oMNT6uzslLhEhJNCGRAH8MgpghYR/ifKgcojp1XFwt9n6hB1rpjbF Ot5bTpI58NMZ4yBtKiNTkGxfwbqONoVt7MFO13htgbk/aE/Q2eZDF6fhR+M5kuktpnbf3U20n5Hj 4leoLwNwCV45dEkqhyZr2SAHfm6wTO3PpWxsGxsciLBtNH9nc7eFeqzB9+Pn9KAjkePmZfsKRrYj 9+n1jvDNxuXQ8DZvBgM2FVQgM8umousIkO7gzGrs6JMDhw9rTYhNrjccTRqfYrAnuQLggq0AoWKV fgkwFUwuEcYUBV4OFFLz6gO2UU93L37dD9wKdLvpa0S5ZTg5xIxgpT9PRqyi74RC44QRNr29rUuL hT24Py/WzBDZl8/c29srcXgvL3viNSLCOgi0qNs4Tu3t7WjNBNiYtj6O77nDuUDCfW9dVJQPI0IK DqbFDcol5IfiI2CYA9Vv3R0dUH6oJsLf26CoUtC+fxko2oAmkYLSEqvDxaRQufFGLHIA3vWB54eF mw50n3AN+OgYQ+yjP2OFWyKT9w+lBGiove2d8tPf/Ywsfugemf8U8LG++4IceH6HPP033xTv3GJJ 1FRM5KJJXhyy/EBofuGT/02m37dIlj/zmFz74Xb5+Y+fl4f++asyDZRGwU5+KOUx2nuxlgdNY6Zb GTrzuT/6HzKrOF8W/v6vyan9e+Vn//e78vSff0mmAJPMROYZ2QW2GQ6m6P8Ka0WfXZRMbKnO1k75 2W/+vqzeepdM/fhjcvK7r8jeH78mj/7dX0jq3DJFDR/LZRtp6uhugN2eOHFCEgAhwtXiRLftILCi vKQyQsSKLBLRrHXVomd+nl0DRLHQSbEI0qHzmtHOfs899xhC9RBdhiNMwPZwFawRnbBhcTonyiXK eVQMpBvIgdF02mz8HzuCqXfXrLknpGvQDhi0tbUphhCdMLs+ic6H6n06S9qwYBxsjpTwL/QTzLPh oEt+QGu8nA9eixcvDulYbzQdly5d0s+mn8A542GdA+S4yRHKK9h5Gjrj2OIONvH4HRsd4BQwImA2 CWuU3GiBdyIUyl4EZXjnXUPkHNjMwRxkCxC9v/Wtb4OVeoakpacBjCpZamqrsFBiZQZQnfmwPpws Cf9/7OgJmTW7TIoAbsm2xFTgJBH9+RKM76qVK4EdAQcLCu0kwDBbAUr48ssvy1f+7M/kX//5n2Ql ACXz8vPUGSubXqakgkeOHJaKykr5xCc+oQZ8Opixuej4/RSwe2dgPEeOHFGAL46TX6tXrw77BIdo D4b4Nmb1cM6amppUbnNmzUbLJ77HXBROK5E04hxpqDxa3gJ8/bSVi8DzUyCvvvwrYCClyZWrV8Bz 45J5wE5atnAJvVKF4q8Dt04j7pOUlCgdcK7Sgeb64k9/BkyrFEkGxtLCpUskB5ADfjplk1GkEM/r xLodlX9cZpIseWqTXPjbfxfXa3vk8NlTMut3/4vETsmU2D4SVkIJRzCYSKRhD/TS3c8+LCe+/k25 tn2/7AKV0fyPPyMZwFSbKA4SZ5KArqx5J+6YK9Uhq3/9UTn8ha9K4onTcuXiWTglmwDyN0VT5BZF uX7PQ7CFXBPWBaERJXR0JQBVf8VHHpCLf/03ErXtiOwGfdTc3/64pORnKpUEnT1zdB3dNTI1hPom wMBMA/K4rw9MAVU10toDlgZAieQDsy2G0TPA3cSwNRwEs1HkLEUUx7SLg4IJFCV0DvrwXup+HqLt LMXoRnXjV2vfiZaGDEghgJxTktPFj4jSxUtX9FBfAo49Nw7ltoFXY8+ubnVuzcUgwRnQgZjrRhZ+ bCMN7uSLB01ZJrAG6eR0gH8tJydXMZA8CBqkpKaYbIBVCmMHJ1R+CEDkwnZqehx/7+rukvLy8pCP 9UZPSBvEdc75p4NLDjf7+xwwcRBPkfhPxEjis/rgaDpxGLcdPP7eOHjIXBDhPBr5fn0QPKwHoeNY oGWCv90Qu/m7lFBSfW1z8Bj/pdACvAjS1YHweazkZhWBiDBNDh85IefBy8bK/v72gBw7fVCaqvok e0aBBHrAX4OaqVo4UeePn5HCRfMlC2CS1SA8fb3+TXn8159AVMgtFVcrZDqoSwjKVX65SqJBkEvc p4tYTIdPnpX2q01y6tI5iY6Lki7gTrz4q5elCo5RXUUj0ERb4XRdk9V3r5GLaHN/e+d+BRt79NFH 5fTp0zrxjFpNJMU4/gm5+R045SQ/5gpgvMjf2ycvPf88uO06pbq8WZquXULBpV8doPs/8rjEW21m BN+LImwA4QD8PVAuKVBO6eJOAT0MULc1IoVF1Yfo3y9/+qL0I7XbVl0vWSAeTkKUrwNAYIMtSPV2 XMQib5Wtjz8C5yk+nI86ee8JIQETqZz39CMS+OUeOfujb0sxkJlXf+xRGUiKE1cXT3QwLBF0khid ZjRp6qP3i+PFX8mZ7/+7JCxdLGs/9pg4ko2RCIleDIH8uacYRWIJlw/xoaKN94h30265+PU/k8Ks GbLksacEaLnSy1M1256Jq8SOtxB89o1uoWbbshk2Cyb7WmNAvDsTTucg+DWrv/cdmQ2al5XPPCCO VCBhI9ATxXqPMVx2R6x+rAJAoTYSnbRtrT4Qbe9V0Fs/HA0v9BMBNul0tLU0I4MyVaoaqqXHG4AD VQC7UYGDdJ1s2Xi3QW7WDi/zIKHKJNAh40VspEFANPiBN3cS9qmmukZi0XoflZAklTiMZoHuwwFw zJr6esnLzlF2CQKFpoDug9UpjNgYB+nGacMxiFHfMhw1Y6pNpLauSX71ymvy1EefkV+8tlPmLlgg A+UAgcbeyAIB7lkAXvqhz7OzMuXiBertZnnyicdlABGx5ETqfGIW2fNqj9V21cc6yhuvOhPoovuP A/ubOzC+XA18bNu/X+7acK80w+4X5hUCgb1ZekBnNgPE91cqLko8MBuT4JhWXrwsZVgTrXCQa7o6 lL9WL4ahWrFgGhtSpANS8aAtsRoGygvHQPPZ1oeO93F0qSnTIfBwBuHBwYP3gDPHDaesF8ZxDRyU c0BCLT93Gam/EuRn0uRs82Vt/OcDTZs6R2IArVSBnHZ6tFM2bNgsNefIb9MJzxsOH54nDoY4LS1T Lpy+gKxPHJBJ/eLGYoqFR1lzBXxtGdmyePUiObxrm5y9elUKQInS2dErM2dPw6kCiNwgXb1w4QQQ Q5MsQKpodY6IjMp/75SLW8+cOlkQjzoMIGxfxGYomTkfUZ8uBIbcsvbee0E5skOLQ6MxHzzKOnAS 4olQU2kwItzo2QCTvFxdh41fLbNBHuiw4BriETVcum6tHHlrjyxauUoO7NglMxfMF39rt8xfs1wO IuLHcHQm5jREwcw7Zfpuw+dE+geI2wf/17fk8JnTsvypT8je3bsl8PlvyMYvf0n8OZlW23rkHo3Y Qw5EsM7/zQ9k17GDMuPZJ6T+7ZPyy8//hdzzN38uqThZT5RDUwCd2tyvsTyIgl7h1E/+U9741S8Q tXlajuGQePDrfylP/s1fSUJxiYHToLOEN8DOhcXPU3giNVX8LEZuWOeO1Dww6w7+3bfkGKKE8379 Y3L2rX3S/offkHXf/AuJATZePNFexnggVydG32sgRwyOHksEYsGykI2Id5YcPHjUWkDR4AxNkurd J2QAsnPiYH3mzD4l4WbzAIv1BwZQWU78JmZaxlEndeMVy4EO10K1trbKPWCXcAFA+c2D+4HCHZCG U+elDXYxG6wQda2XxA2HLRaYXatXAbFc6zqD7zy2NOW77SaNXHEeIcxYpC5PgBbFCV1cVY/oGuu6 8Objpy6A8oPk8D2oI21W8uA0cOTt3ntQUgHcvByHCj7n0FjDfrDQmKUuori4BGkDe0dMNCheElPl HEiDqVPmgI/RRdwupKUJPbT7wCFAZLhAoF4gqQi2vP72bqlsbZZm/B3BaxbIRqM4u0BOQgDnTp/U 1lFWinRCYU0vLVUlMLLNdYwrmLNBgZN/CZ/gQgGhr79Pzp49LXVNjNCYU5ADiMpFU4vl+LkDcuZg tSzctFgGEoAYC+Rthv0qQYDaG+cSJ6DaGfFyxjmRc3ZCIKxXckhXT6dk5Wah3hK0JNkZ6mCdOHEE +Xp8ZlK6xCDtwwhZM9I7s5Bmq7hwAaSri8HbxhxsLTaXQ9bcs1Zee32bFJbkaaiVDhLrpu6ky97C lo4TD8LkS5cvRRdktcxcMV06agjxOajQ+YnRiD5aB4UFy5bKi2+8Jtt3xsii2XPgpAZk/8FDEgUn ddb8BXCMFagEgHzAneEpg40CqUDnhkJKzkzWmjI/Qsm/Ao9RMtKeWUitqkIPiyq/k2Z0gj8rFlwA JNb1jV0y49O/IQs/9ojE/OwVqXzjgPTBUe7NT0dNEoxEBB+DnWyD2PuXaqolB2Na+ltPS9bPdsjJ 198GqXazOkkT5dLCbciQ/HYI1Ev11XopAxP7os88K3FgmN/57Z9LS0ereKJLlCLEeEoR3Ff8OKY3 EC5qrmiWJb/2rCz89JOS+PzrmOOD4q9vRzQpW+EAQjHHJsoCEEM38ff6pQkUE4OEHYhLVpvWgvKL jv5OlAXkS0NbtXQ314FqAzRWKN04D5vkA31VQhycIw0QhOsyzlwMxspxvPTSS+KBM5KQmQ7E8Hog QIP6oxtApl3NMguG/QrI3HNzMsByEIsIWXcQjp/lkY7DNN/oCU3kjEXXUShpyQdjQis+PxlNFR4p R6QrHv/mQHc311VoyUQCiu4Tc9ORasuRYyCXnzplJtJdTpDTB3OhhmesZvymnsx2llNSkhFxwwHf 2wU7kgi+wEZJgNeTiHGW4nnicEivqQLiuq9bMlLigCnWh6hinbgRsUuTePHVN7HJiJ59vxLRzcLX 9TLm8vAT7dh20EOwVrTJABs5GXnY3/n0JxH26gR3m0gaFgZbQaeVFUl/T59sP/iW5BRnybp1qyXR nYw3AX0bSqs4Dxw3cH4y3AjP4nfzZk+XQTfbSB0ya85s6QbX3BNPPaa8QDE4RUTh3gvnLtA0TpYn VQbwWhYQPvMb/wWnByy2xpWoQcrEywP47BlghgYrHNKOuchrJiCsWQUhsmaJOeqJcmoMwTTc0i2G 8EPgybDm68OPPCK1IFtMh7xiBhaq05uBHP9//vhH0o2ctQOTe99998uTH/0Iugx6pQREhwQizcwt UMTdHuSC/+Xf/4OLCo5RkmzedC84+1JALJmPjeeQ6bOmSU9XjzjxeT1+0MuAjDIKm2wA4ehBLEKD 8jp5fSAlwA4Y8EA9/LUvYz8ToLRPFn3saVn0xBOK+s8WW9aQhCfucWOJOth1BIt9/1//KQh2tUpT pkK3lD1xvyJtkxTbAO2+/xebAXmYYINEf6JLtnzxc3oY6YODMHd1nsxfvg5OVJT0mUO2CWKw7iJC hw+74Jfk1Q99/UtGYOBSWfDkU7IAcxzVg6Q+qKN8Brp/TALVWIrVjdQHfe9FysQNgtsHHtoM/Q99 AjYGNv/w4Hv23HnJQ4SbNEsdXVlo+ukD+W06kTclLXEBdBn43+C0+0l+boVBbrUj6lYHTzRrEsl7 +5zoLM/TBiEH7EwcKJ1aWgrEjYP5lXOXJANjTI5LlGuXkEZFWUJvb7c2NzHFZSIPlFno9obd5c1C 7T5woaYhFXrX8sVKJRaFjmUWMhcXZmn3cgrqlpqbwNWGqBzrRumgNCMrFQ87m49Ahtdrus1MoTcv e7+MbY7fS7aUCWuOoqO9smDBPMyd+ZxB2h9wt61aOE+SQRzsQCqVaNv5GSkyB0GZJETwDpw5hexS hWxYslmmTSmVniY47tzfPNkzrKaYY3SGdKURq8agJhOZ1EQwbeIH++HGEN4bam9kqWAUHCMPvhAp sC7mEpHFAf9QrHwEJKnxnhREG6CllJOHy2BQispKdawMFbsR9YmGcUWGWZVWCbrztM0cqTdEzwzc PB4oBY4P3CythTHrCacV1BTwjh4YaJYvOgfBXlzEaJEpRsvJydbPLEU0TeHfJwj9wHstklD+3Rwk jNKiniDHUAE2M6OwRoyDkgrFs2ntepU7FW5Kaqpy5+lFfBt85aqMccAF4eTWrTQwiE4iHZeGeWGh XxTuS7mzcy4ZhINceHFRCcrhxYK6GDi10bzXyPhyKB918l4TQQLUP0jZRiEk4gKPo7asooYlGg4S gQcHmMEdA2XF2B/NUC5EK4o1t4LmHrARgJ7kYJcU9eUY9ODYB3TTdyoHMIbih5PURyogjNWFn11+ yJNyBL8WDRhxX1Sj23ZVaRl4hfY57HTbkOnm51L/EzYEdUcUWz8ig6BQhw1yQmcYnR5LJ26MY7Hb z6mqWc/Y1XVC5yuG7evoju5sH5B6C1rEA0e8va0CZSZXoXdYmwvOtMoK/L9BJR8kjymKuskDZ7fB h2raOE7SX/BJL1w4p9xn/Fz7s/xonmK6z0HCMUxYd0ODNPhRKoKD5bXL4G4jyCnonBIRiTdTZzkC KuzQzCPHWFdXh2adRrN+uGZYbK46melI4pcNSDP5z/B9Wytex1dptNCnEa/yiqsqO3adZ2bAAR0x Vl2IIb1orwIIjpyDA8wDtYkm8mPMAYeyIbxEkx5wTFMavwg70wAdA1MmS+BEeVG+c/H0CfHgOaly 9EUKHmld2ranbzb/P1wLMnaQr+G726CUdus3d4TuHv1QbSdEdMgJxZiZRcPKgZHPyxRi2ZOk7psV 3RrahNYTsxYGUCbKy2N3bagTSL1gPRuNuTkVkPeLo6M51hAX/mVlO6SFcbBsma3/d+I15ArbC4Di sdcFF6MW4ZtXse7IXvB0YIlTrCQvVo2A7dzE8ZQEUuHgyyhEg4nVD4dMCW7xGxaWoqYRHZfWSDSS FBoFcDvPZ7Be+eBJA2jbeEBCQDDJTzOiIIjUdahKJiVRiPXquy4FP5TnAJSjixyW+GTSonBM/aip 8+K7hIjFYW5hxULZWeDaSBQwnQ25UekRMlhTAQZAUtGs7X1k8W+FQ6a2D6ZxA9sa6fc8wRtdQioV Lb2gLiYPI+aYcz9WxG2jZ9jZFo8MxL36vUkZ2X18w3Ic0Q3HBcZi6mCH10o10dDar70RUOEtzMw7 XqJsYThUzpo1Q6aik43lHzoHllxMy4yRFXeBWj/qW8jLx+imVQLjdtM22c5GsK0ey6iG30M5pqHM YcWKFdbB1NI0Iw4EtgG2Vo8qbXMPW05+az64BtitZ8ZqXj/sV4xvrNe/e968eRoppHNmHNGga6jY zfY5bO+BDhQDQ3SmCRtArlHTtKROkgFitA0eI0p8A6ICFn67oUnUx7I+bch8jv7phrhp6CRRyHRO DAQavWEjZwLUm02tGXNGsPSYxL1tTCqJT7n/dbFhU6lDpM9pTlABRTLlz9Y9aYChIRT4kJ9GAkFG 0Xha4GdHo0APbNEGwx9jQuQqCt58cAXhkEGy18T1C8ZyIcw56GYyClpJo5dexN9hRhuk4RRbhLKn HEmYSTA6iA8iI5+VYlXRmJEsmTIeAf3HLjn482y1NS6U3p05fzVBRAMmCSdSpNooB/GzzoLcU7qU +VkTI7MR8XkI3n62fTNKlCK0kEqs73WHWMvsdnOoOO+gR8ac45k42TDiAdou7nlLD4SzQuT6idWg EbvA2BUFHe/Fz4nw4pjGB6eTnk7HGvUI9SIyq4AOkWWr2AxIbY6H8HONQIjkRyM2ELnT6DhpE5hG kkLvbo+IJFnGf1iT8BOpHRA9YZE0vnxQJqr5Oe4xDoeZCHPmBjEx6lQNb6cVYhu8GfCnZSg1SjK8 ukxZsmnTJyAuLxvgeLxzx8M5nSR2c9LRMYSwRrnp4d0ivDX2z7APRKk+xd9Q/KlRJwuviDU3NosB beGQpzLeQdJOIuBgCtYtTWL7Y9Z6ebcCe5WqPovhQKWf0U8MLNvfCvFYbdmxM88GvqRNGXLGhnLM RjDBY6fPM6i2LUbtlhL28qCG3yGah1AeimSJLMu2RF0kdtxWH9IYLHOZb+z1G6yAb3U+zP3xTrYT 8PtogEQqrXu8LoYBdknhM3lSo6ENoAvOiV2vZV94HQfOpI6b/otlMP3YUfT6NHqkg8L/cdD4Xy8+ i5vQGGf+zdTkU2lQmfBv6gTEQAYMXWhaj0/YjVsY9iheqkxsKeg8Uy62JOyFOZwXNjScQ++wvrdf NxbJ3aqEQ/s6PfGp8rCErc4zzBjnAXOkRaKUGJ0kKzio88FIEiaIMHV2XJ8bn1AChiCBJycuTM4d 72CUE2smyN3EixQnwPREl4eRJEPxdIDv2EuNWbT0sd2Cxa0QTCzkTzMdIEAO5UjEc25wKzrL6eGv g9fvxJafQUN2g42VjhL9JD+cEV1jeCYvD0QRXAKUGw24n5EkLMB+1Mv0Q2W5EOL0egDop+7+xLhc 8CYHYGjbkK8KYKxx6DLyKO4QACOZZuO5mGlupEcYsWHEzhjfYU0VyicZ8nNsh936HI1mwVj6kXID QgvGSH0OWWLMKM3RKInj3azvTQZpR5GobxwOMs5DefBIbBtjpm9vOFvqKernakRb1ThtEb1ztv2o 66nREZsOa7xyUlYJDVypglXbazCQNMcxFBSgrOjMGpJiK8JO+E/KiOkuvt2wu1vnpTF6l0EPZNdd 8XkNw4UFgRB06+AE7c2mSpND6iRZGSBiUOkvgxbEeAV53fuN2rPur0uJdsV43YOcWDuKZcQ+FFA1 Wsc4oiZWbAIw/EJsiSBVxqunEdM/WhGkIWdoSDgjJ2As06EOCQfLwWsUyYrWWA58P0IS0QEmp/k6 LNgYFs2xJomeNpwmnoDo4XHxYpdz4fCtTm58JUnUFC68P7MjaVDUwULESAsauOogSRoWhcjHxomm M6RhKbymH8XZ9OijelUZ6+usBx063aiTZP4zl3VSUeHav9OqKRX10LFe/zYWqYV4JY3idnawbOiE ZctOV6NmeaF0cQqksqWPaYX0eSoyZ2yrsNCSk3n6kWvN/M4sTJ0ea3xKgmnXJXKl6KK+veQ3ClG/ 50u5Lykf6lJF0cAadyL/7sMvyddFCAae1uhc8tDApUcnw+bLe88PmAAvUGcYjrWX+xZfuhXpGAF4 lO34RulGzkviwXcADgUP0w4IMgaORze4Ubqx2HncclicchNAdKovDZE8I7lwNPE9U24DiNDwZEyr wEYXzbzpwYOYU1YZglkuYbl0y1o3t7Iv6qCx5p27vYd63Y1fwOlHmZfRkmMajPkg2kE6SMOoyuaU ZfS1jdEz8lFVx9ufqd9bUTb9tSkFYPGxHaEYv6BI72E6vuxDjTHu9hc/wSCic2wmgm7VZOIXJotk wJ7NX8zrbds93vHZhdsmihRcC2o+iSMfmqKbqGT1T1Tu9PCMTDUqZw3OjDXUl/mM4FSq7Zjx44a4 Qy0HyZa2EkEzOEMGCU31Gz+CQRQ9+9uO1/XKJyyPYDlgJq0FJR8DcCzm/VElrwtbH5BTgHHRYaJh wBOgKgC/QPE03scH9aNOIAb5w378SwOuOXc+GF4Zwzw3U24IkTqhZTXqYTtIBOC3CrBMZ6epfTBC MO/jrbj4nPhsp8OtVCZEhybGBxFQjSOMDU1+OdYtaVwZxwIT6qC0dSQ2N9xIxygcUg31Qgu6nw53 OHlo/mIAzAzIJB+dhf8aVIUIEOaGzNF3YV6jxJUWZhJ+Y3Pq3PKIg8R1m0nulh/xVl/IlU7jF6fh dUSSmJKiQaBDgeaFXbv2yPSiUsnPylFDqRx5XJL2Hr/VD3o/X0cnmZFKRjoQaRhwxci+XbtlRkGx FADnJpJRJIqBKWQnDHciQA7bcXZj9NkP+JFt+3fLwqRcKS4oRG3ecIrm/RSdpr2xRnR94F83jTBT lFRJGPP+/YckHXg706YUa5MLLQH3VFAyJSzDt1SI3ts2VD7iqUFucVATgXiXvHRkF4jUC2VRKrhD kRLoVVbR0V3B6SqdO3Sl2Zxo/BnxQNVJN7ssF2v4JSaMrg0mbNyx62xCE00yPJTkbaOfo7Xk2vZt rDcjV+a6wXhpbvTX1KuGeiMcuvHGwJnmk27p84ZexGeypR7eIw71Ibvbhud9yCUzTrL6HeaAwL1h 16MzWszfMpNh6xiez7k3IskVaUnJEhIjO1gMddUt0gp+tVi0aRYU5EpsnLa2yQBaxJ3oPnCBb4fQ 8L4uLPhBAFsme1AAhmgPQvB9rYj2oD3chWLgANoo6SBFQ0EQAoCeDtspB7rBbwP/KhZdclGoO/L2 RoEHrkOLyFiR78L7WcpIJFYnO1aADUUqFCeOYUj4SfmFKxiTRzJQmOxFS6kL94xGJ9YgAL18aA91 QpG70IlHJ8kX6MDP6I5DRMrrxQkfuaJYD7vijEM4rI5GrwBGpy5C82r7RKeOq51bRsdFtNOtCsjN tBpgAfoQzVACZIaN8eUHrke/B8sLc0AetgTgKFVeu6ZptnxAAmjbdFDuPzSj/eDfResNIHMaOBcJ JeGUd7GvMzlW3oLRPn7kEKA8phoqIfInYS4UKUad/lvVbJGXY3BbtdYCQDcMIK3VB1Ww9+gB2X/0 oEwrAucfnpmYW2E5gN7ksVWxogaEeoV7wAdOwm1nDsnOg7tlwUbAjPBEdePgRMQF6WMI0Trh08cw jiZKDmKj5fTFM/LGrh3yofsfwFkTCSQ4InZUdqhqIEwjHqqhU1FBZ7CTFZ1mPhizmCSP7Dh+EPLc Kx+FbtDAsZZ73JIZHjFik24zkQ+/v08x74jwTy/RCZ3FjEEAQJbapUz/R3WyHvNM2lGdFH4RrYTr EG3raLNvQHv7rNlzRzhK4xeVMcrswKNB5/i4sF3A7RkAFE0g0Gs1FhmPaMhhwTj7WcOFCI8PNo/8 avPmzQkqrh693Mb/LBPnDlwDjY3osmMkEEEMQ7xrnN0oNgUQHJQzzsJsBlR4nFD56m9N9sNKydkx uog7SRptoAcHwMgmLJDvfOvHILYtk+QUpySh1b/1ajsK2ZKkML8A5H8gRfXHARSyA6CSlTJtRr5k zSiS2mogaWdnSsfJq3IJcPIrV94tmQU5Gsi5ePKkVACEq6GzVZ79tWdkx6vbJCbdDcwj4Cd1Ado9 q0wuXbwgu3ftkk2btgCsMAWKt1+mFGWi3bFedmzfKxmo6t+8+W559Revwrg3qiOQB7DN85cuyNPP PAMQrQopmpIh3/uPH+Ee90oyACr7AYyYX5Qgly9ewcmyG1DoJbJnzx5Zs3Y5NirSIHbMWbsoTFrz drg0nca6CyguNGLDoW2Va9UNUgY8qfbmRlCU1APLqliBJhmaBKSkvPLyC1KyZBFkliOv/OJlcLcl y0WAoEU5PbJo6V2yeOFcyAtH88lrVBLgCacPxQmM1NW0N4sjJR4gqy7ZcXSPvAiZ//ajz0o2YCsG gSkVbGRuB7VJw8WTdWtnmzhTYDBw8Nl77IA898IL8uxjHwXeSj5aniPvjbgh9AYA+QXik8AM4JLd Z4/KD5/7sXxq8yOSV1wADB0TTZ0IF1v/cTxBBBxAiT2oqYTecQB36tTlc/KTn/5Itqy8F/u2TCPs rLMJ9zV8hjfBdRog4tM1treCzQCHTazdl88ckJ+8+FP5rYefkvlpBeKDQWME0RnEUXbr46RDwQwE nDE4GsREItfYYL9Dkf67vK3omM4ADVa2cToYeYOz4fdZpHdEMoYzHIP6IB+gSmKw1wKgVapF+70N /xI6GBjjJNExywKVhxtAgQOI/F0FHykP93lwGAmQ3A/bZMZpEcbSgWN2xAI4bgQPqTEteqS1QkwT ZUXe+syF6pVaDI/HzwRVihPBiw6Q07sgWwZWWjraJDU9W5kitNYKgnWQ9Bbzz0hhPwM3tHdwrPh3 drUS8iPiTpKpiuPEMySG9BqiOMUAbcrKdcuxY0fk/KmrwLRIlHvuXiUHT++Qpkq/FM/Ilb5Ol9SW V8uVphq5fOaC5ABAsqQ/Tq7CKWmqaZQHPva4ZIIctfpKueTMKJErJ2q5slDT0i/1tTXy5rYTcFxi ZEpWF8gLa6StoVGunDkvl+srEEJ3yqaNK+XQPnDF1bdJEqhHotnxh/9yC/MlHkjerfDYG+sb5DJo OQ4dOiTnQCBJolxyutXVNEMDxMk9G2aC0PWAZOXFywNbSbAXL9euXpM586ZjsfP0Yi9ec3qZ8Bdz yFr/xdQaOxP88tILL0ptS5dUgeuuGcq3p98rSYWX5UNPPKqnNEad/EA8p/fOA5sXgJKDyYmSi0hc XAoWLhBag0kaJ7wMJtIArbh8FFJQu08dkU6gAcfAUfrFCz+TR9dvlkVz5sGLYlsDdSULnE155URP t9m1Iy4oqmNA/K93dwErK1V+/rPnZPOae+Wu2fMlynKQIr1rYmGczgDHptLfKaX5hfJjOBv3LVou a2ctFC8jrNZ/E2GZqNKHanFAjmcuXpXTDRVSPGe6PPeTH8iiqTPk3lVrtEZJM1lBggwuYA3lcwzV f1guu57YceA8ijnuxkEyIT9Fvvf8c3L/6rVyz2yANwLlkkX6PhzI2Kk8+ot61dS7qg9kZXmYqfjV r96S1NwUmQKaiW52+DDSBgVF8tpigCjX48DnReorJz1XqsorpAE2YyO52xiRgNEMz2UcJS3PheNz 9twZuXL5qsQnJSH14ZLqmhpgC2VgPt04wNdKDsh54+MTURfXD/YHRpzUpIdnaLfxXe2oEPXKa6+9 BbymfMPdtnuXrNm4Tpobm4EePkUaYM9JtTWtdBqc6KsKhklntRxZj5KppQAf7ZHmLoBJRloWJhfI L3Y6mRoeBhUY/uoD8eBqEFqevVgNepRrSjI3Iz9bKpsuKRdRX0eP5BaXimuqSB3QU9FqIhvW3iuV QMhsBfgTqTGI5JwAWPde3CsGxsQFBygKDkoRULoXLcyVY3sacUj1y9xpMyUOryeTfXbRNLlWXikp KSmyatkaqa64hgH1S3FpsXSj/eLKxUs4RXqA7D1XEvBvenyyNNRdkbkMwaLmphMkeBkpGZqCmzdn LjzWSniwXpwQcoDkSpoTHm9uD78oeD3Y6TYt2cIPveiCZBRuyvSFAGHrgvwS4BhuklcP7gB2B4oa 2amGMLoLtWQsSnRDVlywBUCLpZt1obJO6uobwZuDCZy8Ri0B5s8TWFyINMXUGWXyP5//jjR3t8uD S+6Sh5avAZkzoStMbk3r4WCUWENDY8XapIl6vrTbqvnv1Jll8p3n/0F5GjfhuR64e624e5Fi0wIB u3Ywcq4ST6azgbb/3Z/9i/zg6DZ5cMZ8+dhdG7QxJAqneR7yJsrFIn4XU9lYA8WlJfLTo9vllcM7 ZcWUafLk5q0Sx25THBoV2oWRHfPPkL8UlvVh6T2tj4Oz4YXMymbPlK/97B+l8VCjbJ21XJ5YuR7d saB+gkMK9SEeJX8df9TQwIqwQ4uFzrGSnpMnGbmFsnv/AdM+jx2RAGaFKhjNPkSenDCQx45fFWK5 kUNwALYjGikauzg69PNspfdYScboX0sbMhObwQLhkW0HQMWDlGElONJIxZWSkgS6jFaJR5TJCWfu 7lV3aS1stMoqLDMX+seNxB2DWjXpfJK7rbW1HaqjVhIS0+TMpXLZt3evzIHt5pr0A03cC9/iwIGD iEAiYAOWDQ8ieJe2HZDqplpphH6NuJNE3AHTEwWHBoCNABCXqtqrgAt3Ie3Fdgz8DyU+JfD0LpYf lFPHDsncRTPEnUoqEbwGzk9tfa10sR03L0VQrwrEbSx2nFA8qGfqQ/0RF346vMK//9u/lxykeMoW zpIz56pVCO5EcMBhofX1Ag4ehXy5gE1HTk/mzJwlb73xlvz87HOydNFiIAG4pbKmTq6W1ykfHLng rlVclsNHe/T0EYsoUQCOFGHZ00CQOwBouQTQrNQfOyptXS342Sc1teVSCOh2LXRmFMDAf9823hIX EcscmCIlHL0nEfDt8+dLRXW9LFtaIl34I4KS4EKKU0h3NqgQSXvOymXyix3b5MDBPWBYnoZFGJAj xw5LTGyClKRn4PnHdEyMxBab0J+h1XxcR7AfZblTZMuc5dINAurH121BG7UTjqpVk6IRJOOYW2fr Cf1cHJwxZv0oOs+VLQvWSHdbhzy24QGgL2NDQy/oGqQDEOGDsw9jygEp6oeXrpNzjVXysXseAn9c rPRg77OlfiLZJ21ephMNeeXEp8jDi++Rk4jaPLP1w5LuSoDhRw0Qk+eakjAoZSr7MK0OuxvYHLbM mmRDQVFmjmxauFqaWhvk19Y+IImwBX1Y1wHoR8qUNXdjLtBn0bPWE/FDDa6QE2GpKHRJ19ZUaV1K PGpM+dSs56EsckFN0gwyU19Xp2Sj/GJqSTGY7M8j5RYQBwreFc7UVEqP6Joan9h4P9blIlgAW0af LTc3W15++ZcgkI2T+MwM6WhrBy8maJnwyk4Qis+ePRuRpstSgpRhAtKV7e2Ez7FmUTM0Y6vlGt9z TLB3W+wQSv4LRZmMSHsAXZM9ve2gHkuUeqbfSFbMAxmYNOLA41oN4nXWdyUmx6O+1o8ASw9I2mMl Hn5Etw/fR/oRB7EoTNbJIylpufLx33wajPIopIb3ngo6C7ZYTp1dAt6vHtl5oE3iUau0Zs1qDBg4 Sow94eEKp+SD9y1ZqS+oXGfOn6EFWi5EjgrnlEp9U5185EMPI4RWKekIVyYnJcsUhNR47yklpUNd Z7zXXTDgjGBlZWXJ448/oTnMDLynG6Hf1WvWSVFJFdJmHs1xzphVpuMkW3MSQqKmew15ayhSwrDz NRvjzDPwPdcqfFKCE90A4QW0hJa7bPwnpEjNmY5a9yBytBw//vfghz4ktbW1qliYF+ezpiGM/fwP fiztmEfOw4aNG+WRR7aiBqwHczVFO9xSUAdARZOXl4eo4e1TkxUpWd/K53DfEO+GCt7VOyhPL9ts Om7wB27uYJZy2wCqoYpc4OVWHuMdrwnuoolGKuSpxXwuRsIsFHar/XlMNx/nm0i90I9I1odnrzL1 LljLXQosGJ6OovEMl2qmH4dFXs6eQdk0dbFsnrrEBBd5AOXfTVXySAcpTOvDdr74+aoCOS4Oo8cv T89fr/kwtr/3oLWea9f0zBI7baxSsHB49DBBx4b6OQD292h5+MPrpQMHYzbeJIHKgx1Qp8+ckXzo o7z8fOnp7ABHWR9sUJo6WVkp8yUWh2Ocn7Vz195bIaNF0ogHO9tQRYaShQDqpkpKixD58KAkwQ0+ yzQUIDcpaTspNrJRg5sIm1N52Y+6simwWV3YH2Ci0BCrLbBwpQXHOh+Rfx91CQ8JrCmi3Vm8eL4O QucNAY0+RBVXLgZ3G2RpADyjpDAnHYf5IgQBkuX48RNy8OBB2bJli2wuXQXfpC3yTpKebtlmx0JN PASNLb9szh2eFtU4Qzk9+ugjyMHGq0NCg6wnBEQqSkpKhnAr+GIXIkwUCl8zc8ZM/d4J4z0NUQwT yh9Qp4Wf4cDCZ4GogSw3i8pe+EmJiSDyS9U2dc2fY+MSMp73tWHa+Xo6aHyNTgjuwzAyL35uHnjN qIE0dbh6tVVd/8GInFAGdBJtmVD2LDZkevNuPCsdRV50dtnRFpWDDiXIwY9Q+hQ4S5SX3w9MKutU Fvkt9MH5RNo1xQLheYmt3lZHxu3+hHSMyIhuO0iqJzQ18v5dWjNlNAXW++1xyDG4d6wpNHuU8qTe mwiXWbuUJqJHIVy7wV2SPLzVoKanAUXXvBTfCEayq31QmutNTVIcOig725rlXEujDigGXYwNDTWG K9JagwE4UywNsampRlCZjEOYWucJG9eHGqlTp87g/ujYhplgsTH1amVVhfJkNuN1LkSauttbpLmh VjJB+H316hU4AuyA47gITWDVa49jPB+Ut3J+ulAWQs452nfuXXvOuHMdkC/XXWNjrdbGKhK42noc esBRlwA6tBWLF8iAt0uunj+rEckRkaSIGC860BYi8AAryIc4VoZDmpx1Plg+PHwuBH6pilJUcEOe ZztVGqbHaSF4g2ilOkn16FhZxoPCUkeLDpqV7rGf1wbO4kaiUbeFGgxBb3c18D72eHRMkCK5dOz3 cFPxsglxbUyNiMg2zCvdlpONQWHLlosxB3xsQzLAfBl2aiMf067qC2GoOswPepvcvh8pn2Cl/UFY Y3rwCHJEuLbsvc5pCZWRutUptvXK9fs40uO41fEGv45HM9Z68nq/5Xj9+O1j4/VrdrxrOFiXz5kz R9eSjVenhdwadDFehX6Wtv3DIljcdswMmEYCY6foTMXiEB7c1RaKuWcUgxGPfDQDZCHFbEYF22Sy 5JqC43cMCiiuH2vIhpw3Ywc5JjpvwftjLOvkg/QeyoVBFJu7zbZRZq5Zh2eCH0puqw4SgVYN9QvD nUzTsV6Nrw8AFohHDYdtxOwT23gX6XsJ3L5/8OnQ7m4J/h03tR2tsf+uqQXL8+PnXH/CDHaUgsOj wY6S/f5g4Wmo11LG9vuuP5nbHqmtqIPvY28g+x62DILH+36fht9rXm717/Z6CZY13xvsUAbLzpab /bsPSsTjVuUVidd90GQa/Dy2AQjeW5F8XnudB+sQzqltfCMxv+P5jGAdZKIXI+trxnPvULw3WJ/b Yx3vfe17xqFW0p4//dcq5KYTYmMkDR2U6SuZAJMhexgKd1m/vC4HGJo1CJw+oLe7gQdoOz0cgTpz HC8dISvqrqjc6kExejwcEQwOFoxXbh+U9xNCwb6G558+J2fddD5acVadb9Ohin/pOKkDrVYe/yN/ K5wkbhqmS643eh8UgU0+x6QEJiVwG0uAJ37LCQ8+qLxfT2RHlOx/b6fDjx1lmQhyvH7+rjf2oXFC Rn6K1c4w4pdDdVPvuqDGXCT17stUodCDiwZ1pasLZ9ewBo9v+Pswjef92lQR+9x3L75TR8l4x0Ej ImSGlQ6J2Dg5BI0GDY/l5lNuP9QtLorrn+8GD2W/5IYvHfHLm3/2EFLrnVBbw+idJQr7MGXQdyxv ewwLR+X37ut1DHedfMvtKoHrDeLQNtQ1gtWiJ2izYCLtlJjszLD+0SgEaxutOkRi6IQ7+n6r8zqU SRp6QzC/lkkv8TWatuH4NWIxfPdQb8kRDoglw5HmJ8gckQMP47KZvcY8z9YHhIP8IjgqdatzcrPX DclhRJ1YsAG69SJsO5Vk0ohmz9ypVzica8f14c5ICNdGxaSnFEWUU+vi780yMTnB4ZQY+dIMjD7/ 7gA1hn3ZRdXMIzK3SHwjKgEtUryuUHH4FGhCmlbwzYRYrTCcYQA2GBoK+kqKBI5I2/dR/Iefo3XM igAWCXG9v58x1I5LOgzKg9w2inClslE5B8Wp7ZD+iEFrPtjIakDrylS8k9ekBFQCwTUVatwI9YO2 vD4iZ2Avbt+7TaaDb6wEKPzhZxobOSlKKMQmD+vAH2AuBg7Gjr27pQjjKQNI3US5dE9SLVljNZET OB6klcQ+3X54v6QCGX/OtBmm5gZfwa32od6Sdt2R3teqjTJA2tQBhv5D7Tpk+qtDO6U4f4rMyC0w emasl/XeftSa+EBPpYSqeroD0ySbAqB8iBOlcrHKNxR80iL+HbBayIcdDTiUKI52oMh6uLZp/JIy +hNLHfWbPjSzKB652jyrHspSkLRlDvwuQMfWLjWxbBffz5okQtQYhWyDoY1/fGMV//v9Pq0l0ppY w9M3HKHkyIxdV+mozbLKd+zkmwkl6ZrhZQPFqpMU6Yv4BbqRB/qkvqYLeBktEgf4/Nz8TIl1x+tw WKsdYxHREgwM9VT6cKzpPHjwMFrzOtEKOQ3dZNmKMcHF1AcofjQooE0XXVQwxr29fgWS6vECjAsd aSwENw9vXVyQuKGyeROqFt/1AIFzz4Fj8MTcsnLJQoB3oXsA//X4u6W/zwlMIDKtU8BEj4287CI9 V2brcdGgOwadKNHAtqJ8SR/gVPBIFCACeE0L4SAPkpO2gRuvpg5w+Xh9IXCo3C4HUEwrJCs7B6ld QCeAduDOkNz7MVu332fakRgeYhzc6NiTPiyQXvSVbDu9T948+Lb8blGhGvp3RMPD/Lg+GlnoyFjo INraAMa3/fxR+eXON+W3HnkyzJ8+uturWsJbYljsS4wgEnMDnXEAh7qj187Jz95+TZ7Y8pBBkCam lta3WHU4o/uoW3r1ULzZ+hB22fGwy8+NITE4xhmAA/LmqQPy832Q5+PPGIJxnkdv6RNu8CIqFkxU T7dXTp0+CugYFDYPgCzJkQRnEdybhELw4uALO9ELR5xt4lHkCQUALjucBvCHAQVppGPCLud+aW3v kLtWrFKHJFT20o7gsVOtraMVuDy4N3D8HDHAcKLTFugxRcWakqNeZaG2caICeEYWGPcBI60fpPCr 7l4xYaKZY522UL2POuQiwJ+9AIl0ggLHNFqxGN8UZbOhi9EPG3OOlsg4p/ibBlaIXcV5Z2gE+2TA EXkIgKGNgwERk+g73/6xZOVnwYBmS2oGcCCuVooHAFpZYPy+UlkrsfDgs3IzpeJKhXKskcKktbkd eAbHpaS4BBQjvVJRfhUw4zPkl8+9LGvuXy85Kcmy88heaalulAsQWG5xvkwrLoOBBkBkeYMUwBnj yaC6ukkyswnM5ZYLF6olLSNWF2n5pUrpRAvg3QsW4N7XoFDQ+g6QsaN79srd966XOLIuWw5cqCb3 drgPFUQXnNNKtFdGMzShAABdiUlEQVQWTy8Dtgi+r6ySrIIpgHRPVoZ6Bzb6Wz//hVxpbpHsvBw4 SnPk2NFDUFoweUC0ffTxxyXZaRzhyWtSArYE7ML/ZrQ6O0F6Ohjjlj2n98sPv/8d+Y2PfAyUIKWK N6YAwxG82CJc094kGQlY3zg47b54TL774+/IkwC6nAnOwomSaqNI6B8w7t0HL6O9F/gugOsg4fbp qvPyL9/+J9kMZOvFs+bqwTD4mDJmh+Q95mFEak0jRmwgipbm9jZJSURRNRyD18/vl2/94FvymSee lUU5UxH9gXHCSZcQjqO/jDfGaBCNnBP3LwHhsx8hyfrGLmkHAXk2Imn54N0EJ4D4QIFCcwmKNlxc WHQe8TO7m7TD0geb45UmYOcMFXgHZThGP76R76BD6AVzRAEO727gIw0iU1FZVS9udGdngQ6LHdJR cM77ILdYGOs+jpYdWMx7YBxeIHFfQJv62D3K8T7BxHx/AI5jIbjvHA6XYvURXoEEwm1drZKQGo99 jBQ5HHZy4DFKp7oHIVVYLzjPwNJCMb0XaOeqbKLguL4/j4kdg//5SDKHQc6ZPUcyczIAmnVW3n75 DZkC8tRZU6bLL7a9LpnxCbLpQ/fL8UOH5WplvSydt1jOHb8AsK8saa5pAKHtMTl/9ZKUTmsVXyew ktCu2dHcKRXg3pmamSeN4LyZOWeGFIHY9pXXfipXznfIxg3L5MK5y+B065SCwjxZvHyW7NlxBOOp h+M1V3o7/AAdiwEnXCuiSvuk8tI52fLMs/Dq++RCRbksBkmkD4t0bBv5/ZH4eD+Vnjcxjn4BwtEr QCJfsny59NZWyaXqKlmybq0sX7FCcTKpcBw9AZkCePdS8OulZKZjwQVkBtBiO+AoMWysXFHjHdDk +z8wErANEI3C7sOgA4jvkfTUTPnpD34gW+/eIPcuXCnROO3zNB3pdeOEfjp29hgIY4HGDBaAf//R t2XV/MVy/6q7xY2og6kHifSobjz1UShXAPSlBGAEDl47I+frysEkMFe+/f1/kwXQqR8Gv58bB2lF fdIWqvAuoetvzzZ7Rmv2HT0s7TE9klCYIf/20+/J1tVrZMOilfRJFHRyrEhUWtEEcMZoUJDw8bie +LSdHb3y0kuvSmx+vEyH8QwE0DmNUoFe5PXIyVlaUCSN4KP0gtYnMz1L6qqqpa66Qjbfe7dGExiB CDWYpEYvsJ4JO6PRKXydPXNWLl66Jm5gAy6KnadgkonQn7GBaKnG4SEf3Jce2MNBGPAEACkrFtYE WXvhXUm3fncjSvKGAh4BmEgvvP5LgEPnwK5Plbf2vI0gyjpFWs8FeHQT6GgCgKYpLgJ3X20DskZJ EgvWjssIjBRNLUagpEPau5CduvWPD9ErdX+aswtrjAJACm7HycKT4FHUa0Kvt2HgROFecddKccKR IsJzelq6nL9cjbRNpS7k5csWyc69bwM91SnPfuxZ+d4PX5XUKABy4b7dRPAGrDg3SS+QuzsRLu3P 8AHQsEACvZ3SAXTVnt5u+ehHn5TtO3dJW2sb+MWKZNfuo5IYnyNLly6RKzh9NTW2ghwvVyrOn5am llags+ZKHaJfg1BGDMlqr+gdcnEzMrx76sQJKZ41W+ob6mRuESJ5eP4unGiU4VtzuvDIEXnrQeqz s6NdsjPSZMXKFdLc1CINjQ3KQ5QGwluTN5m8JiVgirFtGI05c2HUf/hNcLd1yfr5y+WRTfcLOqSZ 7DWH/QhvOaaa58+YK3/xr38tdTtekSVz58uT9z0Mxjauc54IIhzaepcFQ6PLVJUTDLazi2YiJfiG 7N61TWYUlMgzDz0qCQTSI6u8VmwPCzIiEJOa2mOhBcaGOf6T731Tmne3yubpy+UZROU4qgEUfmlx g1WrNNq9wSfifNFZ0ksL1ZFuYdQAdayZmVMkDV+7oecDGI8fp1x3rFuqr7XBP2P6EWnJ4+cB3og1 CR5OP9IyLjgx9qILFUSB2j4r1ckCeiX8xlibm5uB9LwZJSeJsusI6K1gx6S8Vdpgw1KBvF0d0wEA TBcc3W7YxqUGCHG0QvrAv97GP7IcJfCHtreDkL2qFsDUaXL6bIVyt5FjlfVg5MHs7kEJz94D4GGN A9lxKVLUfrlw7ajUNlZLE1OhkZaZKZg2RdOGZFCU5oM54pS0BIRiWwEf75OC1Hx54603ZQY8/5Ub VstLzz+PfCI8bxCEObGK/fgvIysTobOAfPf735Wy6Uuks64Z+fgBUJkkQoERCAo0Dlj77a0dUl5e DrLZHqmvr4OwchQF+rvf+z6iTDPVyB8/dRZ1UXFAOQVlJWnlsHi7ejtk/4G9GJsGOFFn0yKZU6fp iXbiqMbIzCBPPrHAHZm/ANxtDc2yZNYsae9sh0xqJBeM1InM51oRa0diLDjFusC23CRJeM+FM6dR B4HcLk5kDqDemjbLyWtSAsMS0JM61kVxTqFsWXQPDigN8tGtj0myK87UELwPDpIaM4xpSlqebFx5 r5yrviKfePgpyXOnKLkt4vURd9refc2wENWh1B9TEjPkwys2yKGDe+XZR5+SwsRMlaMWcOqDqRLW UtYx+iSjWr78ODpwrAAtzM6Ve+9aB/qoavntDU9KmjMBkXnWT6H2i2Mac00S9TTdLJRD4APV+SAf HOapH85hSyNqX/G3ePBM0i40dpFywiGpySnS1gm+TdQgpcZ7ZNb0qSA1v6DFv2RuIFp5KB0k48Bh aEw/WkDELP/IzskGa/1rwE1KEFdCqvh6fCBWjwOZMtKoPj9Ii4uk/Oo1UDzFg3PMIx0IJhC1e/IK loCuNAMIiv/S0pKUg6+7pw1BmHSphi+AHYL9GyNlKNeJB09edXU1UrIDEgv6Gi8CAbRj5BCMw7r0 RHdG3klSB0mjSVGSBH6ajz7zEWmFx+zCYLNBWJuMwt70jCypRW52/rw5smnjeknNxOue/aiiNqem ZGiRVSzyjPkl+UjdBKQE9TGlJdPFi9CYOxFFehBOFqgxUjPS5UOPPybdKNxOBfnstLgimZLfIqVY bC8+/6LMn58nC5YsFhdYcvMLi8GTE41CvxTUziRK4YwSiXM4pXRWNoSMbCXuexSMzNNIOzKxDpAR 2SNccAwNP/jwh6S8vl7yi4vE39WOeq9CzFe2fP97PwQcfCfy6Q5ZvGiBFMbGKSHpFCBxlyGcWV5e gZNcjqRjzhUO/g6KwkVkgj4AH0LdEA3l8LG7H9RIh5tUEiy0tKIexphHJO4xJE2y0vf3+2Xryg2y JepeSUWtVDQsLMmT+jE+JnQiHNy6+UzDGeABjkFu6sAN81bIhjlLoStNswk72YZqQjlua+Bjjdy8 15Kzm9R0xrSYHN1Y1in5mZX3kVBOEqLdqg8c+CPNmo6RRbZjkKqxK3hW5Oy0Phf6p5+fkeSWhx/e JK2BbkmC3ciclQxC9T45igxBTm6+FIO/rbMT0SQQAGemgZAcAkxP9CgbvDJChONQZ8meEVT9wrNP nz5dYmMTUeoRJxkw7nW1deIBJdeVsxckPS9b0mEbq6/1yPQZC8AyYaRrurgmL1sCBgvMRJEGBnyy eMl8S06gl0EpznTQwKxYPEMbuViPxLU5JSdBZk7LkfikWDlx8qzs2X1Itj7wAOrZloH4uO6dtCTh znFaBxirg94phXBYCi2D2U9PPpks8QIyv2SZNXemdrj5sBAI3843YcnqaUE3Fv5j8dvMmehcQEg1 CSy/BgJgQO5eeTcUBgoA3aZyiCFYkohnpGdqOuhhELW63VBxiBiR6bts+jS8ikFfRqlAIApmavro CfFFCgEQ6O+R9Sja9lArWt0ad87StDBJMXlxSYkyKy1Za7ISPJmSnpklAXjq96xZozDu1ITpIGNM 8CQYc0ZZQfDzUATPiDY7DbT9d/KalMANJYCIpfae4DiH5USDaeLO9qbTnG7kZKct44OSSNgRdmWx y41DQZqNRdLOCDtt7/bgrOdh5xPhChh94GGSZLaE3RggN1WQFA1iEl5HxyLYcwqjZBmVMxFDkaRB 6mVwqUHnYojioROFLx/EzNZ89xhi9Tb+nga10WnLMo229mZ8HopvUcAeiPGD4DQgzehwG8SHxrn6 pau1Ss40V6JTlzoJdajVlSwcUF7RcpSCsBwkBmvQ5vkMtXhozI+hCYlk7fx8hwMp0cEmqa3s0gJj aWTXMLjbEHVrrqsAhINDLl84pzL09XmRFUGkdciohnp0t9/9uOZZDM/GLkIjWOVeuvLp7EZBpkxT NtUouIeufTrk7LhuaAEXntMvSxej2L+3QS6fq8d6RZ2fDSYZyS6NaHj75jKhQhsMKwahYnscLrTv 2X9jyNM+RbK1lQ9n/CrraISHJju37nVCieMfJyrU7fer48d8Pfcnfw3Hy40UEbWdAYazcZnMeKxR 6UK0lYkL+UpXPO9j1PUdszJpGFSiJp2mBoIywz+aSmfGwRUjhUXEsDEXzziKacV54cstLCU6tA6k SsNxMBv68MlvbnMJoG7FaUiuowYYFrccIhgKVBDouougi6QehAO6RKtpoHsQpVcvBP0xSN1o7GvC yJvdpdx9Ng9VL/wQYuu4UfjLS/+O/w3gIAMmRT0S8u+Wpgz5cwxJxtLVNFC2fhiM4dGTzS8WOTh0 MtWE1nqNYyQmOoa5QbfYhg2bFTNHU290BvW+wzUrhsNLtZWJqhkjo/8XjNNHUm8lyA2l4lJTgvos 1OCWlpYauzJk0ywsOVsO9gMwwkbOtyBOUlJwjACTHIfsPghvZYZi0aJFysF6/XzZhe7B+sNM6fCK 45rQGklCZNC1smydtZBG8qJFSmBDwzP7d+h6x4K87u/B47vR4g3+3Yi/Wx/yTgFaztpNHtwGQQsa YaRENHE+5wbay5Yju9aCLxNFsh1Ksw5DqmQmjlQmRxJKCWCdxAQQKUYbuA8KD13aKKLFOoJFJ7ik 7aCH8iPf7V7s2KRz5MdAtDCaJ3iOi5hOTOvA2E+U7jbiSw2ioIeHEkZC0DusEaVodI0hmCI+RFd4 uGTEJga1OrZfYOxEBFzPIB3OfADKSQXBHMF0ixdzq71o+hpzCBvv5UHdTiguk8IZD8LlzUdh04KN dZzBQKxjvccH6X3q1DANrp2Nobkc9Eq7uroiDvcfmuFP3uV9lcD1enXoJGacoslrUgKjlUAMilJi /THSiQaNbkRwnHCQ4lEDNAhvxctoEv5OxORIXX1MV8HpSO5ELAkWnF9u5LR64W10IlLj8cLchzLC MI4HI3CkF1XbbBlPgtcRS6BXOHitcI56CPyKZhUH5IdAHZw8hlbweoJN4jMR4zURqHBc9m35kfii I+QOOKQd2YJOtC4mdQMHCGlMytOHKJ0LNknHN3lNSmACSGCIloTOUiQu2/PV6nPmCNnGaP07ms+3 oxLD1CUjMSOC/26fAkbboRB8j7GMcTTPczu8dgSFDdSq0rxY9WTB88pnseXF14yZh+l2EMrkGEMq ASRHxOdGvQ8Kbh3oOPHDaPYiResASnIcHJIADKudgQvpB9/kZj5YdNprRrR6B71IU6FmCjg7DgBL wq6jDg81NRPESXJgQPE+gAwifNTkGhTPINrLUSfYwz2K9IEH44VIUYMJlwjOUgxpoFCDQRnTOQ25 k2T5Oexcpj5g2h5+rubjGdXqcPihQ1D/2cdi82jpQnQrFnXIbs67vnBsF/WUTUEVqhrbcETBbXtk 68jRfEbwM47mfWOT6O3zrmCbHaq516jmWB2VsYrOXhw0nnau10bcHe2EB489WCj297y/bbRNfnp0 pyWOJ9RAYmOV2/v9PsqO8lSH2srx210oMfg9Q/x2t4YD4U6+zubWG63c3+9nnfz890cCUWi6GPC2 SyqaKgLoKmPv/wCMZlQ/0XHpIFn1IxEaXhJSVU40jvTBQYpOhbUfYCGvR5wt3ZLtc4k3llyGERrM e3wMM38OIDP7UI3tA6rrQHuvJKNxhbxkHniWrt6AdKBjywcHr5+OHvcwidKQoqODFGqoThtegAEq rV1EVItMTgS9DAS6JB2epxOOr2swVrrQ0BGHmiU38oJEQg4EM++OUrzUNYaOAqX1PMiNUucHf5yd vgm2AfYBf5TDGvFy2wbaY+S/t3LZh097DEzXjef5buUzb6fXUBahtjuhSP2OWoY2eBwnvB7t5AQY JK1FRnq6njj01IHJ9wPoid1tRDzVVkcIwMmuEuViMXn3HiBB+Xx9aN1PwN9omANDf6ewCBxJ+pMA Qs15gH93gkeMGycGeD3k5SGXCzEq+JlcqDYCqh/fu6y8Zi+wE0KZ4xy1wCbKG6DgmJrllZAQbzBW NJqEUyBgHJqamgDOFispgF+oqKhUOecAAsDuMJwojzE5jgkqARZMNrTK23/yFVn04fVSsnm1XHhh h5x44W3Z/IefleYFReIEHIc7gqEkvwtORFuLvPnFr8nUR1dK2dZ7pOX5XfLWc6/Ksi//vuKmwZub EALtdEMnMjKDkmxPR5+8+cfflHmzpsnUZ++T2qOn5Ff/9kNZ819/R1KWLoXTx0gS9Z72yodl/CN8 RzpH2ikIUFrokG1/8iVZtnW5ZD+4Xmr/803Z/uoOWfiNz0lKXoGkA9xvrJftRFCX19TUoIMZoHe4 HFZXkxpQPm9wacBQK0BQAS+jUfiRBbwtLS3ooJ5haEKszMdYx2e/T3kKcbAkgCRtm909p01KtEXB mR1GKm0YjKCoJd9Hfczi79EGF8Y7/on6fs5PY2OjDs92lod9Cha9c+6tE755Fa3YzR8Hf4q8k6Sh UIOT0w548G9/69tSDFCnWViEPCmSMyUGTlF3Z5cUFOSghbNPWtqawcVShJCxXy5dLpdscK/1dvWC uLZPktGSfq28WmbMKJVrANrKyMxEW2Q8Tkp+OXL4iFRXVksNQA2nlORKYrJH+ptjxONxSQv4mBIT 04GwnQAwqUpleiZ/XH1DvfhwX9JqlF+7BgygDPCTVWpb4fz588NWwDdRF50uI9YRYL462jrkn/75 n2Xt2vVSMGUKkM9TgW8CQAY4tC8A7LMbzuR8oOnuBYp5Q0cbwCc9gFBIkIcefBCOKPqBJkhaYiLL +k4eGwt245LipHBWkRz9X/8o7rePyra92yXzw1tkIC9RYhHVibG6WyMlJz/xe9JjZeriWXLlr/5Z 0nYckz3b90rixtUSl5WoWGAT5XIg2saIUD+iSG4Qc89asVj2/f0/SkzFBTm2/4Ckw2HKygFNEA6S DgAtsIA7modFrU4P/VPwlvZtCftBQEdyYbnQtj5lbpkc+Zt/lPmHz8ju13ZL5tYNkgQyWvYx942T OJxqhk4ICU5zc3MVAqGpuQ3E270KLpgN8EiNOMBBJMEtbQUP3ERnom0iyDHRmAkbE4A9qge1FX8f ypIL7d7EF52wtLQ04COh2xoyqgU2Ep2x3NxsQACYLiuWNPA/QtvwZxIUBxBAoE1qAUdmOOYu9Ksh Mnc0NgYwNOkZkKMLJPcMcGBdIRDSDZaN+EQGUxwqP43C4fUaKIHPwQMD383fq5PKqDU7siMz9OFP GcSmJMiXGyCQ0T4vQq9RMnv6PCkBts53/vU7UrhomviAjF17pVrmzMmXE8e7xO/ulHlz75IEf6ec PHNVZi0vktaaNpABNsvMudOkpTNOrl56VS5eviiLlq6UtfeukmbQZvQ0NUqGI1W6U5Nk3opCqag6 KTtfKpfVaxbImSt7QJ2RL1NBNXL6zE4AALlly0MPyvZt2yQRlCZTMnNlP4hZ80qKZMPGjYD33yVl 4GwbarmMtODeh88j/AHD5C4soljMUx3ANDvr2mXX20ckI79WHnkCig2EtvTM6SCVTiuThXMWSfXZ a5IDgsYUkAdfPHdBeqGEEsg8HuTAh6tG9H0Q0+RHhkoCRGQGZ+Kyzz0t7kvn5eQ//a3MWLdOFvy3 30CNSop4epCCQ3pImeQjdDmRUusDBP/83/+oJJ8/Lof/8R/Ef/d8ufcPPinO2EzpJgbRBEm3uZGx 8SPyzq42gkfO+NhWiao8K0e/+g1Jge5a+Qe/J76CXO12i0MK040api60mPmJBTPAiqHQPggxm3hL /UcZ7BFFAmdaNIryF3/u4+K6eFrO/O3fS/rau2XNHz0jAYAo+lFT5YMRi9EW7NFfCkOJWizaSoJR R6Peqh34N8/9bIc481NkJnD5phfASGLefBhYO3CUSvIzpBEHwF5wTman50kt+CgbaiqA/bYUxpUR H45juH529KN65zvU7QFeE+vZ6JRFg4z11NlLcuL0ORzeE2TpknmIYDWDdyxDHT5GszIRAIgDg8EA kLjj4FRFQ/fyixeL4TlGsxZDO4+heN5I3WMAtYyKkwWnlwS3r736suRk50vRlGJ5Y9fbsu7+9QAO 7ZQcAFZ3Qaa9cJxLAHZcVVcv8aB+YbCkBtmtnIJ86fV7pRWZqIg7SQropJ4x55QcXz1SjtRMRnys JAFddNnypXL++ClprW6Rq1evwMueJUvWr5Htr+yT3IQB+eTvflLaOyrliP+8xFyul2tVVVghubJw Rr54Aa7VB1Rurpe2tlaFbg9g89fWgLCw1iUDSOvNnjMbabdcEFZmwfGplRR3LCIja+VCZbmcOnVK pk2bJg9vuV/+6itfxWJNBJx5j4JP0bun564e/x100R6pb46NSv68pUuXS11rl6yD8YrDour39ooL itmP02klInKtJTMgrxipAUnkGzu3yYcf/rAkJMajrgSeu7V9x6b+7iCh36mPSoMKw33+J6/L+bNX JOu+++XM6QuS9OXvyvTP/g5aydwW7lYEBYS9n+SNkvKfvSn7j52R3A3rpO5Shez+q3+Xuz7/WZEJ xEPoR5HRADYsAkqIJjml6uVdsvfNXZK9aR1Iuqsk+sv/Lgv//L9JT3G2tCMLlQCHBEB5SF8aUL2Q X6xFsva8RqMtvDQekM5+/3U5efwi5vhBKT91Tg597dsy/7OfErcHhso3ID3jYQ/X1JRxFBgdIBgx nYk80KFkIpK08+3tAJOEPkdUy+kclIryS9JLsmLxyMHj5YSxxjqELQEoAcFMB5QTJxwXJkplhIgV IlcNyGI8CKTnGPCz7UMWpLmlUaKvoRwFNsgN4+2ubEJkPg41cl5ZddcyjXQMFSqHY3i34z2D0pKU jRsI682ItnH+4xKT5PiFa7Jr5x5ZunCR+Ht6xdfbJ+29A+Bz2ycuUCDlFuQpCfvRKzVSXV8lrSjV ibiTxKXLzTKIkwI39AxwgH34sUeku7EW1CRu6e3skUOHj6EFNAbQ4R4gkWKBwkAnpQCqPTNWfvCj 70tmbrqcPHkCHSfgVyEXGDZUr68Xqbk26YYxJs9NPNI8db4q5KRjZfOW9bJ8ZYHs3vaWRMU5tV7m 7LkrSAelKSdUDIobWeOUh9DsuXPn5Dvf/Z6UzZwOQt1LGvbkCYiUKHZ++3ZcO2MZs0HoNdEkVIGJ jzD/2NCxCjvuh81yY2HhNIO5SsOJ595Nm2RqTpEcP3hYHoTjuR6K5q3X3pRFs+fBlpBPz9LEd+5B ZyzTcMe8h/qNfFUnj12WtPu3ysrffkocP3hRqvefk+KmdpFpyao3zKk5MlcAkZa+XiD4HjwpsVvu k7s++WuS87Ptsnf3bpBd14L+KAmbI4IDepfHpj5l4TvlQ1LXK/tOS+bsxbL2jz8hl3YdkXM/eB2R 4EaJLc3TFBQ50ohTRGMb7jIv7cYiBxo+rh/6+dTBU5K3daus+NTTkvy9l+TawaNS3AwC16mZMEpj PUYxVG0l+ZCWNeVWiJJpsKVPWmsrpSm6SxJjHYhoxUh7dx/SkuBJgz7r7TGddnEAGZ4+dY5cu3xe evp8GuEhjEKoL46SUR9DFYNoEhCfM0G/9cbrr8JJigd3WyKmxaWIUQPQrzExHpSfTEFJyRXJT41X W9SFWtwgJLpQD/H2vF9wjhdPkJiUgNQpIqbg6UtJTZG6tk5Nv/mR+i1BQCQRpTksyfGSCQIp6m5s hFiQHnux50EUKw4ERSLuJBnv3tAMpCEysWnLFhDJ9sJRccqWrZskNjVRnnjicfF2ehFqjMeiTxUn MMFyHwRPW3eTHDzxU1l67z2yYPosEPx1S2ZKDsLhHiiGDklNy5CcvCniRH4xD2m08gtXpKioVJJR DNiFGqe5SAUNepNg2EVS8+KwQfIkOS4B/wbAQVYE7pZ4yQePTx9CcGVgAy69clkSIVgWlxeCaFdD nWEqcpyYK3J4xVGXxiUnycYtmwCgB9wVRJC+9R//IX4UzschTL5s5QrIL1E6e7pl/YZ7xZ8QIzlQ OAk4GbmwKO28+cQwJxNT2nf8qFgpiz12z59/AaUrBrdn7u9+XOo/1QfLij3ObqUIpxJcUJ4BD9JD X/+stv33IPWWBeftgWfuM3UMWmA7Mbx+4h9xozGF40RkZNl//XVlF+gHd1n+EwWSgbof0l7Edvsl 3ceUFmlAsJdhoHkYCudTBLdms+Zj859+HgdWh3SCL3PmZ56VmW2PId3mlnbAFzDTkAhYgNFepmaI jpKJJLHeigXbaakeefChTbAXHZKMREDGnDLp8jvkwOnL4AvNkrLSAmlHtMGLqEJOFtKReHd+Uowk AYoCsKaQ57DTFtx6P9rxjXg9x0jHkeNkKQJmYPasmUj5JMEexcGWpWt9ErMrFy5cgAOVBXuYJo3X Lsrc2bN0yTFNN1nmef0ssPs1Wol/KeLldy1V29PPQwGCIa2wT3cvmIkATArsEjqy8fbirCSZWZwr cSlpcvzEKdm9ZzfWy0NSOvVuqWtsfh+cJLW7zOFg0MgbpsApInZHDIrsUsAJ1offF8JjZrRpoJ/Q 4mhXHfSJAxGgFl+zzF8+H6c3EKUmuWQK2nL7+uOAgIu8MVZNdgZCZcjLD+DUMAgXfcU9q8n5jNAq 29ZRqghPMQrhN4Y3Z8yei9fAUyeaLzjj3OjW4kmHBdtMrwUQcp01d44WdbEQnJ77neUg2YuP5IvY jCxiQ8oxOQPMWgR8646SVatWoL6BXGwxklkIWhJElQII4SemJgOkDiQSOM0WwulkERxrJMbRiTsu fTT55ttHAtx7HhBMtwNksBV7sB+n6UTsWU8XdjVCJDbVTaSeiIWdiDOLExHpLoQkWvBzPKiPEuNS oA9QzxOpgdzC59BJYqpNo0l4fVWuB+m0aEnvMNhTvmScibE/oTaFwJPEKurFlx8vZhNf2AuArboZ dsP6U3HCx0c6gX8VgFPUj45YFsHHY2xjTf2xucSOVtFQXkXjTU0t0mfgiYtxJIGQGJ+Fetf22mrI KU4SkbnwojvszNFjyEigVgpze6WhQuun6IA0VLBT2i8+6DG7u3m0WHs3mzZ1buAc9SEadOLEMYyP tZ2so8E6a2+Vlpqr6uA1tdWintMngc46KW+8KunxMXL50kXVqf1+n7hQMKUQAJPekoqaDnh7ewea raqsbkQ7CkgZkSfQzG1VHdeF4WGkznFA/p2tteBo7JHVi8okqrteKs+2aOd2UCTJzh7fwm4cx0uC P4WG04fOin52PuAPrGshQRhb/4fDiCjuxk9MoSVnJMv6+9ZJoCNJuv3tkujvxgZHrVFMHzYcFCqY ncFnwCpBGHJWpgNXhcZ5EB1zgwxbMnWEqkXcrx8nFZyh9ARFt5wNHlQSxGaxi4p7UIPEv9rw9nde d5Ym29QwkV1cT1GUD75iEbIuLpoCA8JOgQGlFfAxnE64Bnax6KkO8gSzNq9JB2kcm+YOeitttQPO USq8jz4YCQIkMiVE1GsWGvuYfQ999uOmEo4hPhP0hh+GMhEGzdSQYF0zBYKUTRQKeydKE4IhuMUe ZUcexhWLA0wMyOaARCQuHwhd6YCw/gXya4+FTiUvHQbvDFOu7brMxwgZR0MvkIjXpZ+Ngm42E8G1 iydCJ/43lpokE0lixxhqUeDUzsFBGJpJ8ZkApYmidjqDXtRgIToICt2AA44aCskdgR4E3AwfqPE1 hiqp1D64QD5r2shNjVMoLi3hgL3LzctHRiUZtzS45wI7xX85a/ydPpPVeWXGBVsZhbHDRhIOhyUP tKOqY0MxsNv8HpRXSUmJdrXRaR4xX3SIgp4vOKthmkEMnI12t7EuzXotzhFWoFVZkBkCHHkX27jZ C3C8U8FGS/MRptZFsQz4o65QVukjhD00Bh6L+rRbAaAeWjzsR67QDycoDmvID+fbgRaKAUSSGLZE 56tuEpvITksF8AuSUSKcpOzSEs08LkP5HAnfYJiCRpxeeA+OjdEuK3Q7/Py2fO6EJWkUGJcWEXG5 bemFs0ZsAF55NCJx6lSqKwV5MtpkkQhTbCTPHFKUlnGxZt66r71MR8rSqCjzt+BX2Krgesnf+C63 +W6/Q4dPZcX9HQNPiDuU5SB+/o6k1LDuqq8iufUQJe2D3fI70FHk54ELdClIUTF27YQDEhVFZRqs bt+/iQtYBLI9JJGGTsxrwz6CimtOpI6DswcvgQ5fNJG2CTwJOcb6Dfq2FwXMoXb2gs7wQ3Om4LyW I+eAcadT143xUq4sJA9Az/fBe7JBakcjTdvBicZa4ZQksq4nhjhJjDC5cd8YAFd64CQxbYuoNxwl 2gAn5pLUySzQNoUgtgZiGgzrEJmMaKxJ1jfxM0IB3qjuDpRlFFKCbneSSRPyIEr7RygCTccZbTmE yM2REbZhmHJcbSLx/oaskvWe0cjt3V6rgQHq9XHeMJTwCe8+FOgJOI5ssDJAosb54QMMqGxNN6Du WP5u6GaIvrJzlk4pfod8iXlmvNARjd2SiDoA5LskysKnsE0jYwDM5REhlWrB+DEmf83vxiQ4NZya idVRuoG2ysURzeprBq/pEFnOC8Ok/NCoAbwGfasDeJ3daRAzyHolD/5GjiIuciwdJaAkWBSVBHEn UHRHJ0w9bX6ZcFHUIJ5XHwEbSBERTUDNfp4hlcdCSC5Ma2OMjCSN6enHudQi/XZbEsZBohLl7Efj ZGokipwuEIi51NzoHkAPiXawOblpVeNyo5tlSEkyGsD3McdvGxZ+N6R0KGeqLZ7qVOMh4sfvrcfm KuS6YWGqXbzLjzHFj0rOPnnd5hJgqmMQUYYA6wWwXhxIhTtgpHzQT9H9QGPmYohgJIlI3/0Ygx4A YHC7UL8Tj59JpeFLRGEnTvUThbtNjSyUdjRCb51Ip0kCdTf0I5pfYhGxgZpUPa4HTsiQXaj8Pbeo A51xoXaSrK1vjBG/EMHRQycND/Y1QQe8+DlFT1b4eyzRt+Gu8Exs6eTRLWc7+mLBjRADCrrKjgx5 8D0sjpkvjY7z7lxniMbYD49xmbuY8AF/7YBNMprL4C+FjmbJtMaMOApaOpBOku2g2LbJRJUwIGIn WU6UsULhU3zG5lGPBzlK1scZL8D8+WYXHUtbv4cCqfxW1sPIObLkq04oZ9F0KtrjHpacsTO6NJi2 tcpD+DY48/gj8pptaI+va2hkgE8XMqfPBxwH4jRkos2VRYq8ixoxNVVj9C6t3CkjE3SI6Nho3IA/ Y1dFD4HFcfgctoJdqAcYhVoA5tj1EemF8308dTDszTFxLvkn/QxGP0xBXBSBwizWa6bjNDKlH2u9 4aZa1+aVs4T3jsVwJzhKlgNibUSVLOaMCoSOabR6K2TcMu6TsoxTzUDJmRVivHi+Xk+H3OgMf+tc m0gB59xerCw6VUWqnTr83mpPHgppGmoD+w26fKw3jxOD7lb23+RrwiwBHsx8qG1DvxF40rzEjsa6 SZJYIG33un1YQQ5xha0l+50P54tBTQoWWOxAIhw3UJNEeaGzAH1B5H+k+Q2NRrhaxEcpbCvtkoT9 4CGoJJwkH4xCLPYX+GSlE3uFACZxkKhbQ+XYh3COTHv+GPX5uw3ROqbrR1E7qIE3USI01yNCh64j 7P8snLNA46YULwQLdVC3E+Ro1BcPtKaQXmtNGPU2pk9/Z75/L51tayJ1J4cuFujTYbBRt0c9tOvf wPSdjsvoPtWN7zU0+x56UqAqDY6qmmPnrd7ivcZ/fWnJ2KNnllOiYw3V6G4+eo1UYt6Ha8eCZnHI ER75fiM325BYx3eLk5Q/IdKKhYkw5LHTpwHUeF6ysrLQHYY8LBmaUeTmwt8eeXgrwnpwjdQ4mmvM rYf2mNVJoWdsJlwjFRputBbzUP4Lm0WfwmapHhZ28EQOHTB1Iuhw8TSBoLimEXnx93SOmF+2H8Ku Vrwx/83w/RntMIvSvpU6aEM3eq8ld7v/fVhxGAcGqUsr0mMS9fRjEcoe2qSUv70hDJGxmQGbR4mg ctHiYY0YfWUoTpYmqMOki8u8XuON/KV1K6pNrVZTR/idMr1jpuN2X07vMv4o5siRwo1290siTsz9 iHoEerw4HGH2gUBsoHZuMPlhkgkPcS6kgfoBZ+GKgwuHUI2b6T/QfriR81c1E8HxvNtjsiGMjVIs 4HZzzOjWciWSq42upUMS+vqU1YCdP9xoamQtUY5Zn7/LgKjKeXt7tnie0kYZOBxsynEnOCSJxbRI 2w/0IVqHDmdVAnQcxiRT6gZj7BhNYNF18G2MGrnJ2tFfq1Ey5kbLMHjAM1Eu/p5yC1Ukya6V4XMS x0m584KcCHXRblbBrlEmY3/otBln0DxXqHaGqcHCGlL+TRS1W07Djab7ZsM0YhueSxfaysPtKNkc sMovqo6nsU9mbkd2Jwy7RUZyJoZo26rh7xz92DQ0Pv0QyKy582Tm9DJxY1N50C7X3tEtB/ft1dqS 0JSrBc2iZfham1ulA1GsRLSXp+HLGETbU6ZRxcbhZjMBCfMnFnIy/UdCVdsAQxheLwrwCDWOCSWc PIv3vGhVH0C9pRMor4PYgPx7DHLgvBgK5F1N3ZFIXR0h4V2ANE8bok7hQiFXnFmQ5nRDeH2KlPey J8Xm3rnRIrqdf6cKQzWdKcru60FNF8QVi84QOixKcISrp7tLGlrbxQP5pSR6pLG1lWdHUL3kaJeG Iu7iHgF0ZEQ72SGH0y0IN31oR4wHwjkPR9opxHWthbqQM758gIKIgsPO4nGmTaNQMM75snPc7GYx Dpk5D0xet68EqEC9rc2y7Q//RJZufVBytm6RtudelF2v/VzW/OkfA0NnlmXCIveM2vDR1iUv/OkX ZPU96yX3qQel8aUX5OD3Xpb5f/knUjCjZIwGPfTPYCEAKNpwAEXmb3/xmzJrVqkU/M5D0nLgtOz8 Pz+UlZ/5Tcm8exEiTHpkVKwk3T23EmQZ5ZC5I4fPxMbokry2s6NdXvzKXwBXbTWgXe6RyhfflDdf fk3WfeXzkldYqmlz+2g7yo+0dACiVMDNO3P2LLq/UJLB+jHCkMDBpc433G3DB7+hNBYdFZZMKx8l 1Qo7dH0IFvTKsqV3WYXAoXJDeH904AH3qA30XC7oRDo+hvAdhwMYLQ4xhsXHaqtoC02llv2zTY67 fPnysKxBjuvq1ata40MZcWx+OJ5U1tyrfjgiDkYg4fgqHIFK34yQqfIAa7j4E97bBwedDt2iRYvC MlZ7nXBcpBEjn2sMS4h0JRnOtmj4NQHWl6lDYZdxMDBjXKR+ZjewYmOYJyZFCdlB8BscLJiqMgW5 Af6BHWYaFmVejhDfxvCYiE8IFog1y7Rrba1t8u//+kMY0lyZv2C2OEqLQXbbJR5wfnVgIxUAQr8D 3G2NjS1ShNZ8HD+kGgjbXBwHDh6StRvWSnZujo6vpblO9u7dI9k5oMNITZNtb70pjz7yITkKYMrC jOlSVX0GzxAHmIFsWbRiqlRXtEl+USq8eC+4x6Jl3759irjN08L06dPl8uXL8vhjjyko5ZtvviVT phTKFHRzkSuH8PA7d+2QFStWKPBU6HLUo1cJkXoHF18HMCP+3z/9m6y6Z50UTyuRtKx08bCLEBvi uf/8OfjwemTe7OnSCWDQ8uYGnBRTJQlzsRVYWAlIoXBhngbVS3lThyxbs0bcwH5obmmSkimAha+v kZSMFIVriEct2gBqP9rg4Hacq5YKGE6FEfB2y72PbpELFy9JQW6erkkt9IUCifNYdWaREsjk54Rc AlSmsUjtZxYVy8mv/m/xHj4gO59/SeIfXi8xwDVhipaBJqOxInP5YbEH0uLBJzdfDn7jb2XZkaPy OqiLkpctkdg0womEQCeG6FGAmqD1RawmcMS5JGflHHntb/9BNpK7bcdu8U0tkfhctMIzoA6DTGeE Bx4eRrRUIUTjGDJYQy6L9RueqXjAAhl5YVGBHPjaX8uyA8dk5y9ekYzNa8STHAfDyoewmnlGPR4T 8deEv9bCDEJvT8GhNkaam1qlEx1PyYAnSYVO4qypI4YHZzc1ed5YzjHIGi2mIVFrOYhOuEB/tzSe gO2gM2B9jXpYN3iDOjy4HxknMkCRkRCfpE4RMfmcgLzIzsofOgzCwKjt1egIjT0LHfC7DpCK006F 4+L96diwADoPOIM+r18jc7GAyuklyCbkReJyBXflFw/Q4Dxl1InOFN8bnwCdzAYf3IsOV3l5eTiG et09GdTwAV8qGXiIHulGNszt9qhd7wUNWnw8cBfpiILw3smIKoMgcKiiAQHgp5zRIR8H28NO+QEE aAaBi2bATVkohy1CCO8kGH1AakgshNDDCECIt456lizawyLpA40Ii+iWzlsEfpV0cLd9S4qnF0tt PXjXAFK4dNlc2b8HmBCYnOVLVqGTrVtOAGk7B0CRhw8dBtBTg2y+bws43mbAGTqIDVEgVTUN0gG4 cXq7ly6DNwxOV3lbFQw48CYS8+Fhtsrzz/9EKq/5ZfaCAklJQRV8IE4uwvDmoR2TNViNIMQ9cOAA xpSrvzt79rwkQ0n/+Ec/BQZDu2zZslm9Yp4CFixYoE5b5Kr3I7DOhnWa+U6PCFFwalulEQBne3cf Ahp5pXzkow+bFhn8r7ujU2aWzZQlOCm88txlKQJpcVJWnhwDxUyAXYnYSIxQdnW2yls7dsHbb5bZ C+dKf0OLXL5wSS5dOY/X9EnRkoUycKUJyjxLGrHRUqp7pSsByN6gmBkA/sWOHW/LoX37Ze7M2Uob QwDLWED1z54JgLXJ67aXACkZ7vqjzyAKcEIufP3PJROUGnO//AWJc2XJAOklkHILvTm/udgCaBHv cQFz7XOflooTx+XMX39D3CtXyYav/qEkZCZg3zN+MzFqkhx2gET364DM+/gTEqg4J/v+9M8kd9os Wfblb4pjer70YMxxrBlkxJbQSdDH7PMKuZOkDq1xxLSHmvYEesCBtNo9f/BbcubMcTn7V38pJctW ycov/Z70JMOwgSIi2mXVjI5jNdMBYYs8UzzNHT3yq1e2Y77ipaS0RByeJOmDY8QYTUtLq+SDpqqu oRnRp37QlmRJTWUdnJUaWblyAbIOQFwm+nCYLjoQjLQ7XQ45Bztz6tRp0GckAg9wOTjGumDsUQ8M A97a2qLOXSzZIeAEeJANoQNDhyRcF2XIDIkbMqitaJbX3nhDnvq1p+SVV7bJjDkzJTElRR29LBD0 Xjp/SZ02BhAqKiqkqalJHkOQot/XCQidWI1GRSrbwtQgo6mMHr711i8lN6cQsACl8urb22TdgwCv 7mgEd1umtNU3gFbLiwN3vtTVADQSjhUSFVJxrRL4fjlANPdJUydoSeywJjsP/F6AVgGwIpoxWKSU epAG0/BaCC89uWg4FQ+CCW5HNOnc2TPwpBdKakKSzJgxQ1559VcIyy1VMLCU5FRZu26NvPLS25Kb 6pJP//5nlDqkFw9QBuTRquoamTt3Jgx4C5yqJVKLqFMLwLgWwlifPXlE5pTNlmunuvCgyMpjwru7 2uXEpSNSXLgCzNANSPeA383rlnXr1mFj1MIzvwJHKVM2btwgcTC+9NTJJM1U3MmTJxG+nikNEG4e CPAaQKLLK9x51hCKf9S3GkpiwdFJTUmWVStWSWOHX9atXwukbSiPAQbu0ekDh/cKZFVagogffr5w 4aKce32bPP7Ek+ieRHqN2EkMc8N7fxg0NL11vXKh4pqkt6FrMT5aPvrMx+TF//wpUnbN4gPvW2dd tWROncreE03pOWJcCh2/d88eSY4H2CCc1Vg4TmfOnJH7HtiqaVc7bTrqh5x8wwSRAMwWDEDFD74n xy6ckeTNa6XjxEWp++b/kZxPf068qela9xY+s/BOMbDJIw5URzU//aEcOrpfYjaskO6LFXL+q38n s/78i+IBsvxEuQgKSUeH0RTq18ZX3pazv3xV0tYug+Kvk77/9W+y+s/+GFSXOCzqQRURG2IKIaQU Fh2mJ2JmIYxfO9SthZ+v/fB5OXH2qMRvXS3Vx65K7P/8V5n6R59DOj1DgS2HSklHK1xVWOaD2aGk XyQhBqRESkauxKdkyOvbd5s0EPQRjenlimqltWI5hrf7jPhRH8W0y2JEG1wKUDnaQYz29cSfG4T9 aZCtoGqJRfZiO6id6huaNFrT1dWtzpEL5SNJBDbu75K7YOsiBm4MuUQDjzAG3Z1nz17G3DgRyGiR s5evajSG4mZJCtedFzhX1Tj4OpDq2r3/kCKcL1o430oXhtoNfw85wya44OA1NDToAiQv4FEQCO/d tVuWLFiIue4WH2S7YN582bZzvziT0qWkIBvAna04pF0Bd1uj1ILGhC1ISuiWhEjJ6XPnpRmek2kv BBorwpNZgGlHDaBOoou5SK00Gc7njn45wOAxbEnAd8R9Z8IjfeSZR8SL+qco1A0lJnlkKlI5fX29 SHvNw+Zu0pRYcrpb4jM88v2ffE+J6NxYLAQCcwGzhFd8Yqr0elHsGZcIr7BeilcWyd6dOyUnvxBR o9NglwZkAF6bDLiD6VPnwTNvlqXLV0pPb4/0ofW0qqoSjhD445AW4umwEVGqsrLp6sEngJWZgJIl cAA4lmL8W1NbMwJk8oOaclPpaj4WuXo4tew5inYSGwZdPvwbNg+v1KwMuf+Bh1DPlSrHjh2Sxx+8 T9qwAHe+vUPWAhreg8gbz5WxnjTZvfeo0sFMnV4E5FuQOMa55Ze//KU0g4W7BH/3TgEaMMgep+Vk SFegCYsUPTpAQo2CM7WwcJ6cxmlr3ty5YHYu0nlIw9o1DtjEMVij3ReTrzfGnZRA+7cdkpStD8na z/+OHP9/P5TziOqWYT24MlK1IzKSkSRtIAc22679e8W5aYNs/K+fluP/+aIcf3ufZFfWS8Hs9LDW WIxmXajaZvMDi3pBcb995z7xL14u6774GTm965Ds+t4LMvNqo+TnQo8R94f124qbxH0cBrEGT5VV CEw92Q2U6zd3H5WcTQ/LvZ/7pBz4/guyc88hya5rk+xp6UTqVF0x2ovpqiFsHO2upS6nl4aDXFSX Uo/EIlvijjHgkN09XRKfDJ40pFXA0KdZLUcsaFIWzJdr166YBYkYGx0s2yEx9x9ZZD3acZrXGxtq Mmmm849ptx2IskdDV/aDM85DXkwWPiOC6o73YN6ypRw1QnlI/7oR3SLh+tgK3N97xHZmhM/KguYB 1GdlgcKlur4aEaQEjBEzhGiWptY6e3U8nDWmBPNysqW0tFQOHtgnGdMLtZbXrt19708e3yvMGrBS pvAP4pGFoKPc3t6g5MaNLVgDeCI/6EmmlRRLEsjXyd02gBqwfgSJejr7JAFo+p3IjAwAGgJhFRNJ Yipk9qzpMq2sVEOjfFit88bhnwXchAJg3c5QVGE8RbKacibBLQwrToYbt2xUNO1ohBs3P7BFUtMT 5emnn5JapM1KiqfJzBloAka9STbScQ4cMc6dvQDjWKoeosEzQIMucEvmzJ2PqE+5LFy4QGYh9ULO m6ee/KiGKNdvTlUQLoY1Y/DEft9iKa9ASmhKsew/cFBmz5mDtFqeHD58WB0fRrNqamo0YlVWNhW8 bQUauqN8GEVKQt3EufPtwoI5PzsTggqJxzfFE+vdQ36/bhQU88NZ3Hj/Jt3UXHg//clPpIvcbagh W7FqFfK9HuRyA7J200ZxIQqXjc3igRZ4+cUXddE5Me+zZsySLTA2CchX56MGydfbKdve3il7YQgf fuJpWb10EdYD6GaQJ05G+LNrDpxnS3/TmSdFTGFBoc4Xo0hz4SwRnoKUBpPX7S0BbY6Ii5eHvvo1 caaiFgAHmhX//TOyoLFDYoFJFMA+RxA9DNb85nIj7tpAbIxs/bMvKQehC+Nb/ulPybxnn0FJgilo nSjXULEzxkSqoPs+93toWAEdExopljw5VWauv1/JXDUya4p3LH8zTCf84Ntq6MbU1TiRennyL/6H xIELLwY6Y/WnfkcW/Xq3ksui9oGtsmMSKR+JRc+mpoiGEmksGOg02JQt9yEq2QNbgijN/NnTVG9T f6RnpMv0smkabeiD3slBowmjS2nJbklAmigGY2GkxDbydov5mAZ4gzcFYFvdKHFhWnDu3NlaA8vo UQZ055Vr5Th0psuF8xckOSVJ66vqEH2fT50HR4oOSlgigNY4+cz8DIJz5uWDOy4rFcjoKC2BDWXK tApBhTjY4ayUdNQbVUDfU3Zm7ro6uyU1KU5moL6X6UKb1iVUcrvZfez9qA1aGPfy5Ut0jQ8g0sXU aRuK8JfMnSUZkGs0omDkb8tFbW0pHKbEpBQ5g0jTLpBXP/Twg/AP1sIPqcchHYvKyXZHhqYwOfa6 tsORjKoQO0mBGu246Xiy10MbBwoRCyMDkAN+pM5YhJsBEr9+1KVkZWVjsU7RMbEqnTxs8QlguUXB 2vLld+nOptPDMfajXZgGu6ioSAlzE1AUSAGpRwtDyon2IHer4V6rEWoA90zLWqYV8EuXLkWhd6q+ h4XYvFhjRE+Y96KzZU98QX6B5KFgmEVpa1B4zL/bmyecizXcC+uW7q+nHXSrYY54Mcq4YOFClTN/ TwJglTvknYF50CJDhF6noTaJzhELFPk6pi4pb+0rRAei05GMNOky1IctlXy8lvBvbjjM8VGJ5nQF Z8vwvpnaJx/WCjskKHcW2FOJaIfb5PWBkAAbSTx5GZoO6oDu8UBJx+dmqvPN+CVxuCN5EYx2EHrK UBORSsIP3F2nxIFM2yAwhylVNYaHNPWeRLrHNxBTYlqi/ss9yV/FZ6M4GLqP+tyG8x3Dx4zpLXb0 RR1hzKkbEWcebHpRIOvAfk+MTRM/Tv7UC6YfaSyX0VEGtHBASyVYCM2LGQIi0PZ2N0hzvQGEjEE0 3Nvll2OHaqG7DIBJc12N6hY6B5WoafVj3fXDoVKmgRBeGuDCpFCPsv6Vh36qMcqGTmJVdTkcIYd0 tNQjkuSTvq5BOX5ov8Bfx+H9jNoo2iGSrofr4mecRYdgOZw1xbdCkEGDJ3Q6uKBYLoMHqYOc6Qhd aKrTDmiW7nhZ9I0a1JOo46MtYNQrDbVL4b7sgnYWidMxM92C5iBDP8GBSCLtRUV7s/6Of7LpS3o6 sQ6kTZYtKhZfD5qPrjRrnbaDD0CPS7sb0O5IL5zOCGVg7s22RDvcaM70Y0+2mfodNXra2mi1hZLx G79Xh4PJPLWgxCTBWFQJmTDecIyLDM8mPqxdAkTlxvuSUfjHe1wfGqVQ+uGx63soFDwvFwAr3jPh pPF787NxrmyhEjPK/pm/4335MwVPpWl/zgc11Xb9grbniL9nIR6dFPviyUwVFGSop62htEiUOpz2 xVkkYaQCRXKV4fX56GaiWlTaJiLaEnxGfSIA4um8m+8Vkh+fwd9xLPn5+TpvnIdIFQWGe5Pf8ffX SDYOR6qBaOwsuAfsVUPYEOGLUW98ads40yzIMxAuhUaYIJJhisGM+SFVN9s1QArqCvlphMUo9EEY Lo4/OBMWyYfgPlVYFepk6gAYVz3sUp62Ph9zdI52wdgRRpzXr18/pD+o+Al8S/2i88j/1Jky5NsE vDL6hYqHuobugFpBRHritH5WRRsiZ8nWpfPmzVNHyX5kMxZjZWn3aNipUxWtnHaOUXNLJ3IsLN4O RzST98zOztZgwABpXFhzZBEIUxasATWZJR2k6X63HAMeZGkjGR2jk2kHEBhUCMdYgzcLP2vmzJnq QNpRv+GDDOvTzHPoRXtjHf77EcFUYGTsdTccamJXaWqV/g9DiwbYylocOltWp4PluGilNf/Mmw6l 2sbR/MpNqyO01qHteLGQkGVSSkxnnoNYSHY6y5RscvHojtcvs+nMfex8cXA+1byORpSv4WcapWtv VhsczF789D6HPU/jWNk/29X+HFdw0Vy4J37MGjPEb7w+WhYsg5FdFmYt6WXNi84C1xPnDL8zRdac 2+F2XXWahkDLjGbXlaiv5bwPxxEo8+tD33fKPIR4Wifg7QDgyIgD5t6mmqFTTbRodsbah7RIDJxr UnUnXbQh4225GKpOIjma935ijoynfLP9zL7R/+EXBkfJ/GwfdUeMPsyPElyWoFhItpNpqXO7v05/ HIdc+TnU26mIWI/usgVgu75DBmpI3w/botHd+Z2vNmuIh22bQN28xh5D8L/BrvgI91bfEa4Cbjo5 PAwPj8taTyO8atsW30gekRtr8KczunbzCNuN5tjeK8N3CY7PkWMQBWxoxSc3Ek5rxuHgmY1RGkZl YNiQFtFU2yCA/YLgwcayTMwGuPE7lVLE3tgjXmItVqUToUPHKJNxeNRxUlRmDQTe4MbkJMJpgdWJ Sh9uT5wViQpSGGN5nsn33FDk5jAL2SqvGh0ldYzNRe624fmz32/+qpFE28G67tZmfUxeH3QJcJ6Z 3ue/TLup0adRxRcZ7G+mP8IhFzOWdypR+7hokdiH46PHdM8bDvX6O02AfaQI04pgOXJPG/uAo9Q4 nKQbC44K6N3ikIbsXPnvbEti25iwKR37k/jU1InBNmwoHDhCRkZLjq1ma0wLKvhNXDdDsrAdSBup 2rww2L00v3mfxnrTh7X8hqFJtsfN9aiRlHe808EgETodpRfV3o1ATPaBENHgTnLOApKNjpIkgkIB CkD/gryxcZRsotvRid4uDL/Ru1QRWgF1KxlnLVdOiKUdCe7BbgU1uVaIj5QFTM/dxEkaiCYwmNXC oTwYXIBGIMRpGk4gju5ZJl99cwm8c7NY6w/yBuatmSmmMqxbMFKgTrlZZTe8sVkfk9cHWgJcONyi TKFCOfUhPURaDQLWObV9hge4SF7ohCHvoxVRVgJeJSiEUiXFhh68JsYVfIjQmhHC2DNdYwE0aiSY +8xKlWiDjnVmDLlP8h4iiSKaMcGLabO0CMmQiiqTAec+BHWGIyPfdLZvdpCm6WBDwPVzSe+cdpBp y3DUPTKSTkHpwracJJPVwWofkqDtjti/iNZ6lOErnBF0TQuqhTRo37zMv8Ma3hxabrwrIznWYJnc qEbYWPqb7Vf6NpZcrzNeaHKIQmgqQQ4f2StnUEWfCTBFF0G4WDSGlrgr2D0feuA+xUGI1kVmOxgm rz3qi/rFWgbqnOB/Dkesdn1q2DAKuUBSAeiuRWU92Kw13K3M8nCEsFjJ58VTCE8cTN8MwkEyxVeG u0cLFxkgx7MRGp18bTEo++yL8YkLrN7ABNWdSVcwGkRHUX60L4K4MgoBfRUunSrduSwaJxLrcCrP 5JJtYsHIqutRy3rcb+Acc87tDQtMI63FYBErnRkSjlJMJsfP098AJwuiY+SR8xvwowgSE0LcjAE4 uEyna7c+ISBIREJyYmtdMSEwGB2Lv/QoZe4A4AU8LNiN4vzgPuhkHBhAEkbnml0sN9+c4370yRu8 PxLAHvZgf8VgX/Y6fOCRRJ1hAN0xQEDudgN2glAk2MORupjaH9DPYwcSIu6BXiBUJ0ofjLxzELUk cJLGqAlD/gjcR4x6OSEvKvwesMbGeDA+gCQOst6Se0Zlifou1J8OxAAoE/WmAdS5uAMmchfKa4St 4Z7VrjrIEg6vlkCgVrrVAdgW6ACHF84oNYbqdaM7RnsZw0gP29Q09g/04GfaDWZI0ObPYm20elPz oBIX88h6KB7JaFdIsmR1TrIEwBRxKTcfizxoS1iXFqqaJB2gln7QUcT8qPBZ+2bGrx3gPMTry9Q4 6r/UswMWobs+LZ11vPeG6dPRCvAGr9c6YZUlO0spElP/azJLJgJGGdkNPHapiymngf21ymfomJNi hdGyGx6gQzBW3sLUVBN1ezhoomcDnXPMKyFrdGoNrp6WbOhnKzGJ/SfzGzNF4I3UAjp2sPlk6eI5 QE0uRWsmmKLBzVXfEZC3AWcfg9ZbLjZ1QoxrYSZmzN61eS9jOQR4rAVQoys2AXhE6MaAs+IAaBWx mcjbppwwQEe1C3M1JOZH1TprE7C5fYPgaFHiSwe6EDhGmlcUV6Jrop9AabEAi6SL1N0ngThsSGBk KB8c4ef7ofCsyeMkB/Ch0Q4KFzD1cNyi8H0UXm8XddNRZEcL65YM7H2IZnbC3sYoCivsY9KW3CzO eHQkcu6w8FGgxyJb3aaIPMZAEbJrsL6tXZ3t7PRcvLZHmoDW7cdcJSano9iQyglqCvMANjdLqUG2 UGQ+gJk6qcyBweGH4k6ko4rceCCql4sVitQUWLK91zhK1hhVhh/4CZmwKyUkA8NeDzQ3yVtf/9+y csNmSbp/tbQ+v0NOvPymzPvCJ8UDaiKoP1XMkbocAXT8tnnl9a9/Se6+Z6VkPrRKWt/cJqd/ul0K /vTTkjYlT4F3J8LlBeQ2nR0fuSnRzn7+i38tUxeUSsrTm6Xr4GU58Y//KTM/9V+kfwk48FB+kAh9 mQAHsFeBYEbvlLzXM5saVsvYaIEszSsQ1gAbsv3P/1rWblwhaQ/eJW2vHpZTP98uyz//25ICeI8u OixjQAy1a1JZ10pw27qGanRQUy+hQ8mZJL4YgEMGACwMwFJoeOkj2TkPXziUMb07qB/KCJcxm0Qi 8MOOkGtu2rRpoW0O4VkS670BeHy9fT2ARXCpgxSDQyJtbDTw+KhVySfG+jw/iJ5jaKfhBPhBCBwD exdAgXQfcP4IU8OMCKWt6d8Q6UF2JDc3NWNsOJhiMukY9aO7hgdedpzzIn0LTg6mGNouDrbWEgMW flBM0cb7MR/sYi8jzJAWnjO4EQ59Paho3zY0j11DRnvNrlQ/HVJ1jMyhgCMY+lfHZGhu+Qe7kw+h GhL+cVHiX3wfwBfqwmHsSFDHMLMdBn2vLTHKv2txXZTCsO/edwjOiFvuA8VITkY8nKZKySkoANZC FxZ7u8S746WxvU05fwbgIWYm50pbezUwemIkIy8BiKReaW42IGnROD11tAZw3z3S1tIrxcXAB5kz F+2cVZI2NUVavC3iRXQoAdhLHjiVfTxBOfuwGDqloaJJGpqOw3mKh7M4VzKLncBV6AR1SYo+HKv2 jx8/rt1aOcCxIE/NnXSRn4edDqdPn5arF6vlwfvXSnVtlaQAaoFOkotRSSiZtwEMebqmGpgssbJy 2UppQFvtpctA185Kk7kLFgGXpBCbC4qqHxsdjqojhpEpP1K+Xqm61iydFTUS8PSCuy1BHrtvkVyp qJO0PBgrOqkA+KLTypbesOyxO2lCJ9qzMgoCbBVXpkcOfe3/ypzjF2TnCz+R5PVzJDo5ShL8IKyO 7pUAjF2oDMF7iUCjDylOySpMkBPf+D8y6/QZ2fs6+ORmLRAnEHzD4Fu815Bu+nc3OMpi/WhjJ2WW O1qSpubI7r/9f7LyyjU5vf2AdGdniBs0TF7kLQM8WMIpiPejU9cHQEAnbECoQ0n2SGmJLAPKSLQb HVkZmOPD3/ifsujEfbLvhVclbvVS8aU6pQtj00gJswajvnh4YhaA0RbTvZyVlQmb4ZbWdq90edsl IwG4SYmAQkBEoRe6hFGQaH+XuPGZxOAa4OEZDggjNwMIDpDgtpGwABi/m11djKwMFfCPeoBBb7Ah bPolHZApbuhKGCKpA5K1G05FFoB0lV4DC6wPutIN3UuIBD5bYJDOHWi94CCdO0vWh9A7uBwoAwfx 4GpLSiFcAzQ0ghUsMvcBkZxRr1h0/VFGEmWAOL0AXSXHJgu+2fIfjwwVTrs69z2w5RcvnjdNWOMR 23u8lwdnHw4I6ekZGujwYqxkayDZrbcPvLDxkKnaMVPUQUd1AM/FxiPtjGcICOsmQLwuRjSZBRnE 4hhExAWg3cAQSEREBwRw8FodMELO3i4TxrPCUyFyUPUxGerqBiz4sePHlEi2E5GeQRjBV3/5K6mu bpa5AIU8ffo8OhQ8wK5ohJzBJYeHiMW4Htj4YTl6/FUAOzpl9qJ8OXj4JMY4ICuWr5Y162fKnu2n AEoJpXb0gpw6eV4aG9rE29Ih2YMZcvHIcakAbPqUgjwpm1ogB09fBYhXsVQBidbhg7GPrpf+nlRp T2yTPUd2SJffrU4RecLoJDGidf78eWw+gxd0p1wasoT839r2lpw5dQ2+tVsOJbvkwMljUrp4kaxe t469/Til4R8Q2G5ev1lScjJlG6hJujrapLhoKkhxpwByIUfDy3S46puq5Ozpy4C4rwD+1BRw/7Ri noBN5cVJKr0XnEuDsmvHdtl9vEqmL8qWZBAUe+IzFbRy6tQyDaFOXh8gCTCVDlLKjf/ff5ejVz4n O7/2B5K4YZnc8z++IP74HGnxd+DwFlmC2x4nFD+iLqs+8xnQ6FTIwb/6ivTdvUI2f/2PJCrNg9Mx jXk4TsSjn1cHTvc+RG8T+8jF1i+Fv/OYRLVclRNf/YZET5stC7//ZRkoypEB0KxQjgHULHWC1JXQ 29EoWQjbU2hRjXpK+j86L+v+4NflVA0oIv7yzyRr1VpZ9pVPSXV2gng7/YqAHTcGNqworctgyzmM ICMH5EQDYGUrSNJfBd+YMztOygqzJa44DrW3A9KLgEBnZ5vkZSbi0N2DueyVNAAj1lfXS011lSxZ ugAGE1xpbP+HobczCqFxkkxUTbF7cH9G5C9euiInjp8BwXsCMPuWAZm8G+jWyUqLUQndmApmAXab Me3nwLPSFjFKE47LjsCw+50EsddA3fLmW9vliSc/Iq+88RboueYA4DIVEboYSQKYcHlFOcjoOwDc mSoV5eelta1VHnzgfo2yEmJIgZzHCBI6qudjhospMsiTANAvIwqdDZtDAOq39+yQ9QAV7QXSOsuK SInmB5B1Dmw5ufs8qL124D31tQ0KjOlFRqQLtdrIlWDwcED6fcjZ+mJQQ4JPQAsJ02HEb+gD469J P4YeNI2eKr9YV7R3314IO0EO7T8IWpI5cuXSRYWQnws07EPtB2TJ4rvkYlUV8avgHDWDOy0X0PFX 5RIWVkpShixbvhDG+wLuNBPhtmYpLSuWrOwseeihu2U3CFn7UJTe4+qSsukzJL8UiKCIEB09fExa ugNyYH8DCFOXSOWFDkQ7EKGAHBrAeE8E7mlz7lKvmNxtJL+dP38+aDeO6SZUaIhwusWjWh1hfjFW HskgWwDt/7Fnn5VXX3oTRLe7JTY9GWBj12QVjxpcnVikXKCJIGZMTUtRxUvniqSHg4gAJGCjJyXF Kwt5akoaTk67pB6yrattVPDPwQGeTrCpmHrBKW7fvoPiTCmV6hpQxiB1d+XaGXkANXIM/94xsg/z 1E6U2zP87vAPSu2LO+XquUuSsHqRdJ+tkov//JwU//YnUCfJxtzIOsYuBK3ccDqaXt8nl4+dFs+a hdJwqUHO/cOPpOzzH0cqOME0JU2Aq9eJvYcDbz+MEjMBXW8elYtv7RX/msXirWyX1K/9WLL+8HMy kJuu+j0B5QU4j6AuCfAKVsNpuB5D0xqYX9v4Vr20W86duSDee++S7jM4JP3dc5L1e8/IAIlQMZYx lZ3ZlQFMpWgNlFasasTf6w1IahwPWNny+mv7tR6JkSSyNWSkeKQTKS8/PpTZI5KiI9QgsxYv0dpc 1i/pwZ5RB20ACs2lVUgsJ+EY8XlV4KzcsmULKEiSZB+IwauqKxWjyYsIO68EoHEngfUgpq8ThO+L TN1niHCbbvREpv6W+ptlFowsgfECAQI/1lgVSOhPANQyFocaxwAiNl5kBIB51dMTLRWVrerAHTxw WtygsFq0cJ4+5xA+UWjEd8O7aL2w1WTB6B9NUmNjo6YnEfrVoMiu3Ttl6cKl6gP0gCJnIWz6bnCC uj0JUgBU886uVnGerZD6xnrw5yF4EoMbERE5IzlJzl68KE119dq3RpLbrp5OsPpmcHkPTWaono9O FwG/pqDOYDs81MrKGpkxrQwO0lTpgcCnz5kFtNQWrRnygAqAHVFEJWW9kNffLkf3Y6EPpGJk4N6B p8tFFkMeN9S1JCXH4eF9CK/1yquv/Qqhy0IUZ3slqyBHaqsb5NSFcrnn7jVybeCyzJxdKufPnpJM 0J7UwpAPRMNTRzgkIQsCA8hhAF19ZWVlcvToUY0e0XEM3uyhkseEvw8WXyLSnVzor77yCuYIPGsz psvVmkqZBXqXVKQvoaM1v9uN1O0b298Am3U80pJZmCMWfMfAaUrW1G4s0qfRqG+Ki0vWqFBGegEW ZDXAIUukoRrKahA1As5ocSUAMDJjtpy+1iZlc0qlJDcHHv9pOFkGNDR8R98JPxsfyAFyX/X2dsj2 7b+UgpWbZMVnPyEHv/MfchEnwIKtm2Rg+iLs414c6saSihmbyNyImMa2gmvsVy9J05qVcvcXPyWp //ITaX15vzQ/8bCkTU+BQY3ceN7tKXzQ2f3YgE7UrARQRnDm5d0SDWqne7/y+3IVfHjnv/tLKUKa PCUTDOdIb7OGiQXLsextGZt4bvldJrlknIwADt573twnCSvvkY1/+Jty+f++IGf2npDER1okoyQN 6SU8x5hq83lqZV0R/8WXOmUEY+Sn+6UTpNgdrR5kSlDYDqrkbkS+U1ITNVtCCBwXjLwPUe7ly5dJ Zfk1bRZig9CYhnLLksELWZ+EsZIqYzcOnjHgJvUi6hKHVFe/b0CJvTNA9J4Bfswq2KgCcLeRfL27 szPs88bBKe4UvKT87EyprqgEowIOv7ADsaBTIXG8rxupNYyHmZYA6r2mgPx9SlGhHD1ySGZOL1DA y3bLbo5GLGN6rV0Ep14LbBYoeUj90tLaAMTvRBCot6EWFhFUOEgzQEdD4mBSjyj/utcPJw90WMlp 0gxiWz/eF4PIkiMahdIBoFNOL8uXouI89RJNGS4iPBCAB0zvRM0k148BnQzNpYCOuOcqcH4dP3Ue kZ9ZMmf2bOlurZYLl6pk2owymY7i4OQkJ4p/s5QfLKuw1BhX4FsV5McjRedH5KcQK8wp8UkO5XcL 9IEfbM40uXzhnKwHU309mHyLp81FwrRHOp1d8vyeA9KOSS0omYqUDWgwkDZdvngpQofgoMkEtQYc JBYVJ4MROHtaAjh9OhSYip7xFBCqnjx5AkS3GIeeKiZGwWZoZuTd70I1Q46hTZs2ycXz1UiPFYP3 KE5ywW+XmZkrL/7kOSWMdKFotHDeTEmBoxuH/PXCuYukvaVUzl24jHXkRSq1XA7u26ndkinY+MuW rtRwbi/y68kIdXdM56m2HTUTDGgmSCZOucnw6qdMBbnjuVMI885SrWJC3naXYSQkMPkZYZcAawKg bNd+5U8kDdVtHVlJMvuzn5Xi7g6JdqNWKUAHOrJ7LgAHvzPDLXO+8kVJRsNCPw52OZ/+Xel9sll8 iIiikjXsYrnVD0iEQXVDPJ04rXTGOmT6F35L5rO+NDVTZj5aIjlb14vXBZJgOA0uRJHobPoRJAmw 9kV78W/1k0b/Ou3Kgr50IBXGVPu6L30BvF/IXqTEyazf/20p+XiH9IM4tQu6NwAdwgaQ0V88JNNJ Ypca0zzkbgMPG4hNN25cI60w4Mmo1ZpbuhQO0qAcPnMRtVHJMndGqdQ2NEEH+aUQ1FMEMc1GmWQq 6qNc6LJ0IIUXmhTbO5+IDggbgVzImsyZOwf/grwWB05ypV2+jCwJuOWunr8qCWmpUgRKrHYcSufh dUxdOYhrGM5Jw3CVdw0ptwKQ62YAnNNHxGpE+8i1Wl1br+jU2anJyOqUK0K3ggrDT6DPAB8PPKhl Ot/B9CCjn9fRvIMBHc47nBsETe66a7HOHZvTBuEndMAJWjILWab0TFPXimU2FX7D1Jx0SYKTeu7c RdkJR/VBcLcVFKySRjSSkBsULhc6ipRSAt4hW/yYNdEuNiw2drQxJUbn3PKpFUVpLGuYH6UV5dq8 aODxMQkrVtyF71GQBijwVDAh351XBFhwMjejmAopFxaA8UHdiWRFpgPXJ2Wz5yhEux/FigwqsDsv BUorgI6NXLAVJ2CGUkBEWzx1KiJKOF2lwdHpBVHlgw8hwpGG1FkaeHCQZsS90hLhCPZ3I4XnMeVX iFaxM25KEaIXJS7UynTIypUrlIBx3ry5ytlmqDFGM3m342uNu2x6g0nlIpBbDnj1SvG9gV4gsW0f Fp4XTo4PUTdCABSXliCVlqzFj6zZyER+Nxfcbgx+t7a0STycLSRWEAFEgSIcLOa1oyQTc+nD6Ql5 YYTBuR4GMP8ufOjqNeDZw3pw4P6JKZla08QxDWNhfOAn4nZcPGMaMyoJxJWaKz2A6+ge7JYEpNhi obwCaOd2BrpxsIJOCP/ZfnjsqFvxw4jFZBeKA4fJaKQ+OuGwOQrisR47rXrOibL+2M5PSiB2DiNW gkOHRufY8oTamljsXUgQP6Puh2XKgNPoZ1qK+cIwIHRaDVBWtMMg39FYxbgAORAP7jue3lEf1Ut9 kJCNciLmdCwjMYbVM1wSQv0QUCejqqpCC7KdiF6zG7e7o0+utIEPDQYzCTlGR3+PnDl5RDu2aPOu nm1SHCl25jbVX0WQEHUpiDAEMzGMYWg3eAvTQnBmEQ26Vn5VeVO1+QXpqwBqo8631KiT11qFbrxo QGH0dcvFs8fQeR6QKxfOyhXckR18dlaDujXU8UB2iF1EdsnjjmW/HYqYWeVOeATtdUdAAR2CsJWd jZVaHlFdccmifUGhdk+vxHtikFI9rT5ELw7NjNpwMZilFp49w+AFu9vI3UYnSNN8WprBzAOrwFD/ heeo6mgegr5ipNCJZ2muRkc2Oh0Xzy6RPqyROn+n1lKxaVTxagawQINq6ywfqE8nl48znIo1bsT4 L9sAR0kPDKx9KbfX0M/mlMYiO3MZAkT9neIgmL9bJYGsG9aLKOEJSQnoXIMLhNMnL5bMxOMkWAa+ MeUOgsHtg1E2F3O+CBvSMQu6fNjA/Aw3WiA9HpBswjFKRArJ5KXvlJoYgxdlLgc6HNjlAJlaQqdj y9DrjDkzh5wWbi4vonX2xVx2HzoIeDEqt3DhIv2e88DX8su+Bv3dcHf1r5qm0xWItC+vzBxDWGzX BYTrdDdiEUz+EGEJmDpFbvRERajxwRFBw4R+x0ObWRuRu3AqRYTGJZ3i5ZpHV5gTJNzSywJykqIa AMSJcBEHhv4Q6408wCcb1pAYHZR7TE+UJFlYMCw99SsfGQ6QROEI91NYBYQ0kIzVC8of7Iv4wCRu ZJkHNQ06yschUT4JVgqiCHPnzAvibnvnDCm2nkWU/m7zx2LpYEqVUOgd3o+1UoWFBZpmU3Cdm9QX 2bVQNt2Kzd3GMSuHqGIthW4NmlqkAeVCZeTepu4azRq/0Vip+1n8HsqxXj8myqq4uFjriI2DNDpn rDA633C4khPUomtDd5tJXShRrKmyvaEsQjcFQ1vDfHP9jbWNyvqlRrTMCYSXDk+/DXpweonX34fh NQWRNPfXW+p7sX3gCFmBEevvJlJiY3ro3S3Bms8isS2/jJFnhOnOuWw5X/fM1607VUuWg8mCbOPg BMObDb/BtGjC8FktwUMIdtZca+TSijXak8eTHS+m6MLbQHrnzOyEflLdkmbN6Gqw9rHiqkTcSQpm FFPloJGG4WtYP73/MtVNNDw+20BoKm040qDiHDIeRt/aB82wP4OlClTf2vo5aE75u2BdPJrxDNeK MuCBrqsktPqHyHmwMZjs8YTivrwH2+VZszPWi/cIZTG5PQ7Kks6CDX8z1vEFvy9cYw3+DJvcOJRk uuggBGYQC3KHHIM7yQkIxdRP3mNSApMSmJTApATebwnYB36Og3YtVM7D9bZxtNGJm8kleLzjued4 3hvusQXfPxzjvH78w0Efg6Ydis9UWhLmWyevSQlMSmBSApMSmJTA7SwBO8ITnB4b7/PYxjb43uO9 5/URllAY81COKThiNlHH9m7PG8q5+v8BNRegxUThO74AAAAASUVORK5CYIIAbh7wiBYBAB3PThMI baaV5Hxx2Q79m6j/iVBORw0KGgoAAAANSUhEUgAAAYIAAAGCCAYAAADt+sSJAAAAAXNSR0IArs4c 6QAAAAlwSFlzAAAOxAAADsQBlSsOGwAAABl0RVh0U29mdHdhcmUATWljcm9zb2Z0IE9mZmljZX/t NXEAAP+QSURBVHhe7J0HYF5XefcfW7ItL3nvvfdesWM7dvbeE8IIBAKUUQqFMlrKKAUKtPBRaGhZ AQJZkJDp7Nhx4r3ivfce8rZlWfr+v+e+R756LVmvhvc9QVi699xzz33OOc8e2U/95ZWi/CMFdryo wGrWyLakJRBIIJBAIIHA2YdAjRo1Sp1EURGX9X+6X3oP3Y06eR//SWtcKSo8bgUFBXbgwDbLPnTg sA0e0s/q1q1rhw7l82T0kvD/YcCzD5dkBgkEEggkELgoIAAiP5p/rNRvrV27lmXVrGnHjx+3/GMF pfbJqVPLatTMsmPHC63oaPo4RVYjO8saNc21/Xv22MJFNSy7sKim7dp5yLZs2WDHjh2zo0eP6CVm hUU1rF69BpISalqhKEdEIJKWQCCBQAKBBAKnEwKFRYW27/ABa9O6idWqlS3u/gRzf7zguG3Zusdq Z9WyY4XHrG3bZpadLU1Oqg9o+vChI7Z1+16rn5VtzTYstObNNEadLDteWCR8blZTnY7uPGiLGna1 zkMH2cFDRy37qJD/ocNHrW79HP2x30YMbW2HjtWygmOHbfasJdasRRdrULee5eTUFUEodKKAQHJc vxfo2Th9QJTJycmxw4cPe58cSRlHjhw+IaaUA72cOjl2rOCYU7qkJRBIIJBA4GKEwNH8fGvftIWN u2Sg8HvA8BEkagrHzpi71Fav2WL9ene2Pr062WHh2KhbkWUJ+YOD35q+yA7NnmMj87fa8ZwWdrhu DWvTuLH33bHvoLWrc9jyNy+3vT17WoGkhmz4/No5EgEkaixfX2gbcprZ0bqN7GNDs+2tN9+wfQcO Wv8Bw+2FFx6z2rVrW4eOXS0//6g1bJhr3bv3dsJQKJIFVTqwf79NfecVu3TsRDumj5n6zss2ZswE qykRI0tiCnM9dizfamXXcuLAf/x+9OhRq6WxZ8yYau3bdrDmLVppzMKLcQ8k35xAIIHARQwB8HEh bLQQ/p68Aymm+IS6PksqHRBprdo1Ha+uWLHOHnvsOdf1R1x5gX38oQ9Ydq0sq1XzuB3Zc9BMOHtr 7aa27+W37GDbdtas3yA7sOQNy85qrHEiYGdnabD6DerazhXrbePeQ7Z9xRHb3aCmXdm1vl1/3VX2 9ruLRDHybfKbL9s119xok994UQ/XsZ49emuy0jVpwg0bNrQVy5dZ3Xr17O3Jr1iH9h0sS4Th2acf czXTkGGjdH+p1dFz3Xv0siWL51uTps1EDAr9+rDhl9jKFYvtL4//3j78wEPWsXNnfVjp+rGLeI8k n55AoOoQKMlgVn28ZIRqhQB2XZYo/9hxce9HxRCnrLYwzvoBXx8T0q8tRH+soNCO5x+0kaMGW4sW LVwamD9/rgjIPhmCzbJqZ9sRMeSN1qyV5NDHFk24ylq3bGnN58yxfXv3mzVtYjn16ghHy0aA4aFu 3WzL27PM5i/vab2G1bMm4tBrFtYQYq8tIlHPGugHjh9uvn79BqI2tWzv3t224rUltmLlcmvcuImN Hz9RiD7b1q9ba3945Jf2D1/4mjVt3tzWrF5hUya/Jj1VCzsi+8OuXdtt3pyZIi4F1q59R8vbtdNa t25lr7/6grXSJJkPhKngmChf0hIIJBCoXggkhKB64VnNo9UQUobTP7xzv5x3joog5LvmJFs2AZhu JwTHCq1OTm39K47/0CHh2cbS1LQTg17L9u3fLnW81OsiBHWkZSnUL3u3bLWt0u4M//JXbPXbU2zF tHesuVT9NbNrWoOGwu0iKsLpWdasaX1r02mkdZm3xHKsoQ3q09o6Natpe3YVivJkW0Mh5ppSHXXu 0tlWCvF3Esf+1puv6e9u+CnZXlmeeWkdWapRH9WrV982bV7nNgSElYP7D1jTxpEEMOXNV61lq9a2 fftWy5e+asDAQda6TUupm/KtQGomqFPjRvWkWqpVzSBOhksgkEAgoQPn9h4A2WcL527essdV5k8/ /YLt3r3X2rdvbRMun+DiQr68ieo1yHGEz+9r1m6xPbsPOhO9aeNGMdh1rKh2juXWrWOHDx6xvZ07 WNfb7rA9P/8fazVkkK28/kbb8bfnrA6eQ40aSD0vQlCndpbl5ja2sWObWIN6R0RBdlm9OgdtwVxZ roXAa0uJ1KlTO3v//R8Qcj5qD338E9a2Q1sbMXy47u+3gvwC69m7py1ZtNhaNG1q//qv37GevXra smVL7e6777F8uS499PFP2uKli1B+We++vW327NlWL6eetWnXxtVFffr3FbHYp4/YbAMHDbBGuQ00 j8RgfG5v2WR2CQQSCFQ3BCAEdWTIxZW/SB6d48aO0e+H5UqaL63NQTHkNfxe85YNbevm/Y5z9+87 IE+hvYbNuEGDRiIWsrtCLMSYHxaxaKb4sIK//s12v7fQai1aYq0G9LMdxyV5aPItmjaUZ5IIQU5O LcsVx08bPnywbdu6zZVSRXIfbSfy06x5M0kMje3Tn36oxDcPHNC7xN/XXDOxxN+DBvUp8feo0YOL /x49eliJe3Ap999/T/E1jM9JSyCQQCCBwMUGAQhBgyM5li87wOx5q11NXrNGllTpdWz9xp3uSlqr TpG1bdPMFi3aKGnhoFT4zVwz4+41wt3rN++2Ji3qWYve3W1Zjbp2cOZiVy/VrCNJ4cAuK1rzmh2X 806LTp0lNdR2rU+2vEBt7drNtn//QTc2ZGflFPutMu72bfts86Y9pQWnXWxrlHxvAoEKQ+BU0Tcx 1+/Mxj3hPJKE9WQGsfOyF8vcpUNjxQLs0W+RK36WTKY5dWo4bm7WLNfyJSV0bJdru/fI6GsHRQTw NYpabq5Z66Y5tr9erhXeeacd2r69GH8Xs9ga8LAcftav3+LjZ2/fsUeixiJr1aqxkxPnxqvEkJe1 vUu7Xkbf2OXIzTRqxYcqfiFMN35I4p2r9C3n5T46bZMuDZTpYPeXp3WUcFl8zaPd07bYSWOcaquE ta3gutK91LmmQyttb5V4KAwQNmIGczhVlwoME80yfEQpMI5/RgbTqvoeic/FFzRO8qKb4eSCaKLf o5QIJ8+vtA87MV58nPinR2PFRvNfdVXejCWbqzhiGES/+8PxFSiNysbHib7Bn0hdLn5d2nrEp1Fy Jqda8fghkUt/dh3r2kE6mTSAcX7w+9+8Jc8a1m8obU4DqdcLXSVUnFZC8yk4rshkqZDaDOpnNXNG WJY4/uMeGBzST0iCkFfSrNlLbK+EgOxj0vG36d7YRo/uJ+ODvIUkFWCwjbeaoh4EMhRpAjVkNHaf VdZeSib/0JTLv4KQ5bZUKOqV5dIFen6s1hg/NA3FHKi35sJzqRlF/2hsot34EIzSRfoICJKPF0Ma 0azCBRbcv0quqlnRvBRuHQEjda/EAuHqqjvqR2Dcif2TWmBBvChsIP0eNlnNLFHjmpq/A5Lv5g4/ +k55UhFYp5v6W/NOO6neU+/DlwuRL7wWD6zj8poCVjyXAkaK0oVNe2KK0VxOHKdId5f6OPc3S223 tL2crmErsarpZzcseDoi5Hpq3NIQjL4KobPEfqkuQhCdUzidCIZRE5xr6Jo20Yn5nLgX7Y/4l+oe exf4Fe8l+od1PLFJ/Jiz7xjDf2XDRLD2XRKQR/E+iQHH5xYAdQKIEVKI9os3v6DvwfW6eOXDnEue +pOWojR8WRLy/ldpETj+rlOsbSnDlDpO8TcwVvGyc55ie4C10uFNKSvUTWfOR+O31PziS8Y54JzE Z1+Y+juFUxyM9Ikd3Wg5Yl/rvxITFYO1fzjPxfcpeIyJRO9gnpHGnD6p/idBMvqeOBwrTgjSvrEE 0IshE2GR0taqeL9EvzDnQkUXN6xXYLmNW5VcwmMHzKb+ymzRSjvS/hLLvuJuy655sgPO4UMHbefO XQoo45Bohx8+km+b1m+0lq3bylU0tqi6f/DgXjuowLJ6ihM4ePCgtWnT2gPEMATHjxyIhz1/UCHO e+RJVL9+fWsi19L1GjennvyRFIQGMfFgsXCooi9yolGT3BjyNIIYkPuoQOHUoTE2wWsnAUkdDuzJ k1QjNyrFJvAckcl4KPFtjOWHWkQIpH3kCN+BTUSbUvfpmy1Cgm+uE4jUB0WkQIYZReHxzUQ9N23W 1OfOWCDzDRs2yXW2kdVT5DXW+6iV5IOgfdly+SI0nKA57q5bt95dZh2GRGefhDlTQCllPLBR4BIi GhDbMSlM5zAqiVNKIPMTCCi1oRxBgvRSY8U3Yfiq0qhA8eqcbNgv0T1tU5+E7kqcqEDXAqIEBSua vXjS0R4gcOYEJg03mUd090RYfoTci/dRDP0GvB27mQKIk4IT65IOjxLfUxryjuZzgg9OwZdrDuuC tFenLVagC7EpFD+QvnjFkz9B/05iiMOXxHMVpCManwIHmH9j8wlENfXe+HYrcRiLQcw+YoxoLaLL gbFKrU+ME4/oLP/Hevof0TM1BKPUvvBRfHtG8zox9UhVUgxrn2NsvYNTvvaPM3lhn0W9Uutw8ipF O+8UG94ZhBTgUxOIGLXi3Zf6ncAw/P9PHi9i68IY/Jvaz6lpFk+9eK7R4CXOtTOXBcX5huKJ5mqs mG428w9W9N5GW91ho/153yTr1bONNc9tZ5e3e0ieQnX85TDn7qkUTSX69FqKDyg+cA7TGo7gHvvz E5bbqKFyX7SxtevW2dVXXuEItpniBNIBhvvoiy+9LGS3zq644nLZHvbbs3973hEf8QfXXH2VJ0yK izG1df21yW/LO6mTzZw5S5HJYxysDST2OCKHS8OanqPJO3cXrQPXDh85Yo8++icnAhMnThR12ykd Wa67UkFUDhw85Nx3AxElvKCmTHnbunXtYn369vW5NZPVfcOGrdaypeaXrTC7FJHiHfjs7tix08e/ 5uqrrePRji4F1NIPaTSmT59hveQhlZvb0AM6ajibETXgWCjJZvLkydanT28F0S2Vq+wAF8/eeedd 69Gjh2IrmlsrwaUYFqdEtsVDn3KPxvdW2KuxJ1OrnX4l+TuBQAKBCwUCnPtjeVvtUON+ltM819a1 bW4r9r9pB/fl26X1PizJQEbjQFRSH10i7zSI1f9LEVUGhFPfJdEBRL5ixQrbtXu3/ejHP5GLU237 4hc/Lz/URq7+iYgtqp0atnvXLrmAymKhi6+//qaCyHZLKoi44OMFl1uWEiDFySGceHN5Jz399DOy VbSyP/zhUXkvbbcuXTt70jtoAe+5/fbbRKwirtqJssZHTbVz52752XZQ4rwt9vjjT7inU58+veRu tVcI+4jPadu27dazZw+bOWOmI/J33pmmWIYdQuQ9NL9d9sADH7ZGjeuIQkbUuwZWeH17hw4drU/v 3tZQyH7Sy6+4OgcpAmln06ZNtlRush07drDbb7vNJSmof6D1wHPJ4iWKml7pcHtp0stWr349fWtz Jwwd9BwEplWrlsX6uxNkOUVQijmNlOLphH4jIogRExVxc8Xc0Yk/i4lB8b1IBVfM0fBouviQxlmV 0LSUdVpS45dgIKOJFXOFcSJ1YpjAQXrXFBGNcW/FnOgJ3jLisnzi0UPF6sAUi+DqnRgL693SuPw4 5xj6FrPSrL+zGmn8J686Qa1L8nnR+9g3AQZB1VQC1qVymifGjDGtJdQDJVTc/qIT8AqwTJcEHBph 6NSaxjlNfy7cDy8u3kYp+MWWJ8aKh80ZPV+CewxjxrX3xdr1E8+lJh2tWOx+scosxjEXf2zc0hBn 8NP2WEBgAdul9kP0qeH/4ymcT6hdT+ycOH8f2/QB8aQW1c9OSp1Y0kwSwwOxXXTiDMS4vjjHFhM2 it8aP9epi9Ej4RycmB/TOaqAsydq3WBLWl5uuYWLrXfHhda7aKs1q5dt/RtdlVK5p85K6tEYIZAA 7r77dICzjd6OOqZHj+526y032ZNP/dW2yr20qUKTQX6xTzkxZ12sJyQJogT5NRYCz8vd6/mJ4IJR w6Q33ttTyY+mTn3X+vXra4uFPPvL17WpuPWtQu5NmjTxvYa0ET+IPj8RoS7i8K+55uoUp93dJYU8 qYvatGnryJ50FaTB6N27l0Kw51u7du1kbd/j72ohpIwa65Akh8Z6T4nmNousYsmkfko1BvFBCli3 rsA6S4rZu2+fSx9IPHE1BAQOZH/JJZeIIL6usdZbx04dXcqoK/UU4/FcHFGcBJzkQgKBBAIJBCoA gQ15x23ewca2TO6muYo9mFBnun2qW4Fly820Qb3upeJtJwQBobsaJvydulhHvqcg78efeErqoVzl AvqgAheOKGPpYUeuxXr1FIeGzgnE/eQTT9rIkSNtwID+Uru0dOR74MB+V+VAJGI0zJHtxo3r3ci8 es0a+8QnPi4Evt3a6xkMzXUUJQchiewZqIkiSohJCH3/lYq4c8SqVBgLFryn9w63y6WWYh7r1q5z HX/r1q2tTt0c+9hDDyoSOs+uu/YaJwC5IlRt2rTxOfq3eIvIMvBYq+dXr17rhujOnTspR1ITj6Le tm2HDR6suIvt29z2gW3C9W2B48CILdUSdpW33nrLowSvv/46SSO1nWA8++yz1lfqKewt2A/i8AjU Pn4tsIAlOMMS3F6JIZyjdcmp+IsCd6srcS4vteJx9bHvgdQF54uLucSSM0p/fTGPkboR/RNJmD6R EtfDWEEjG9iiFMeWYl3hsP3XE0aCYrG2hL46vpFdfVj89uIl9dkU65lLckQRGFIT9fcF3pA/SsoG xVAooftNjRfj7lJMeIprjrNNLEAE1GIYnnh1qn+0DYtbMecZXTmhx44ejH9NiXVJ4zZPZt5O9I6Y 3TBS+rqE+YRJB4khXTQJu/fEi0/sxOjaiTOSmjvfVtw9gne6HImkHa6V8BSKlMQxQPFw6prDOPqe E3aGAL/UPvPFjeykxXf8FnOKf1tYoLCJU/srPu/UCPGTF85OSShFf6VDLvYRKTgVD3hiTxQvIHBK Har45+uR/UfFWNdXQFr9I9a8YLvV2/eutcjeZ4W1rlfeCanzT94EkY0gLI97Bwn5FW9gPYFRdNy4 sZa3d28UXCaDaRAHQW5xAY6x4HAvGTVS3HYfN4aCgEHwcNEgcu5HhtwTn83fqIauvfZqeS1lKcd2 W+vWrYsimSNuGV17gwb1PT9RuhTK/OiffzTfI5q/9OUvkknP7RcgM3T46O6ROo7rPU2aNLaOUiMB w66SJEDefPNReUxFRCY+LwXUNWtmN954vauX4O79POqZTgrGQFpq36G9fw8pMrjpj8dO98iRIywv L0/Iv7aIYVurJW8qikl85jOfluSkNN0iqunvjW+IEoc6NXQ6DE6sV+zJtM2RvslKbIa0c+h90/Bk eZu2+JmwoRx5lt3CN5yEzOOPlPMNJ45u2oE5xXurfCsjQFT5LckACQQqDIFQ0WxAmzo2qE2hHRvU 13ZtEoZecY0dzd1p1vBuqyP8E7WSh8uvulunbrRo2TpKK+1/p5pOahOpaECscMwUPfBhUic5HORi IqoL1C4gOR0IDpfU8huIvmFkb9Az5CiCA49aTH/oL0kh65SujkuEU/NZ+NU2UroMEHXk4ip1F9x2 TDF6XImawqgROGK649RnR92jE4/0gvGZ78RL6gTiSs0vDipgGQ3uI8NVNsxtJM+ipv4VfBMpOZgP 0sIhh2XEYUXjgpEDx5HG5cSAGOde0hH2iXVL/ZYaJqbajuYWpwRxDqGs39MWscxuaQTE1y98W6kb 4QQrkeKxfHYnXAKATYxSFTNkMR1vCWoJMKM0vqmFLuYGi5cmgnQMBqm+MYV69P5obVK7LuKWY1S4 2J20GJbhC8JzYd6R66oPFghJypbkf6b+rxgSxVMPLFpqLrEt4X1jY8YdvuiWvnvCteJ1K+5QEiGc KI8Y/OZKLppLmukvSL2txDKUmEP8HX64vEW+Fam/07r422ObLALbiU5l0mMmV+yzEcHft2SK4w/L V/KrTyxr5D0X/+YT+yg6n9Eyxr2+/VqJx2J7k+vhe0uAMqxt7GIcgLFvD5/kry0xHeERfzlupJyz SKOBNyT/KcOEte3Szwo6/LfwzhHlE6pfotZLVHQselE22e4OHsxX0iKQUvjKdDDFUkLzMvzpk3b2 IcBJktRVeks/KvG/yzxGZ/+bkhmcZgiEsx0n5SdeGVdYlNaj9KdKTvkEOYxzBWVgueJH4zgnPFfy +ZKos6TDZjRMHEuGgWOOAyXE4Kj/SQShxKekk7YYgU8HRIm/Y/OPqZxODJ3+1tSdNGJYYiplPAJB ys+vKeeaHXHz5AmoOpECR0ARD51Q+fKnGJsDBw64RkRpqGtLB77SZkx/WQThUCmgiU9HH1grx6yu 1EMnAfU079/zafiyzlr6Xg/fVNr1shaeZ+BMFeQGQa5xUPlHiBiMb8SKjnc+wTaZawKBBAInQ6Ck yF8uhIipGiR39nYd+tr2HVJdo8c/fPiQ/elPj8oVclW5A1iTTmb97zwh75T/RNKjWiAQ1APC8kgB KiVqaxQ0sml2QpSrBb7JIAkELi4IfPjD75NjznD/aLcRuGigkpGZtBryeimqRWBXJkJiJiMmfcqH QFDlRHEahfkiAqunWdbm2cTclv940iOBQAKBBAJpEMCJJngHFscRZFowvggjbnGtgIQYlCKjed6U GqQLrDb1WYTui5QrpEb+fsta9poVbV2UMhOVnlsm2fUJBBIIJBA4FQROOAakJAI6EyPQWFXu4zdP GkR6qGx5D9VspHJpNWUrqKBe6mJYFqz6BSovp2julNNJVQyzKXWQhiqsWduyRAQKl75uNbYudBIT mewTYnwx7KvkGxMInE4IZCMJ4Bb6zX/9pvXq3S8WVFUar0uWwFoqg1bXffMTpcTJMCJm4rl3F9jn /uuvVpRVx+EUd3uryGIWh4CJCGQfU87xlVMse+t7nrKsZFBNRUZN+mYCAVRw9evj4nvc6irHFW56 e1X2L6NWt5kNHHWZBxkunDfTDm5ZfsrHiJ1p2KqtNWvRzPbt3GE7lbokaQkEziQEpBqKOEqCsjqr FnHSqg6Bjg2zrHC/vHnqN7MsRUUrxriSg+KznWW1ihSLsfYdK9w4T+OQNVXxEYkgUEmYZvZYbZVw /cAHLlEQY31rWFuxJPl77eGnptvmnUrve4pWr2VX++b3f2qXjhpq+w5ScvCgfe5zn7cN814r9Smi 9r/ytQ9aQf3WdrhRJ5vxxlvWY+ECxcM0spfeeSezySa9EghUEQLFNgLPeaOWnsvn5PHjvr0n7hbX AfCgGXjgKF98WVKD4zGP5D2FXEFgmO4rLlg/QqbliCCMGSFIMuTj88tcJLnouZM9hqO5E15GGEYt 9XWvTL0mBNhFF3w4/xLy0SEHnWoafE++Dn/Rvu1KjqSU2EIilZecoqjnwi3LrGjdDJ+pZ0RPVHJV 3PblP56lOhTdu/dSipQh1qNnB3v1Ly/aHeN22J9eXWo796P3K73d8YGP28fuvta++v8et+2799k1 lw6wr331n+yTH5xtRUfyTnqIvTl2TD+beNlIe+IvU61Zy+b2/m9+y/LXrrVPrF5tb23dmij/yl+u pEcVIVAi+2hmY5WO1qI8QNQUiIZE3RTh+NL7E/3mOT5SBKHUd+swyjyqW9mpIi6nRqk19H5H0yJE WSrYTE50iskU1YhGKa1lKUAuG+yvDsflkllQQzU83Uf/uOVrfrUJ2vKHRbRCPZPyAAWiPp6vaYQk fpUjBUVSCdXct8kKV72dKn4TzSNppx8C48YNUpqTPjZ+/HAv/jFg7BBbtGSNKkctO+XL+yl/VG7d LPv03RPse797yRqoJmzXbu2sVv1Gll8KIWCwY3LAqKn8U+1aN7FRl3W3djo7S2fOtDHaR1N0/+Rq D6f/+5M3XFwQqAQhOBWAjtvmDeuUQ6eVNW7a4JSQPKKItk07tlvbjp2sTshvFHvC8xId3W2vv/yG NWjV3UaNHGjZcO3FfU6kJiiO39IvypZk6xZNtv9++Dl7/+f/wQZ1aRmFXhdLHieQMmMdObDTZsxc YiMum2C1Du6yH/70lzbomrvthlEDRIRURGbJLHt7/nq7/OprrE3TurHkVGV/nqciECE5UaOpEpuK MHERE1s7w2pqXsc970VCBCoByUo9smzZFuW/qmePPPJrT5dCOvND0uU3aNnQbE/ZaVMWKnNujRo3 qSB4ltL/trZ7rxpuDz/xuh1TcafSGkt6+PBR5eVSjdlDR+3TP/+F9dy9x5qrrsbPt21LiEClVi95 qKIQqDZCAIomi+hTP/w3m7S2ln3g/ivFQasyUIqLTmlsvEpXTk4tWzD1RfvD0zPte7/5jd00qn9x pZy4pqjg8C773pf/ye7890fsUrHl1KbKihV/KSrM17VsyqxF303+Fhn5Dm/faE8/+prd+fl/1KHM cnVXkZEnKNuL5pEDKCpOp+ygDRvb9gWT7YH/ecK+89/ft2FdGtrnHvqMdZ30gvVpeti+/eVP2cY6 g0UoJpryl7q+vzz+3qszaE4un0T6pAq0iNjxnTV2LLfCbUuKVWwJGagAGKvY9aAMw2SeXbRoiZIO 3iSPaXHnU5YpXfmp+fNn/vgr+9nwIXbV2BE2akhve3nGMvv+D/6jVLUQU6QK35e//LDqdeyRCqqz vTp7tk3O2+t7el8VvyF5PIFAphCoNkIQvbCGl43Maiid54TLlPAtKheZo/TPxwuO2OH8Q7Z64SJb s+2oDe3fyx57YpV1at8+9aQQoKtxQLQRQi84Jn37sSPWQK6ttONStezatMr+9sIUu1SHs2erRkKY J38q9ZIbKdFbI9UMiAZH/y8rQyrNtvvcwLRrvD078+yWj9xnT770dzZ7+Wa754777aHNKitZs8im vvCU7ajf3/73f39qrXIgJVlSFUWpsE9Xg1Ad93gBeQmtn+1JACPInr53nq5vOZ/HzcvbZ9/+9qOe /nzGjDxP1rV48VpVtTt0ys/av3W5feaj77dBl0xQvYm6Nm/2TDu0Zckpn1m9erN94Qv/pSp3TWRb 2mf+htO4x87ndUnmfnogUM2EQJNUhHLDnCa2edNaW75srfLv17D5c2ZaVrMO1r9rG1s8baot3Fpo d0/sbrnK1Z9TN4pozj962KZMft32yV0P4/BR6U2Pq75w39ETbNuCqfb4jqUq0FzfNi6eY0/+7U3b WZRjn3/wHqmVoAQRNYD7p9VWDYWayu7JQaSRZQ+j8ZK5M2zNzoN2ybhx1jRHn358n/1Yaasb69De fv99ViA1zONb6lrnvn1szltP2/LZS+xSpeBeOPlF+9Yjv7UdzQbZL//9K9YyFxXR6UHMhRBCXE53 rrIaeRuiQLIEL5ye3X+KUSnRunTpBu+xerUM/xVph3bY/NefqMgT3nfHjj0VfiZ5IIFAdUCg+gkB nkBF0o/2GqBaAP1Ug/qIPfKL71ru5X9n/3jtTXbbrcpTpDb3+d/YkQK8LyLkXatOXbtkzFib/NpL lttlqA3upoItqj527wcesKMqTH/0yAF74rf/Y3U6jrJnJn1JKpdCce01bNf2DTb5rXclbYjLz1IV HhmJty+ba3vy1tn//PTnNrBLUyuQNFCr4LA99+SfbebqnfZt2QHuvGyQvfP84/bXWWvs1//8fRvR kXKRFKaHchTKbfC43X7HPdLTF9im5XPtl9v3WdNWRbZREk/zhtQ2xuOpsm6hp1o6KawkORVtXZpE C1THDj8Hx6BS31p5BQVPvfQpUswoKnRUKPfTQynHC+qHl+2tdA5+ZjKl8wgC1U4IIt5cahj5YW/Z sNnzYNeqJQ5aGo7tW1fbtJnzbMCoiZZTizwX8PIRMkWF1KBhE+vepoF9/d//3b7wnf+wUd1b+L26 qglQ88gm+8m//8QmfPbf7c7bpNuvLU8iDdCwUVMbM3acO4weFwKvJUKwMuewHVVWztemT7EP3ftD y82RnUD/XXXTzVIlieOmouTxwzZ5yrt2zfs+bN2bZ4kAvWxHpM9nHjWlWqqtusqrpk2xV5fvsc98 8v32zV/80gaqvrFIBDoltzCclkatggPbVHx6c1TbIGlnHAKUSO3YsaPH1UyZMsVrWscbVfuGDRum 0qgl/fypXdGhQwdJEku9+/Dhw6XuaaESrFO9psWgQYN83DvvvNPuu+8+r8I3YsQIr5AH0n/55Ze9 ZvcXv6jiSiq49Nhjj3mNjj59+sigfNjLnXbp0sVjfqiX/corr3iVvAULFqjuR4bBbmccmskLzwcI VDshcB/+GgUqSXnIFi1+T5x8vu2V3/XB1Uvtvfea2+EDR1Rsfpc1KTb6nkB3IPaeo260Gwa9ZJ// 3Jftr4//0lrVj6a4cu47drRdH3vwo/daPS8SH6lmatVpYK1EPOJt8ZHtlqOC893qZ9nm/QXWs3O7 EvePS+9+VJTp0//608gj5OAea68ylCIj6kfR+nyphl6yPz47ySbe+lFr16WrdRJywJFPtEbxBHp/ 3BGpWldaVoI9G6xmgWwEiUxQrZDNdDAQ7fXXX2/9+/e3lStXeuoVEDp7jr9B+FSuGycV49tvv+3X uTZmzBhnJCAU1MaOKu11s3nz5sm2sN+WLVumutm97fOf/7zOwE5H9rwDYjNx4kQnCFT0+9WvfuVj 8RxxJIwBsmdsbBUQjJtvvtnfPWTIEFUD7OdEYePGjZl+YtIvgUAJCFQ7IXAX+sJsy63f2K67/la9 rNCe+8tv7HC7ZrZ982brPe4mG923gy2cJLuBNnZhqqpONKuoGtldH37I/vPhm+zXf3nbvvKBCbpe YNOmvWODRt9gfdo18niFYlecuEupx4/VsHffmm59L7nO7h5cw3718J9s7M/+yWoWSazGgwe3THkX 4Waa06CRv7Veg+bWo5dqeabm8N9f/4wtOdTGfvfMJOuQcoPdt2uH7TtWJI6tpRF7gGdQSpap1i1V Qwbz45IGouJNictotQI3w8EowTpr1iwvsQonXks+/iB3ED7XLr30UkfiV199tXP/O3ZQFKTIZsvj Z/fu3X4fLp7GPSQDCAN9Zio+AKROYywQfRgXqWDFihWO2CdNmuRFQ0D4jAuxoK1RTe9Ro0bJcL3Y 9qp8LD9IB0gSW7ZsKVGBKsPPTbolEIjSUFdn80jhEimqj8qH+oA1ETc/uPMO+8Y/f9d++MvvuD6e voUg5+Im3xj9Xa9Nbxs7uLU9+9Rz9gURglr5e2z6/A1200OfcwdOkHBpLpwQgb0bZ9lf31hsn/35 t+3awTXtF//3gP30qUvtH+4YJ6+jg5qbuH6pj4hJ2Lh2oS1fvc2Ns5GPJoj3gL348pvWdPQHbPPy Bbbq0DHFhu21n//8J/bemv3209/+1q4d2gftUERYqlNDhMvo0f1mihsI7rbVuTbJWJlBYN26dV7q FKQLlw1hCOoeRgD5wuGD3JEWQPbo8vmhoQrq2bOnI3VUO3D69Ic4cC80uHvqWQ8dOtSJwj55DDVp 0sTH490QIKSI+LubK+kjz8ydO9eHQT3FHCEiSUsgUFkIVDshwJf/uNJVTJnyum1Yv8X99guyGtr+ FQtsTateNnZAa/vxP3/NshVleVihuuTNibeiGnD7ta3vgD729tS1psz7tmf9Ette1NQuH9lFCFLq GaKGUy2oiJwAFR6w//jSt6z9Ze+zW8f3U6Fmsy9/8U774Jc/aR1a/dHuGjtITx2L6nuKE6sttVLj RgoOQkrQHewMpLJo1CAy1uXUrafDKO6/sK596avf9WdbdWiRIkRu4IB6VBb2Jz+Ha+qR/VbjmAyE hKMFl6Hqe0MyUgYQwCgLIi6rvfDCC+WOAhFI9yxLtymAvJ966qkSY0FkQsOYvGRJSddTiBQ/oa1f v77cuSQdEgiUB4HqIwTOUYNTi6yuEq0NHzFKIu5hib617I6771NVxaN2SC551113s3Pf8176g02f 8Vc9cMJYzGSzUgqX+z/3TRt550FDeTP57Wk2aMIN1iG3nn/P9Lefs+37Giva9xKrK4SOeA3X/l9f /7ItOtzEfvqLr1iDLOUp0nsm3vUZ+1dFiX701ptszb//yD774F2WIy7+uNIGtGzT2X9KtmPWonl9 a9Sxh4x7g0uFH+osslNWf9OY+QckFZH3KSrgfnqcVKt/5smIJSFwutyLEzgnEDgdEKgWQhDXkkjZ Y5s3LrZFS5UoTbEAnq46Ffkb2XelZ1XGxTUbNtqho7iaItIqlcPyJfbOrDme9Q3+PFvEpJaQ+ZrF c23ugi1Wt11De/Lxx+2oXCtffvZJ27SvodRN7W1E70a25L337LEnH7eiun3s57990Nrk1nKDbw1J Dsdr1LGPfv1bVqiQ/6//49/Zq88+b9/65pdt5ODeIk5ST3lEGj/HbcOaxbZm5WJbsGSrjRnv8cFW VHBMfUqC6dRp56q4TMeRWFJBZAkVqCIwk8cTCCQQyAQC1UIIeJECcaXKkBpIRrR6devIne2oCAHI +GRfe8+oKQTdo19HawB7rtayTVu7/IomJfpjksU958obr5e6pMAOCXGjlL/15rul6j8mmlHXdm9e btPmLrSJtz9oV40c7Fx0wfGjrrqHKHkEcY369rEvf89GjL/RVmzaaQ3qUSdA3HYxUx+JM4WKa3j1 +Wdtw+H6Nm5kdxEpXU9FI2cCzOrok+D+6oBiMkYCgQQCFYFAtRCCiKfGA6im3fv3X7MHW3Wxls1P nXRuzJgRdufHlbShDvEAZjnK+VNXP6dq6XdRnLTq2Nc+8bH+0WN48+AR5Abh6JITA9kEjksyGTx6 vA1OvQDPI4zLJ1oN69xzmH3rP39lX/q349aggWIfsAjHkx9VBLKV7StVGh5NUYqmSCpJWgKBBAIJ BE4nBKqFEDgOxj4gBNa134AIJ5eTgqGGkDXJ56ACkcaocvrwGimOPdRDODn1NSkbIrpQck4nu/tw v0bNOtYwRcNOSAyncwniYwsGtVQCVKooIpoj36iEFJwp6J+P78GziDiD4IZa3d8QpZeXilbG84yD 1kjjXjuV56taJqQzcAQjeoZnIUuR/7XqV8ubMx5Ebt+mUrIZt1qyd6qCYfW1CsIo7cXVRgjCuOUR gIr2KxdQlSQgZY2b6fzLnVdlOuCnXqe+FWWLGCgPUqwqTmVGS565gCFA9PNHPvIRu+mmmzw6mbiG 07F3IxfvQpszZ47hLUWwG/EKpbba4qCa9TJr3EnpAAjArK4mJKdoe1PaGNulehCkZy+t5TSO3t+o o1QM+j1TwlHlaYphkzraDmyN5peHJ1cZRKthG7Pmvc0atBWxwvklQ+JW7hw1zn69f2+AUVRoLNNW TAjgLGinrBiW6agXeb9atZU9VPYS3FEr1CBqOeJkcnIVT7BPUhZxDRUaIel8EUBg9OjR9n//93/W V0VwzlTjnfw88MAD9qlPfcoD3ko0kG+n8WZ18PMDv1VzOR2IC+9oLkS/9k2zQztLvh8C0GG0JBGd H7QRJQJVzwCUauq9zXqaNekif/fVmuPkiDiEhq2U+bVQoCGSAPCp7sSVvBs4AaM1gpHS+GfaRAgi Pfl2FYkhQvHULcJKRamC7Elq5JOhReW17Tt2ynh+XPYKlDsVIQgkzlNVstzWVriXdAEJFch0I18s /QhKe+KJJ6xduyhtiqszY6nR479zvzTGLjwTno/3KxGXEwNqeKZr1672pz/9SW7g19n06dOjHg3E 5Xa9UpmHJcm66/NpaEpA6biqQWu96yqzFYrlOJqKuWjSNSJCWWJm5XV31poCBF0PDVGCCVz9ygmC 1OESs9aDvGBVmRIN34jdsrJ2SZeUgFFqPVa+KBhlVtUiO4S5/5MKwCxavMx1jWW1mlCwOg2tqJEW w1sFOd6ztkJn9sVFMi4U5TRVALMof4UXVe62TUXVtygNgWdnTVoCgdRp09n80pe+5EQgrgY6qsCz OimJHjVO/AzPVAqMXQpS41odFYUaLSmitvruVhTzYQXOtVOkMu2Ift+kiOZuKQKzQQnx1qleciup oJopYV5T/YR3Ev381a9+1e66605lRJVuvO1QqTmU8j0gYfCEqq6ZvAeL97+77+GFF0N0Hp4f88xz Tj7CZcXpVUo8o5sgu3pSO7WSLXK9SrjKucLaDouIAHp6mr9f/XiXpHP/l0b0tRsMw9+8Tz9KWR89 F+sTngnX4vP2eabmzf1DSvhXR++RW7xfBw4Qp0Y6x3lrhJhbikuXJAARCJIKSF952OQjr5/IuaWO ypoePapnGSM+x8rAqL7WtaWcaDaUTIxY1lkqVg0RHk9elXJbkfRaLUVxfIFORxrmcmdw7ndg09Rr VClC4EFkDVtZDTb7vm1JSNm5v9pnbIbdu3e3W2+9tfh9noROyO2HylI6TCktxNWppnK29VXW1Po5 ObZHaS0eUYK6o6n01cfEsfbt1MlmiDgskvF3l4jB7ePH21ClxX530SJ77t137e80fuMGDew3L73k fXKVTG+kEuU9IAmA8QMxuPbaa23QgAE28z3ppBtK3y3nhoCEawv53n7NSHvmrflKPhlF7ptcv2vK Q7AQwgHCVMsWEiwAIapKW7gGNqbSIdI0zZGjSngqB8eJIH4QatPuZptnRrr2ukJ6MSIAc3vLDZcI v2bZy9OW2J69B4ggtVo5te2Yglod4XNG9QNRzGd8ELJuZGvupKB3ogFTrLkVz5s58LBwX315FR6i xKgSYN5zx3h7bdYy27ojL4XAU9QMNVDeWs1VEgIG7DBHjd2iWa5dM6afrdqww2YsXKPpFdm/PHiD PfrSTDHkekZzdRgpy3LBMaQI/fj7aYKRfidDAt9VU33icPUuwKhZD7Otc5UQoXy8XkwIAF4mrUZ9 6a/b9JLqIz1hXCZPXxx98H8q0mYucolA/6uAhqeIDSgiUNSiuwrXy/iTtAQCKQhceeWVntsoLg2Q E6mJEDfI/ZBSUYPUZyo/0bY9e+waJburq2R59fSzVKkokBr4GyRbV4SivghEjqQE/t4rRnCa0llc obxHo5AaRFBaSxoAKXI//k5+r63nrlOG1plr/6YNLjQSswnUEWL6gBDxi1MX2uGUuuOu60ba+KE9 7Z35K+1Pz09zhDl+RC+7enQ/+9+/TLFVKzbaTdeMsJvGDbRnJi+w51+ZZR+77wpr26KxLV2zxR57 WUg/ck2MuGrUUHDcqIriTXNr3TzX3/8PP1ZxIAiKkPngfl3sRo29Z/9B++VTk5V3rMi++hHFJ2m8 KXNW2Juaa/9+nf257XtEQJ+bZju277FrVbfk+ksH2MKVm/y5WrWy7TP3TrRVG3fac1MWWANJPV/8 4NWWL0L3xCvMUZPxOQoR1xOBYn6oauI2C83nkoFd7TP3TLRfPzPV5i5dJ3NCgXVu29weuGm0vaEE nc+/Od/HmTi8r10xorf9z5Nv2VpVsrv1ulF23Zj+9te35tlLr82xW68d6fdniHj8/llx/16EK8BI UlpDVYDcvaLcM1Qhr6FIYiOffz1tDiE6GUSTdjIEokMT6W4r3ND3iojUbN3PbJPUQ0cy0/FV+D3J A+cdBIJdID5xJAK4/PGqS/Bn1StoKA6+n36WKB/RJULof3z1VWuvFNq9VAdhkYrhoBKiMuBkJczr qmR4EAckh23KmvphcfnLNmywYb162SeU9fTHskV0UyrtOyQ1xKWB8P72qr0Qeb6k4+IiVSbMsrYt GzsHfkgqkNsmDHH1E0QCRNW8aa7de/UIG9Szg81ftsFWiSse2quT7VOt6HfEXcP9jhLyXrVpu91+ +VB7UkiPJH0nxAJ0KSphW8r7mY2nHtM5dO5eiHfs4O7WulkjG9W/s7juGbZf7xkjZPzue6vtlgmD 7c3X51rHVk1F/HKtbfPG9m6HVbZDwafXX9pf6rFcW1xzs0sQ9SSh3DRukH38u38Q033cDkiaWLtp l63ZvCOlLoqdeaQAjNeozeL2Pn3bHFW/Q1r5yC1j7S9vzJVr7j73ztq2e5/doe99/rW51qp1U7vn ymGCUXubuWiNrV2y3ob36eTEbNrs5Q6jm8cPkseY8qaJcONKX9L+jGrs1PFcYeUqQQiI1k3p9qrb 6n3eHc2yJ+xE07kAlD0VIAioB9GDSsdX1Haw1Vw9OWKEkMAS4/EFtEMq/inpFc04hyDywZICcFK4 SsVyagkhvLNwod1/1VVWX4kTbxk71nqqLjiSwFwlwgNhoPP/sgrj5OhZmJVVSg/fRtz/zUqfDYHY KFsBqqYPXXONtZQE0kDjlOaa6vNJ987ReEel/kEtNKRXR1VhK7CV4uh//uSb1rJpQ5stZAaWPnw0 394UMpu/YpO9J24bVcgbs5faQen29+RJlSOC8bS43p15+235+u3R+9MZK96d/n4hw+2799ufJs2y Ef062Zuzltt+cfHPintHlfL6rCW2d98hR5qPSDJZv3W3NVSmAd6/fP02e0IEJ0sIf8O2Pa4u+u2z 71r3Di2dawfLQkB+8dRb1qdLa1u7eacdk07/5+LWm+aqeBbqmjhODN5LJ82xhr7ziL0hgrdw9Sbb e0CqG73zacFso967bJ1Ko8pucVBqtTc0/3nLN9ri1XLZVdzVqzOWqv8hy9urTMqa3y//OsXatWxi c5asKxtGGWy1ChGCSOpBT4j4kUgDZcE3QvsVJACxwQoRp7URarYbYDV2rrAa+7ZYIfasBOQZbOmL qwtGYHT6IMoWQtq0y6XegUBw7RYh99A6q+gNrbWK6sRbLzj7VBuvKmo0nkUaCL9XBKrHpNP+70fk XhoMtULEb89QFtWgfgbJSb/+qNQiziOhi5eKZfJ09QHZY3hVe+612ZGqA3Vp6lom84D4PIaaxPX+ avp33Ybt9vNHX424dqQSjfnnv6kPtgIQmwjBynXbbKXUL96wY2jecxastjmSVnxemjfE5PHn9Bzf lrr2ymSpcXhXpulo9ByI/PXpi6W/l8TiUlINe+oFeWExBoRD4x9QEa8/PiODODACdpJG3py2qASM ps2W9MQzqblkAp/S+pQwFpc3CPA6vleqCk2wQorv8gZO7qdBAEjnC/lLtGw5REZjcQPuYZG0ixkC ZUX2Bm49/IvevxiBo99PAc1Vx6UAsKzr5QWoUadB5Qfluy6OtihlLA7j+xbWtbgwXCQJIl04Djp1 vIxO1TDyxht2Cd5dIFtBdinvpy8eOCXer2v8nT6W903z0OPZ+Lekz1s6/RJjp7+LmxiHwZeNVaeC JUnXoITFKHU+qfcXL94p3GIDDNPhR+zCvsyinVWfJTIE4QVwRB9X3uLXbCgf9/Zy13ILaAVUHhfz Ca7ot7sYzP8QA8TRbRpkNfK2KnleAu+KgvJC6c+5JKArk1bCsBt7oCxWorIsBvWSH/jE+yJ35zOu ttRZyOsS6cDrUdu8sl+RCUQr2QdJZpeC4JrIwyk7Is5nspH5uXBnJ3vxsYdt61ZFZp+iZZPymI3z iU98wvoPGHwm55m8K2MI3JFxz6TjhQ2B8hi1M/X1zGPixMv9J2nnNgQuXzClfEIQPiHdEHVuf1oy uwQCCQQSCCQQKA8CMPqZlDEtthGk6xnLe0FyP4FAAoGLGwLninRyca9C2V8fJQxUCn53uz25xQlE hbyGEoAnEEggkEAggcD5BYGy0gbF45wSQnB+rWky2wQCCQQSCGQEASQ2iMB//Md/2K5du0oEuHKv Y4c2tmv3UVcdJYQgI5AmnRIIJBBIIHD+QQCuf+TIkWVO/PXXle5DLSEE59/aJjNOIJBAIIFAxhAo 3Zaj4sI1CoqlhIQQZAzOpGMCgQQCCQQuTAhkRAjSi10EUKQnVYtTnsreywTMYex0SldWEY7S5lsa lSxr3EzmlPRJIJBAIIHA+QqBjAgBH1caMdiu4hU5SmebqyRW5bX483tVKIPw9JYtVbChjLFLGy8g akLtSb9bX1kWyyJSpT1PrMRuZVls1Ur5/lNRuukEYZ+yMzZQ7pZKZQ4tDwjJ/QQCpxkC5/K+PRXz dZrBUqnhM2E0KzXwaXqoKu68pyQEoXD1T37yExuqRFbjlY6Wxgu596pS3D7zzDNG+bw2Smn70Y9+ 1Ito037729/arFmzvB/XPvCBD/gYNAph/+d//qdR9g6iQBHucePGFY9dFpxA/tRN4L3vvfeefeUr X1F2w2M+Pv8yT5A8xGm/Uuty7WMf+5g/Q8OCfuedd9oHP/hBG6CiGuR2762iG+F7Xlca3+9///te io/i4FUB7Gla62TYBAKnhAD7HiarNILAtXheoUz2d3FWE2VwKE57k8p0QiaUmqGSlyOGKPWzP5PK QOMJOFP4gspm8XlxPS8vL6OAp+pcduYX0v44TELmltT88aKhhntptR/AV6HFx4nPr6zrpX1DJoxs fDyyzIbMPgG2zLeuMsTCwGaypqXNo1yJAOT55JNP2mOqgnTvvfc6Yq2nfOYgZZA/G+/ZZ5+1HkqF +773vc8aNlQpS81wmFLicp82e/Zs26A85xCCKDR9YnFaC4IdyLM+depU+/SnP13mxwCwhx9+2EaN GuXv5r38+8///M/2jW98w4MmXnnlFfvZz35mLZR/feXKlfbd737XiROA+n//7/+prF6+P/e1r33N idrf//3f+/wCwcPNisU/l7mq6jwQyVgXFgQ4W0jpofysVyxTVkyCio4qIye5+bN0nkmzDJ7mejZZ bvX3MRVWKQ2JBEQfkE4dZeTkGriTqlqHlWwtK0tZscgSypjqWFuZO7M07hElU6MPefu3bdvm55+C NuE9nNnNSoENzmBMngtYjvnyd4HO7nGvV0zyz5pe54CWr7MPUgQ/5asvjb8dT6YwO89lqz/P0Idq aDnK9MkzIcfaIebvz9Xw+8ybSo0QqLi3Dfep4gh86zeQJoL/yCuXlgzS4ZUiKMCK8WjHVBOBd3pd B/1HhlZgRf/4GNRr4Dv4/iKNXVdZV0PSYeZHim/qD/AMP1n6tj3SctRRmvFeqiNR2VYmIQjA3LJl i3PczZS6lhfBbdMeffRR+/Wvf2133323c88g0W9/+9v2gx/8wIEKx80P7RrlNQ9tnQpm/PCHP3TE vUdVlBiXMdsrZ3p5VdJWr17tBIf58AMhWKjc64zFO+E4WivVLqoq/g1EiYVn/LfeesvftUP51q9S vvaxytUeuJU333zTXlJ5voEDB9ptt91m/J0Jta4s4JPnEgicDghwLtj/IJzVype/csNOVSOrZaMH dLGtu/bZmzNXKJtxLaWizlWxlq62afteL3fZskkDR5I8R4NQcDZmL10vpHvcmjdqoOI2LW3yvJUa d5cqUxZaRxVOWa/8+ZtVonG/CrS0bdHIPnbLaOXMX2679x9SyczWNrR3e69JgEq2tMZ5bKpzu0vl JN9dvMkRfz2lhB6iYizvKQd/lzZNrU3zJo68N27Ps3m6xrns10U+8PsPe9Gb3p1bOcKkqA0I/+CR Y8788Y0bd+xVvQMKunS0Ns0a2ywVhJmxaJ21aZGres2NNLdCVfda50RraK8OqvbV04kVDGNpDSa4 qZjF7XsO2Iate2xY745C6BGqhnBBWOYs22j9u7YR7DZoLvlOYHp0aKGiNw1tsdaDfsCSKmkLV222 MVobYAzseYZ1Gje4mxOwqUqDTX2CDq0aq3BOkwgGyzc5jHiOQjvHxOCCC6vSSiUEABru+d/+7d9s mcre8QOyhygQmADHffXVV9stt9xijRo18ve/+OKLTt1pPPsv//IvTqW++c1vlphfcxXLfuCBB5wI vPHGG65CuuSSS6LNJ8DwQWzm0rgTFoiFCKHRbCJEokC0oORQbO7zL/OgMR7Xlqqc34c+9CG7//77 naDQeBbq/53vfMe+/vWvOzGCYKC6glj079+/0uJWVRYmeTaBQGUhwF7PF7e4dstue+ndxdatQ3Pr JCQCAu8n5HxYSA9keImQyGYhyqnzV6uC2EBVN8ux1arK5edCnOqArm1V0H6vkPwRz4N78HCu/eSx N1WQZbcj3H5CdsN6d1C1rfWOfPcdPGzT3lurQi2Tlak+364a2cv6dmlVXDu+tO/hnEOI4HJbN2vo XUB+3do2U4r/mqqrfMi5aorNIH1QMAbphGIyrYRYKSxz/HhzFbzZ4ohznb65du0s25V30Eb0VX1m fec6PYPkU7tvRy+Ms0Zw2KgylBtFKHoIIT+p6mR79h22Rvr+Gy7te8ra7UGSACbM5dKBXUSMjouD P24rVH94yrxVNmFoD5VPyHLk/dQb8y1PBKt7+2b21JvzrK5UThALkP14IfvXZqiegBqEigI901X7 IEdEbfrCtTagWxubMneVw2eZaiVcKSK1TXB45IUZ/v2DerR1qaSy6qD4epQpEcA1//KXv/T01KhL JkyY4PYACMEXv/hF57hBoOjqQeaof37/+9/72KiB0LX/0z/9k61atcqR8ttvv2033nij2xNQG8HJ g7gnT55sHVQYo62KYPBBP//5z23EiBGecjf9AzESv/DCC478N27c6Lr8wGmAwLk+ZcoUlwwgSnBG IbwauwLfdMcdd7iIt3z58mKig2QDkeD7IAbc+7//+79im0hlD2TyXAKBswUB1A4gtubi9NuK86UN 6N7WEcmufQft1ssGunqieeP6QqA1HdkUiCvdK66ahvrokHL0o15pXL+uOP88L37y8VvH2Pd+pwIv +h2E1ULj9+zYyquIwbEeUOWtIyIS9aQWARGjHsmnktkpGuec2r8Du7dzhA0HDLIfP6S7bRPCfFHE DM4bjnmHOPFczQfppb1KYXaWxAAhg0O/elRva5Jbz6t81a8TpX1GYrlUJSkXCMn26tjCaw1v2bnX ufR7rhwqSeSgpKGGThQHCj6osjJpqMZQ4cD9L1mz1YaLyFCIHnVNW9VMRuXTrV1zJ263CdZdVIe4 kQre9+zUyl56Z7E/yxpBzBau2qLvqeXfxncPEhwghu0kYW2StAUhadywro3WHJ/Xs0heV4/q5d+f rprKZO6l9SmVELAw6PdffvllV5FgYL3hhhtcBQPyDuoUjMG/+MUv3OiLRABC5x7eQHDYM2fOdMSK mIUUceuttxYjdzjtJ1QT9cc//rFz+Z/85CedG2cMpIinnnrKvYLixIBnGAdCQYMIXKoKTCB7pIP/ /d//LZYQ4IogHEEfiIQCkfnUpz7lRmTsEpdddpm/k6LgY8aMcVXS5z//eTcgc6+var5WB7Wt7OIk zyUQqAwEkHJrC7lfJs70gEo/wn22EfKA+18hhA332UUc9xZdX7R6qzWV2geOvodKMrYXMqfBaW7Z qedEROA+4VB7CYlRU7dxw3quikHVAfKm1i+Ir2G9HKmCOtrtEwc7UgSpw6UfO4XagrnC8YPwpy5Y 44Rnn7htiMwk1fRl7tTs7S7VCoiyiUpC3nBpPyHBRrZk7TYv49hIhOHKkb3dToFEADIfM0AqE42F 6oQx/dtU0pEfxt4piWHX3kNOXG4Y288aihAVpGwpJQzgaQvg2gf91MupYxukpjkq4tlHcGHcNqqJ jJoJUsJc5mpuqIRQXaF6aiMJ5Jm3FthSzftjt4yRFHHMmjSqb7eMG+Aqrq4iFjVlb4GoUU+5eeMG utZcdaYPOdHeIiLeWMTk/uuGW329H1VYtFZVr1NyShtBXM/vXIKAFizTIEgQKJJC8BQKMAOhYpCF cAT9PVZ4WhyxYoz585//XHydezfddJP169fPEXu8L79j+I03iNW3vvWtYsNPuhtr3DDVUcW7v/e9 77m6CMDF54NdIMytc+fOTpTS51qZA5k8k0DgTEOA88Ye56zuFPIZIR39fnHpFJFv3KCOXSNOEuS8 VwXQG8p2cPPYvsWG3f0HVcs3hlTqZNewgd1a+/nq1GqQE5c6+vnU7WOcQz0kIjO4Rxvbp4qFA7q2 cgSMsfPWcf38GQzVB8U4YiMoS4cNU3ZUkkf9Otk2pn8nN6TWEzePAZr5DZA6pGH9OnrXER/rimHd rEn92ir8ddCN0IO7t3Giho6dOsiM07V9cxlV8527vkx2EGoCI5kcP15gV4/s4d/LXPeK0+7StqmN 7NvBiRWqp+P6l/mUNl++CdgekVdWI83hvquGOGKm8T7asF7twHLep1luXdUybib4qEKZGhJXc137 8A1iZItk11S/UX06+LPYwDFATxzSTcXpD1muiCr2hRtG93YCu1dqN+Y0ZkAnayJCvEdzZ6l4NqjA q7LXyjUWlzZ4fLOkE4H4PTZjugG4LOoVrjNeTxXOrkg7FUVMvwdxiLf4/fS+1UFpK/IdSd8EAlWB QPB+w5YXVKJcQw1xcO+eMmNnynqn85kpZhMkFbxcerWRpA66k6SwYtVaHzd4y+wTssS7ByR16LCK vecVun0O6T6cvXCuYMZAYps2bfL+wfPo6MGoamLTelm2e9d227kjUteAwPmWdRtU/lENGwITXL12 ffEnNM7Jsm1bt5ZgInkmGL8biCC4Z6sQb8Mm2XZof54d3Len+Dv35+HRc8xtov75ccIomyfaDVTL Ph99Z94ueVvFABh3MGG+Ww/tK54LQzWtm2Xbt6naoAgRoKXP5gN5JZYAWO7eGbnoN1H/ouOHrHm9 CP4H9u62fXm7HQ4QTf0qGB51TUp8vhXVZJSpGtoqYHpN0qQlEEggcN5AAMYLifxMtezadTJ6FQwe HoPpCAoNw6kKp0R6hJIt/ZXpM6hVgaqQWaW9ACIjIrV27dqT3o1zTEWRbPog6a/MDIIiGsyrFHg0 kDsruDrMF0/M4DGZ0eKoU5kSgVvzU26ZmQ6W9EsgkEDg7EOgPDfsszFD8ElpCD+yEUQuq+dSK6uY S1m5/c/23MN8g1dTRedTpvsoXjxJSyCQQCCBQAKB8w8CFZVaTikRXEw68ooC7vzbGsmMEwgkEEgg UDoETmks3iz30L1r1ii4JAqTvtAayL+WjFidL7/csmUISojBhbbCyfckEEggkAkESicEKUv5fPnd L//Nb4oNCW55T42aThoIso5f42+s4sHDlb9TeahKXI9PMox/psgO76vbqZO1nTvXCUFZ7WKSjDLZ NEmfykGgLEYj2V+Vg2fyVEkIVIWRPWXSOVyU6BA6gTgbdOhoRxWhe+yI/Fhj86ijaN58pY0IBABO u+CgfH1TBCKndZSArqas8UfkPlWAP3/q+UBc8CyokV3Lx6ZVPUzi1FuF9+ICdiL9YOn9cSerCpCT DXthQYB9GoyG7Av8u8P+iMeo8NUhlob+ZRlFQ58LC0rJ11QWAuyVuFs++ytuaE93ywc/0bheWabi 1Gmo8QdOIeQiEYUOd99nddu0tZpK5bD+kV/bUWUU9AmQNO7+D9ua//mZ1a6vVKhHj1jPr37D1v3f /9jh7dusUIEg9bt1t66f+XvbPukl2/TUY1a7Xn07fiDKIJojl6xjIhrNLptojQYMthU/+0+rRYZT 1QY43a08tRcLQMqJEIgW+UxHhzp4QpTlYYALGs8HpMG3Bi8JngmJ80KfcC8Es3Cda/HFraxXwOmG 48UyPmuKn/769ZHvOmnPCUIMa8a+YL+QfgVndaLT6ysgiLQnJD5MZyhY2507d7ovfdgn6UQjTmji cE7fG9w7lSvmxbJG5/N3sn9A7OR3I4sDsRck+yR9DvuA/Ucq7CVLlggvZFlTuYr26N5N637c+8WD aCsCh3LTUIfBsqQ6aXPTrTbnI/dbt8983lpdc71l5zYSMVDwhiIHs8jKN3qsNR833g6uXWO1NcH2 7/+g7Xp7su1483XbPnWKtb/3fbbtpeetXqfO1vb2u+yYJAjut7rhZivYv8+ObNxgdXWo+n79m5I6 ttumJ/5sR0RITrdkUB7AWICAxAN1Jm8R0c8k1sMXmsPL7/zLYWQRybkEouB3Di2RzxAUFhLEQGpe Alfozw9jHzhwwHM70RgPYkEASxiXfueiu115MLwQ7gN3cmttUp6r0aMv8bUhzQoxN+TPopGWpZYc 2Wsrd8zWrdPsnbeftzvufLA4QKk0OMAUsPYhHQq/HxRjhG8472SPcI9DDiKAmIAsSKESuEH2V3o0 fjrR4Fn6MW/G5tnKcpAXwnqea9/AWrCmr732mvXr28d69+xhW7S3Jk2a5ClvwB/EYsyYMUPMR1fb k6ffpz9hy7tNUE64ExmeK/NdGRMC536PKYS7S1fLoubArh2W23+gHW3ewvJ37fTrNbVp83fvsu1v vGatrr3BWgvBb/rzH902oIhxqynEWVObudmYcVYgaSC3/wDLqptjhUKODXv1sUIBwbkcRf/lKq/Q tkmqfCZCcLZb4Lw4lHBuLEw4QHB5N998syNr8jKRlI+Dy8LBGZK4j3/Jp0QBHg44ifPoA1IhRTd1 HEi+BxfANeo1kPaCaMz58+c7cYCokGeJnE/kSUo4vzO7K1hv1njFihU2cvQ4TzTGmejWe6Atmj9T ea92icDv8zQBoy8draSH79olnbJtyqEl9sqkJ61f/75lTjjsL5A9iADiAkEh+y3FkkjeCJIHCbAf WHtybPEvRZ5oEA/StJNdN72oEvMk2y97i3fBiCCpIMmUJc2eWegmbwMC4BfWvoPS4eTXqKtMqWsl CeRo7wzQ2i0Q8zHGk3tefsWVduDQduvausBGKAD6dy/80Xr07OWpeSrbMiYEheIg1v3ql9b2znus VqPGtnvq25bdMNdyWrW2g6tXuUJ/97R3rcXlV1rLCZdb3pxZtmvKW9awTz/bv3KFW4oPCNEVKufJ LkkHbe+42/bOn2c7p7xpbW65w/YvWWQHli91D6Wju3da0xFKTa2Nfq41Dg5FbyhpSQORc4ApzkPi Pag2C4oUADIHuT/33HN+HXEOZE4EYDisIHskCg7q9OnTnZBA8cm+SnQgRAPJgH4cdLKnJlzcmd8V AYG2aNHcOnfvrdQBK1xSbdq6nfU7dsiJwBp52I28ZIy98/JvrGfLLXawcJfy89SzNk3b6X6eWYf2 GU0ctdKiRYtceiRHFnuFPQNTwX4ibfu7777rCR1hOGgQEOppQKyQNIMUCrFAwiQRJGNx7w9/+IM/ m+yjjJbjjHWCYOcJD4y7bIIt33LQ6mQpKZ6Y4mH9O9rTf1nnuKG+cEX+4QO2ftavbGR3pfjQnhsy 6FLbqXtVWc9TEoIiVCIxMGyRGmenfuD8Sfi0Z8XyEmob0Paud96Oqh+lfnhBQOdLfvg9H61wyybb u3CBHdfv/OxdMN//da+i119176P1f3602PB8ulbC51mBNBoAOlRVQk+MNADyB0mDxOGy+IF7I802 ul/6cQ2xnHwgIHlSaIP8yaY6Vx5LJO6DsEAsyGWCBAD3ByFBjEcN1UneTaTzTtrZgwAE/sCBg8ot 39R6dhjlEkHN7Nr22MKZItY5rrrZJ257y3qt+8wZVlC/nt384f+0mfNXem6YTBrrzZ6BMViwYIHv E+p2sC/Yf4MHD7ZPfOITLiVwjcSLwW4Ew0Af1D4QBn732gQiKOxRmJDHH3/c+5MxOHGAyGRFzlwf 1guclC9nmVsnDnENTE3th02bt7oaDxyC5LdL0ufKWats8aydNviy91unntfb5k3rq7SepwwoqyNP n7Yy4AYLtnv3iACwgSIjK5tbV9nkpPqjBFw8LUXqejDIFsHhp2ISQj/u8buPEcbhPYyHFfw0rgMG 8EJ0rrw/g+YZFXXYKZdJ/QIQORwa6bZB9tQ8QK1DCm2K9ixevNg5O7gxnoPTQ5rAPgAx6NZNmQZ1 4ANRQP3D3126dHEuEA7gwQcf9GpwcIQQlnDAM5hu0qUaIQBCJYcLB/LFl1524s3BXTBzjktqrHuz Zk3tVZVL7dBf+txR11j7Tt2UUllcXc2iYrtPeVNifNKgU7cD+xLIm3TtH//4x30PoBJCjciegilB CijOiinkD7IIJWHDu7iPShPpEuYFgkHhpX/8x38stkuUN6/k/pmBAAk3YS45/6xxnlTwf/vb35zg s//qS8W8YeMW633dF7SnGlr33gPs5Ukv2Ijhw53oV9Z+WCYhKCxQ2trhI+Xp80XLFjfhiPkCa9gr Nr74XMZSAYAGeX/4wx92EZzFArlzIOG4qIMMooYowLmF2gnuFiukgZ2A6xxKrsGpQeHxCCAlN5LA uHHjPL039znUcHdIBCS7wlOlLA+SC2xpzsnP4ZChlpk2bZpz66gEWQ8QL1IgPwMkxWE8zs5pICZh qfbJQWccMrHpgLDZI1dccYVz7OwfnkOdAwKnpgZ7DvvBXXfd5cgBJiLim4ps0KBB/jdqoXhj3kgZ 7NF77rnH54ydiz0cnj8nAX6RTQo8AhMITqHYF3iBtWQf4BEEkwD+cFuP1rSgqKZNEv4CJ1H5sSoS Xvk2ggxF2tO1ZpGgIJEJgSMl6vIuSul5KlZdp7pSZVsm5C3usgmiR3cPYuZAQbXDAqCLZTFZLBaQ RQ1upsyPe+hpObDxFvS51GIAuYD8Q2Edvh1jNNf5oW9V65NWFlYX+3OsH9IcVfuQzoKUAMEO3jtw dCBtJLvmzZr4IeZeeYQg7DHeQd+4S2r37t2daUBSYO0/8IEP+F5i3HgNDjhG+qUjBJ5hT8JshGJN SKz8Xt68LvY1P9Pfz3pQeIt9hOoPxoA9x1qz5vyN/RDmkGvYiLgW9l9l53tqQiAs62oTTQ5uJ2wa N0roHkipjtzkyKldpPza+R74EOXZRs1DhaJjKsZQWmMMCmS4K1ysD88Q5AVyz1dVHnJz71clHuqp 7lXlIioj5ahwxZHDR732KmPU1d+VoYbh28oDXvDqCMaYeABQHCkHD4xQxY3FSV+g4IYaD0AKHF0o MJF+LxzuiCBGecqTdnYgEDLyguBpwe03rAnrjeoFbj0Q/0zWLD0mIF5sJPwe0sLzzrBH4og89Ctt fwTGIhCcMFayl87OPjrVW4NNJxQBi7sIh7VHAgh4g/tVzYparkQQjE8vPfc3IXvZB1JJJlq0bG2j x4y191ZsVI3RrV5zc2ifTl7/s5Ys3UdU5WexrvdWsWzsAHHUBZI/ompAy3W/tvp2UHk8j6aTuLNH lZN27tlvLZs2EsLPtgUan/qiazaJAopg3HXlCHtl2iLboZJ5VPJpqlJvN4yVSKxScxRuqO7G98P1 J5xTdUP24hkP5HsqFQwSJtl+E6R88eyJ6v7SoDGoDEPMXMolBHD2B+Xzv3zRPPvCP/yDdNdZNnfe PHvl9TdtrILHFq/Z7IWkW6keJ8SAwtBT562wDq2begUhcPOmbbtLFFluLiMHNTxnLFytknf1rZ2K MNfVGAtVYPq1GUts/6HDkgqy7H3XjvJC1HD8k2cvsyF9OquY8x57dfoia96oocq0HfPyb5Soo65q iVJB1QhpRK/KArgap5EMdZ5CIDgZlDV9VEvo7xNCcJ4u8Dkw7XSJsqJTKp8QaESQ8q5dS23O3Let e/chMpY9J+6dR1Nl8KSm2ae6oHDsXdu1sL++Ptv+8tos+99/ecCvLVq12ZG2T1ZPjezf1WubogKC iOQrMvnI0QJbuWG79VcxbApU71eNznVbdrl6ifqlEJY8SQu79x60Hh1bqRB0Y5u7dJ0kh1zVBa1/ WqSBAMy4KF5RACf9EwjEbUylQcODNVPpRBJoJRCoDASqykRkRAjQ+nfp0lJuks/Jde1VGS+OWKOm vXzzoozp3La5tW/Z1JE73HojFXQeM6iHvSP/6evGDrRrx/Q/we2k1DczF6+1Tm2a2XpJCz977DW7 5bKhcrHMtiWrN9tdV42w+VIPNVKR5r1bD9uMRQqa6NXRbRFIBx1bN5P66IAXpd6g5yEy9XKURvp0 iQSxlcH4y3fj1RPygnCQ+T14AqFHxl0UcS0YCtEbx/WzcIH0D/pjbAc8F9y/QtoJxnB7ivoHAyH2 miAKMrVgQOad4bkgwYR8RvHNFb4hbotgfugmgwosPn4YM3wzYwWXRX4PfYO9hLnyjjBntyVpfGDB 3PkOdNTcD8+Gb+Nbw7UAv4AoGTNukwnfy7P0iSeCC31DAq8wVoBxgHucyIfnEzVgZVBR8sz5DIGM CAG2yekz1tltt95gbdu1snemTrcNmzf7dw/u2cFWrFck45Fj1k/cPAf5Xql0mjZqYNulx/fsnnEE XUNh9FLlYFQeO7Sn/eKJN2xEvy7+03xTA2vXvLGrjXaIEPTu0sbVS01y67lROhWqYK2lhjomQ/LI /l3cfuA5Ws7AKvBtBHXhMRR8/gkSQ3WEix9uocQW8Deh/yBAvD/oT+AYSAwjI66BmwU/4gRAZiBI ruN1hJsfCBKEie6YZ0JqA/rgKjZ16lR3UQwBQ/iW46mCS2Pr1q3d7SwkLuMdPBcQN8g8BK8FwgVS JrS9R48e7qFAC0W6mQvfAyJnbsw75FWif/BkIm0BBlI8UeZJdcjciKTmW8nDw5zxepkyZYp7TuFi S7oGUm7ggUPAHAYw3of7HONBmLDP8H5gw7VgQOO9uNMyLzxnwneFuTEm3818gNXu3bv9/cCGd4bg nECwA0EFFtVRl7Yq2zEQwxC/A/EKOYYgcCGxWNgbpRHj8P7AKQZCGc9qSZ+4UTp9znEuM1GNVmVF T8+z5UmaFXlr+YRA3C9hzR/5xD85Uj8qbDx01I2Wq4MJJw7C5voxbdbp76124++LU99zVQ3unaW5 drpnke5t2ZlnraTaKSgotEdffNftD3gBLZJUgHQxf9n6YiMytgBUUWs27XJCkSVvIlRIh47k27K1 W22wJIbjp8FYHAcmcwYZEQyGLy+BPbfffrv7+L711lseTQxSx02PRu6hW2+91QkCEcUgcfqABElJ 8eSTTzqihIDcf//9HkTE2BxOEOOQIUM8EhQkBjEA6V1//fUeGLRq1Sp/DgQBggMBMqff/e537itO VDKIFp93xuIHogSC/+EPf+j5ishlw3WQJgFyEB4QbkiYR44k5gNiJE8SwXOkUeCd/BDwBOHBJx3k xFggLcb41a9+5deBzT/ItkQiLYgS15gbP+TRISAKV0tg9oUvfMGDaXg/74LYkjsHhMe3059voy/f 9dhjj7nPPbEXEAuC95grRBHYv//97/d1we8ed7vLVYCIFB38HYg1hPzee+91wsscAzE8mzl4gncY 6x4MzRAzmA32AesCQWMNiVGAOELc+IH40Yfn6BOkOQgIz8PIBAQPrHA5LU2tEFdXMU7wXGOfnU3Y VAS5JX0zh0C5hABOu5a4yPHyV3WvHAKJhYQLxYkfUSh0t/YtZQcgEUXmLo3B+zHi8COXyDgOD7ED EIzSWvHz3FSXejlSiRRVPpYgU3BxCOBWA2IHWfEDUuHwcag4bBALfL+JFwDpg2Q5SHCbQY3BMyBm kDgHGUQE4iM4CeQUDjCHlQhlJA04YMbBwwTkDaIA6YJg33nnHUf8IHO4aBppL4h2JgAOLp24Bg41 /9IHpM67QCBw6bzjmWeecQ4bpMncvva1r3mgXMhUyTdCcEBAwIH5EFlLEByIGGLHPPkOYMM3gmiA G7DBR5pv5Z0gJ/4F0TMO3woxRJriGkQSuEJkSKgFAgypEYAV3w1s+AZgzXvI6wTxCI0ALGANjJkL e41naRAHckVBZIjahQghQdAPzpmfoLLKdI9UtV8w+sEAEFHMXmItmBvEmDXmOuvOWtAPGLyiiGbu wVAQM8Aa/vrXv3YGBPhBQCHaSGlRqowDDqtf/OIXxRJjmDt7jzUknxF9IaqktQD27GEM24mEUNWV PreeL5cQOK7V4eFApjc2bQu5i55tt3YIVFlEozrBHQ4pCBhueMCAAY5kUImAdOEmOUAgWw4RCBfi EWwK9A06aRA2DamCA8bBBbH95Cc/sc9+9rOOhLgGYoKooFqBi4awgGA57BxquEKQBYic+xAJkFfQ szM2yDAEQIUspiC7oNoBiYJY4J5BmETPgojJdMhYZLykDxIEHP11113nxAFCAPLne5E0+OaPfvSj jrCBEQ2kzzcyH1RXECCICoSEsZEiQMgQCvIrIYEAI2ARVFxIThBTvgEixFyAM+8ETlzju4ETyJBx gsqDfQuXzHj05ftQpYHQIFYE7jAPiA/SHSlAGA+Y8R1IF8DpTHHBQYUD3IAh6w2ckVrYcyB8YMm3 M3f6/eAHP/Dv55t/+tOf2ne/+13/BiQo1Hl33nmn9/njH//ohIIGIXj++ed9bOALQQ7cPt/L/rrx xhudWMBEsM+QZiGYRDWfSqVUnWcuGevMQCAjQuBTIUCstvLtS3VTQERiLD8PGwiVDogS/X8QNVEN YeA9Kq8gOPfs7ChYDKSNyuh4Sr+PVBAkA4LIzlVug3mBIDkYcL4cQpAbiBM1Dn/D1XJIQyES+nMN ZMThgTgwDlwoKaVBMBzKkK0UrhmEDLIkopgxQ1561DEgzQnKc4NaCMLCNcaGk0b/DhJEHQPSANmC SPidd/B+3gOnjxoEZIpqBaQBVwmSBsHTfv/73/tcf/zjH7u6CVUUhAkpApULxCeoG0CwjA8ygjjB eTJnEC5cK0QGgsT7QSYgFa7zfSBo5sg8eB8ECjUIUgaIkHFRr/EOkDPvYL+BBEFeIGo4XrhUYAqS AhnefffdvlbcYz4QL+AepB+IFn8DR4gRxHy48rVAbHg/MGNt+Q7gdaYIQTj2wJl5MEekIebNPkKl yDoBf9aM/QBcmCc/wZ4D/CCuIHTSnAeiACIPKk5gy/4hUjVIfEGlBMEENkgcwJV1AubAKYlsPzPI +Uy+JSNCgNNn0fEC27xgrjLf7bbOAwZaPaWgFv62tVt2uuvo5h15dkhupONkAD54OF+6exW+EKLf tH23PH4kaosg7Ny73zZu3SOXT6VokEdQs8ZKqZpfIKPyftf706eL3E9R9ZyLxIADwKEEGcG1hsMD kuPgBHUOXGioRgUCAanAiYHAQIZw+ei1OdhwvRxmroEcQeiBOwPRcpD5F+4sGIdArBx+1CyMz5iM DTJljqFACZxdcEtEYoAIcJgZD+RH31D4hFB1EExQX0Fs+E76gEiYE+Oingjfyb0xY8Y48QgEC0M0 CDVEUAcvHb4PpIMqhsZ3Q8A+9alPORLnm4K6iG/713/912LDceB2eS54A5HmAXsJHC/PBg8l4IBq CJiHPEBIbiAzWjDYQxhYv+AJBSz5LtJ8BMmPNauO8P2KHugQvRwIE3MAEQO7b3zjG74PIBSsL4gZ CQAVIAb/ULsAVR1qPpiB73//+zZ27Fj/ViQfYMR6QOAglBD4sLfCt0M4UEF99atfdYKICgnJAomN fxOJoKKrem73z4gQ1BSC3rRpi+369cO24qknbef3fmRXqDTlMZWkxId/9cYd9sNHXrJsEQa4fzx5 MOZu3bXPCUSnNs0duf/sz6/ZinXbrIUIwX3XXmK9FHX8kgzLGInflatp9w4t7XPvvzrkND0nIQfC B4FHQlJURpJDgRQQWjD2BWLGvyERWJCWONzBbgCSApHyN/cD0gIxgcDj48SNePHkYgHhctiD+2Oc ywtcHOPTN+jA6RvC1UEONBBFIBQBKYGs6RtsHOFbg+oLJM7YwCeopugTXGRB/LTgkcNYfC/Ej2+C Ow2IGsQU4ASxCLmYuB848+AxBSIMhIn7EIQ41xq+NZ7qIw6rgACDyi68N8AlPvaZ2pC8E0KMKo75 IF1CYCHUX/rSl9xQDiMRVHsQQgg5Uil9gSuE8M9//rPDhvsQFeCKJEvju0Ho/JueBoV3orqE6EMg 8fqCGLAnUMslROBM7YQz956MCAEmW1I2L5faZpfKTLZp2crITgqy37BVBsuGda1Pl7aSAAo8J9Du vYdUwWmLDejR3urJ7x+unxQQSAx4Fx06pBJ8QjYgflJEbNq+x2MR8DhCxXQut0wRQ1kSTbge91WP /57uElZWMqnSxi/NnSy9X2nvL03tEX9vfNyyxgvIJU604utY2nsD4k9f79L8+Et7byCK6e9JV12U NV58zNLmfbZUICBiEHAgSswDhiAkjIO7DwxIiD+BoAaJLqwF0hOE+uqrr3ZJDwQeR+Ludl2Kpx3X ICq8IxD4OAFI4izOZQxVubllRAgYeuGkF23nrGm2Z/ESe/Xb/2KDRqmCVoP6rtuf9M5CIfEstw8Q +UuE8CHlEpq5cI21Ux6hecvX2yUDuxupJQ6IGNRXTMDazTtslfqhdtqz75DtU94gUZQK+B5V7oOr 8lRpbnZVGS959uKAQEXVnHEJMh1CEO3SHDfKSnDI8yDz0tqp7B5BOgxEJT219cWxcuf2V1Z0X53q azImBN1kFzh29fVWr30n63Xl1fLzlx5fRt/64vRbNWukIK9GcuE0a91chlF5EsHpvzFzqaeAaCVV EJHB148bZK/PWKxI4wHWp2sbzzPUq3Mb+9NL022RiAXSwkERCjKMnpEIsUqsM2qbkFo66JjhsoI6 B84rBInBOYWqUXBuqC3iUbpcY4wQJMQ9nkdNFNLOhinCvaFeCaod+gYdf4hGpg9Igr8ZIxzi4Fce gq0Ym2fD34HAsbH4ljNtGK3EMpw3j1TnYeWjcb6I0rHjch0VhYq80pTJN+WEQR/cu5Hksbt5JT7d 8+uplO1I5KhwGSM4deC8gQde1C81fgrSjBOk9eg5jSmXbfYO97hWS/sO1XAtOYUElWFNBZByzd+j d6JFSH9vWEz64ERymsOBzpu9cyYnmhEhwEOo1+hLrWXf/panBHTdOnexfCEc4gcOKDX0IEUXH0+l n442p3mOoXFD5JpHDhV90TvzV8hOUMvGD+1luUpBsX7LbrctsPGayHB8y5XDLU+SAZ3LCB84k3Ap 9V1sZLxnMJihd8V/nQAddLW4j9JwScSlEs8YkDHVy0CsGJS5jv4aPW7wiUech9tC7xsKUOB5Qx/u BfUEQVfUrIXIYPDFoEofdOt44mBQZW544uB5hPEQnTCIHQ+aYJTmvTyPKgECgfEwnqKBe+iHqxuB nfXFO48mACEPKUmYdnAycMcAqWfz5JzRTLY5pHHOVz0xTtvkcNFAiRdJ/BgFXEZId++BI8riW8vq SO26K++gpPIoL9dunbVmYtY4pyB+/m4iFW8t5RDjWhTjE6mOGGursgTsUFoXXMUJAiXin5QwnO1N O/Za17aKL1m7WXnAWihH2B6X/GEGkfZ7dmwZqZl0jYa90G08egdq4kDYmAeahbPtjn4ebZVqO6cZ EQIAc4yAHyGIJjKUHiWmIEW2+acAv3VRfm+puLLaXpUrugRHwuaiT1NtRKKBT7D8NXzDEF3cWASB jXyuigNw9BT+5oDg2ogBDkSP1wwIloZLJq6ZeMNgmMMFj2AvCACeRI888ogjWoyqHAY8PihtSR8O +n333eeRuN/5znfcMAcxoS9uf7wbwsN7MTYTb8BzRMpCBDDE4tVEjVs8PhgvxC5QzATkgjsgHiUY CnExJJo3BMlhYAweJolB8OygA3fBltH+3Xem6tzgfi2VqxgFXJRraf3+/bcvy57WzPNs9WjfwvYq OWOvToovmLHU6gvB3jZhkP362Wn2D++b6Ej46bfe8+y8IOON2/f62eLM7sg7YJcP72lXjexlf5w0 S6nkt6sWc3MbJLvef/35Dfu3T9zo3n1RRL9J3bvTvv/Iy75nrxrVW9l+c2zisB724ruL7d331roU AOH54Wdvsydem2tvzlnhBAaC9c2PX6/8YE2UV2yP/fyJKfavH7vO2rZsZK/NXG6PvzrXdopAQYQg Av/64PVuczwdKeXPzoqeH2/NmBDwOcdJjBb7LjbFQEkDcCbV0rRBgxhZLeOdhkGCt0twj4RjItiL mADggcteCOYC4eP98Ze//MWje/Es4mCj/sEtlKjPkFsHjwwkBpA1UgXjE9GJ0Y5x4u6eBE3R8Hmn P94ljAOhQfKAWCBdEFOAv3lwZYUYMQeISoiaxRsIrxDeh0tiYgg8DZumAkOyjpNefd2O1Khv9Y7n uWvtii17beekV+3u22+xRXLC6CCkunjNVufyt0oSeGP2Cvvnj17rCPip1+fZMuX+QnJoIzXtLZcN sC/+5Gm7VQQCCeBnT0x2BD28d0d7d8Ea1fLob9OEyLt3aG7v6G+kh/krNjlH/8Jzi/XcQE/xDlPB fYjDLjmDkP+rd+dWXhOkcYMc+9uUhXbf1UOdwGxX2pnuHZTqQgzfIeUge3v+Knt/mxHWWwRrk7wI 90sKQM2EhDF32QYRs8j7sEiqJhhGV1Um+qEK7Jqqd82YEKCSCC3oqV3HrR8KygQ9MymlaZAGL0yv BeWHtaUf+sQooEzBWbGgtKp/yukfgW9Evw5SRn0TEqMRsETELvdBwHDn3OPnRz/6kXP2qHG+973v 2QMPPOBBQfiFQzDw/UYtFLxCCAZD7QRHjucIXD7j4r5H4BXvAflDDEASIPSQgA4VE2ohVEKoryh6 HdwGQTBEkIZ0FBAd3o/6CakEqeMzn/lMlUvenf5VuLDfwLkpOF5k+8RxNa6brX3TyA6szrOGURiE I9B2LdgTkQsoahWkabzy0NFz/kgJg2Rdv25t++ub8238kG7+DJz+Q7ePtUclAbhzh1RIK9Zv93xh /bspIl2I+LrRfexpPUMb2a+T1U7l/0KqhwAxblMRgT0HDrntr7HUvK1kE0SiGKSkky0UG3TPVUNt xYYd9vsXZrrUMH5wdx9n6vzVtl5xRM9Mec8G9u7g77h0UFf79J3j7YDijr79q0lnJFXMhb2DKvd1 GRECNtzmDevEyR4u5nbrNWhkuY0aOyFYLxdSkDyNCmV1JaLSsB+QNjpLmwD94KbteRID91tu/bpu ZG6uTXM+eeLAFYGcUf+QlwfOHQSKqgWkC5zwvSZ0H719MNxiQwjZNxmD/qSJIHiJaFryuHCfICdU QXDoRNiiduIdEAa4eYqX40+O6oD3gdyJcka9g8oJuwTcP3EBwBUbBn7nPA8hQTIB6aPGevjhh92e ACGAsPBN2CGCv3/ltlPyVFUhwLoV5B+1//nJT3VOlKq8Vm3brTPzqQc/5NIkXP323Qcc+fI70vgo IezfPT9D0vQxu2X8AFsoqeHl6UvcHXvesk32oRtG2R9fnGk5+ruZkHj7Fo1tnRDyWCFhziiqprWb dzrHjkqXZI4wbLOXrHeVDrpdOP9vP3SDB38iEcxQGvld8hCct3yj3X3FUH12kfajsg44c6eEkju0 T0VoLhkge6K4/NlLN9hPH3vT/vPzt9tvn59uf9AP5wVC0rdHR1u/SRmM5WlIHrOknXkIlEsI4Oqp UPaNHz1suW172d68PbZ0yWK7clhX+8ZX/tEKtHEXrtxos7UxEOu+8dCtNnnOMq8sBpGAg+mogLKh vTvJi2iJvTlrqdcTIAJ54og+1WbsOBOgQxqg6HfwFoKjRnXDhn7wwQd9Chxk8u0E97uJEyf673Du 9A9JuyAGIRUy+l8QfiiCTs4bVDQQm+AdhO6fsV1nrPF4BjXP17/+dTf8YpPgHUhuIHae/dnPfuYS Cu+FSCCdYGRGQiEgibGIROUd2BK++c1vFucCOhPwTN5xMgQ4M4MG9LPvf/OfbIekxnztuY7t2loL EXfcsz91xzhHymMGdnEuG087bGu5it9BXdOiSQP7+3smul0ANc+n7x7vBuVR/TvLcy/iwj9w3Qjb tU/pOVo2EaOW7WOiv2/drKEbnR+67VK36/VVGnjsDNgjxgzs6u+D8Ozcc9BuvWygq4BunzhYY3ey j948xkb07aS9ZNZDaqEDUv9gBxjYXfFFwgtzpAL62K1jFFvUzr54/xVSCW3U+xs7Q7hu4za/j82i UNJQYh848yejXELAlAoVKNZBnOZNt99o2QX7FdZ/iW1evdjFOBA+xeVJBd1dlcNWaVHh+LOz8lRR LN85i2z3YIhczI4ouAxOIU+bGQRUVlDLmQdFZm8MUakhyhbkHKm+Ik4m/B7yx9Mv5I/nfijQEtRM 9Ic4AAcIjLvQpVRmQa3Gc3HjrXONQhhw76iHuBc8fYKOPxiZucc1CEAwRPIvUkOYK2OhTqIPvyd2 gsz2wunoBfx79uyhhIb9tCciDxoMtnjubd21R5z8bj9HcOUgTO6jaoXh2ikOfcnabY6wKdIUef6c yO7L72Ft2W+b5e3j7qKcT51TMgFANBiLd3B2eR9jxSV3+vNeZ0z0+yszlrmBd46QexShrRQiIkJw +xixafx9WFUIJ89Z6TnH0BwQa4Rq6625K71SYd8urZ0gYYdI2pmFQEaEAFGvecPa1iG3yBqJ6+zY sLm9tSPHNwuuZNddOtDVQVB3XMKG9+3s3AvcBd4FlJbctmuvi6EjVYAGPSaFZs43IuBEMeWHHZap tIjUyrhexn33y3s+fj88lx4Fy/X4mPH7PJ/+Hen9z+w2TN4WIBAihkvz2mqks3T1yN4Vyfh+3gEW IlLe/j/vPuo8mHBGhICF2ZO3V37++60w64h81w9J/33YKX9jisNI/0+FMlQ97aR/nLNknU16d1FU J6BekTiNvW5gwhNhQPf20m02kOfAEU9WR1nL80UUTDboebCjL4Apss+CV1coKwrhRk1L3i8kAJio OHF3Lr3ENZQ7UY3wYqYlkln9+jnbcC45Zyd34U6sXELApqyTU9ea59a1+bNV5KKmVBlSNzRpFume SRWxXkXmETu37ZSbm/SGz06eZ/3khXBUaiD0g8vXbfWykzeNH+z6TPyNUQ1hGLqQFt09olJub/yO Cx//RgcPL6moeA6H1rnyVF+MejSCdDjoxyQxHZMnCL7ZQbwn6hOjW/qzYWtG78HjJHoHfyPu8x7m EVpQZcX/DsghEDp/TsgmTqBLizaN1AURYgnPolZA3PfU42U0nuNb+Z6knQwBkD6eYHin4RyAmg9V I1LCgQMHXR2IIwIeZXiKoXr0XEL6nWtR2vLIXhRFHStITGpHrkdb7kI6dckOqg4IlEsI2Dl1tfE+ +rGPReXqUlwGmwx1wtpNSkOtoBbSSqzcuN0RSN+u7VzP2LghHIn02dqMK+Wm5knqVGzeOR4ZKtu2 aHJOZxotC8AhfD5+HwS9UpHS+EPz7e+t3GzD+nSQl9QBR6gk38Odj367ZagD+bvEJNg8M3mB63Xx ud4hddrAXu0UqdnclkrfiwFw/0HV0W1Qx3rKq4NnceEjuR8EgyPtUaO6jhshLn0g4T375UqqsfDr HtmnY5SCAJ2y+jfQswdlzPNkgrggEvavZ/kXJM2cmRvvidaqpo9HZHj9HBWhlx4bhOLlSNOeZc5H RXj6dW0dRb6KMOGqGOmVFSwl+xCGxA3b8hQIFUWcch+mIWkRBNhflCMNdSKIGv/c5z7nda+JBIco 4PlFenASyhHAiPcYLsM4IeB4gC2K5wl8JHCQ4EZiXQgaTGxAyU5Lh0D5hCCFLLAO1VZhmtCCoXHi iKhebrxlGg+CZ8OZqCxWncsOAQw58UOGTpArSHHStKWOXI/KCHZQP/27tXHvCDjfqfPX2OfuuUwp uZuISGxxBI+3xT4Z2qfMW+VIm+jNlQoU+vBtY2zcoG722qxl8rpoZwtEVG5XQBDuf1P0Oz7jLRSh TcAQBOR1BRRNU4I/pIHRctfro0AfIjYXrtpiE4Z2t05yAWwrlR2BOy9rjllZNVzXDHF4Z8FqIQ3l QBJRH6t3QlRmLdlgXds1s4Hd2tlhEX/SFDz1horxtGtuHZVEkLlD7N59TwFIIhYFhcfdVxzbzwa5 CIPo+3RRMRwRsLq6T8ASaQiA0TWKSoUJwOMEQkHEK4FKg+RdUkvvTtRvkRGW8pTEmFBAJ6SZJkaE qnHEkxD8x7kjPoWYEIgBcSuoi6hLgURBDQGcAFxyVxAh9ZqTlkCgNAhkRAhcmMQboJQR8P3NtJXm YVPas3CPsK4BKZRdu/iESiKMg1rCudSUioTr6eqQTOd7EtWUiE36ht/+9rf293//9+6GGSVvq6EA mp1Cfq2tuXy73xMCvk3udXC6hPyD0OtJGmiroB44aQJ3CMGHu58wtIcjeSJFQYoLWjW2K+RGB4Go Q0UyRV96DIYQKe+Bcyb1d56S/LUVIdiu+wQEdRWSHtqzvUL+ladIHhz9NBfUb6gBNim1QJtmubZa 0tu7IhgE/xDogycHnD95ZnLkRoj6h0bCstfkCbJN+WUuG9zD3RU3yJsDH3E8PO67SnEObZp6SoMd 8lRpoG9DaqAgEdzm6AGdPQvt028tcB/2oGKat3yTSycd9ezVIghIDkSWMq9hCjBKiEC040Dc//u/ /+v/EgtCTAkqn5deesmRPt5dBApCJEhvAvcf6lSzHyl0RH/3DNq82WsVENeSzrBV9hwkz114EMiY EJT16ZFoHyWfAlFBGEo90DH7FCoiIotLayANjNEgTNzMGBsOMqgwyFcUIpLT38MrvN7BARXmEKJE hREl0KoenSi6VtJCkBsIriukZuBT8N/uJi76+XcWu++0h+ULKW5USP3y9TtkKD9iK6Q66q+sqxCr oUJ8u5VjBSSIG9/zUxe5+x/fAJHA55vvZP642vFdm2WD2SIXv5su7ecJxty1UNcxvDesV9cDg1pL NURg0JHWx2y3EPjdVw4pVjsNlg83LoI3XNrXDfbApZ18vVmzkX07uuoYUx12imFC2KQDWKJCQiDp ceL4QfhNhykgSf7nEI02zXNTz3by9WykVANXjuhlcxVkBIG6UekL6niQkVIHkI8K1ZOec7hIcli4 eovVEUzvvXrYSdkuL7yjlvkXhTQk1Iom/gN1DrYAAgwJLCQSHbUQ1dlwISaOJBQQCp5iRJB/+tOf tv/+7/92FRG2hrNVXyHzL096ni0IVIkQgIjIJ/La9MWuFqBdNryX9Nd13R4QGgjniJDNbHkTDeze wf727nteppKspdgWAscIvoaLnfbeqpRraiPZFrbZlaNUd1fcL6qkTdt2Wifpz49K1zxn6Tq5qnYp To8LB/7KlAU2Zc5yD1iDS8Ze8fa8FcqL0tojJkGslW0Y20LVJjgy/qbxfSDgSdOXyk12n905cZBz XyvW7LC35Df9getHuK4eFckAEQKCf4iqvl4I/ZCQOCqbWyRB9FQgDjp+kDXxFvhTYytAKpgoFQ/P 0AfVDQRgYI+2nngMTy2+9SUlAGsugoRUQu6XvlIR1ZUqK3LXhaDWtEv6dXZEXFd/Y7s5rgAegpOI OMVADQxz69dxjv9KqY9YD/T87QR/fNQJLsqTqugSqbWQ1EgR4EnC1Ge/JALyykDokAqQWJBgIBio klAttZdUBOFZKgKD+qmv1oXG9yYtggABg7fddpuXpgyqSOI+CAiEIIScVSF9CEQBAoCaiEyzIb04 yQRRJ2FsRjWEgRlpImkJBNIhUCVCAOLmgFNy0gNLpi+SS6jcS6UjJsV0CGYhwGyjahe/KoKxcsM2 mzw7QtQd2zSzRas2R/2EVCAOIJe9MkzukdoEJEQcQn1xvxikH31hmhOPbqpsdkgv3yKOlYbUQNzC UiFeAlM+fe8VGneTp74gKR4V0BjrMqXAriuDZ1xtVJEtAcKH+6JeLocqGN2Aw2ySZwlJQnDemrvK OWvUOyDBWQqvBzmCMF+Zucy/8YCQJlwx5BLuGuMqUZXYCtxrR9cHS9WD+qZV0waSBvZ5sA0IHUQu yHveFjJKQlgI94fIgexfllqH7zykAB4CeoqD3TRqliQqxl4lSQT9G4gf4zBEITgb4mW0TMb9lRt3 FgcsMacWTShXGRF17BrAHSkmPIstBPUQxAz1Exw/Y/IOfmjvyK6A9MB35Wmd3xShhKEYIHtKPRmi q0t6q8i6nmt9QeREpAdVDjCBmw+qyFB/AuQPM0KakxBZHiqWBW+ij8nJg6hx+kFgkloT59pqnxvz qRAhyJbO2qNaUxGwfAKIt7eKy+AN0rJJrgrT5Ho+EhAHUgHcPiqeIUoxASc4vE9nT0d9x5XDXI9c 3E9uqTT0xxS3efqNOTZmUHdxlY09AvGp12Z6HAJEINgMMC6izFi0aqMjYSSFce17OQeL/v2a0f0d 6WMAJZjtjy++a7ddPlQ69Cgne2UaBy3U140/z6HFeEvziE/9Rwpeh5eQLNcw8kbRoJHbZVw7htcO LbJnyLNHfT1Pu/ePokcjbyWQaJTLCQThzpspL872MuR64RtdjAz2wL5k6c8gp4kk+BiuolPnkCuK a/WzI4QcIJQy2XgQYNSiuac/W09rHmWqDEVRTrzjuAzKtKg4CZOOnoeBiLLXBlfUyqzKhfdMaVXI QOal5eYKEfru1Rfb1/QF8aMW4vfzKa/Xhbei5/YXZUwI6tTJ8bz1+1X2ro10lseVdoJDjDsopSnh Ihet3uT64yFKcdtFaoCwJ6Nso4V2++XD7OV3FxoIqwGcvjjALu1aFEMoILEX316gPCWNozrI+M4L mb3/ujFKm6vw9JR/PMgd5P/i1IWa02ERluFe4AYue+bC1U6c0IMHZDp+WK/iCkrVjXNAuv1xlww1 Gc7tNT8HZ6fYFO2fRBoof2mCt17074n+ZbmEFsNU/UN8SCDw8bHKf/Ope1SXQ0ZV55E8XzkIZEQI 3Eg6/R378Xe+ZkqIaHd89PN2w0232FEXNdErR2lvqT4GkkUfXhxrFOYFdytigBQwamA393RBHXRS 0/NIBKSu2CrjqG9kXYOTxI8ewkAGU9qwPp2cy4H4cB39/EEZZVFV4S65XV4vGD7biaigzqjbsJYO Q23XhcdtGJUDXcmnoqCtytsfqmMOyRgXCQRSRCDi8qNvDhId5yXYwaKcQVG1seP6v8NS2yHBRxXC lL9KezbKLSSPsVQMCfYkLzsZezZAFcmNVNdIqV5oKvU3BIYaA+4MoM4wXyFGJf5sEDGDNO7vwJkj tmxcS7fjucSY6hQkalSLYa4xFKNfXRT27jCNntOrCnbBi2RHWfmEIIWEf/ur/7Vl86fbb//5/bZq 3Uzbs3u85chjgaRzcOZhE+wScielbVmtCe6VKzY6AYlzNPH+qDPWaQw2b4zpSalGIrUD19k0bPJV kkiCKiNsaGwENO6jn94sSaFAc8vWphon6SBXEkl1Nz8YqTmxwdmEqMVo/I7hlG/moPAf9zh06Nbp hf6fwxkOCt8CLFyiStWTZXx3rxUUUK2wyZGOAqBQMXG4OQSRK60ilVOeUyHSOPzr0lYqBoT+EMjI /lCy8V2hH88eSyGQ8F1RzdpQ3jDqy3yDGy9rxXeEb/DvR22RmmdlbTbVvX7n0nisW1DtpM9rquIu LpExfoZcgSn72kW2tk1imlgH7EWkc+E8rJKNB68wUktvV5qXZyarpKlUt6SE5v77rx3hnmjEooDI Ue/i1YbjwSrZ+Dpp3Nraox7RrrG5v2bzLldb4gqNjQc18CK5PuNcgPMCa8y+AlHzjKeWTu39qLSm MhVAAPTves2vg9ylnaBBQIh3UAlb4l7Y5yWeTalJo+DDY/asnCEG92xnXeQp5zYUxyfRuQppOHBI YD7Y7bx2c6rfubTO58pcyicEKUrcpXt3W9GyqXXu0MZ2rlX90p3brYtqF4/s39UXIJ5J9FwX8X2j aFOUDIPLfElKiyxmI4PoZy5e78gen/4dKffQoJvF+HtMKrX1W/NEiOrYah2qzjpsXdpGnhx/ld89 gWTNGsm4J2SL4ZWDSjphCn4gdRGgBqwxGDZR2g8Ms7OUN56DwDdxsPDwoa7tLsUHbNu1X+q3Zu76 6dHBGguvJJa1jySs+QpQY1yM6RxmXFWdiHjWSrjGAo9s9riG2lkyIO9SUFljRwSe7kL/rVQREuwj HH7cRPFyQk23Y+d+V/GBGBYqhqB/NxnENeghGfbz848LieX49/HOpJ2AQNgv4UwFtQ/rQsGXqTK4 L1bNgS1a2yuGKeakkVyTdZ2cXlvkVPD1B64WE2UGwbhiRA+VoKRa2DE5MazwzMAzF69zJDt2cDff O6wxjgyklx6rdNMQat5B9TPWkQhwbG5PqvoZEeEECd5x+SARhd32/NuLPJL9PhWj2ah7HbTeL85Y IoQeEYwP33SJF7+hnCW1DZBICHrMl7fhFHmY3SDPObzLDqkwDXPB822c5gURGSUPN8Yh9qVTK8Wt aA/jrcYcYDwOiyBwRtBAcGbeVuEbHFVIfnmtCuxwNqi21k12vdWbVAtF2ojRSsedMB4nn7byCYFz 1UU2bPAom/fMC/bIM+9advcJNqZ9xwghpWIHyD6K5w4GXMTHypliTy86CObIqhAq3PkgBBjh4pHF zPy5txe61w+IFQTMQQuGULxlQJ64k3IIe+pwTV+41g9ut/bNPHqY2q1zlm8Qgm7t6ixcQPHOGdC9 jbuJgmz/569vewRyIx3cG3WIyC1PquCQ0hfX0WWKW/j9izOcM8TAixvqIR2YBSs3uY8/SGGE4gaQ HnBd3bFnu9aOSnOKVNXB50DiMdRaQWhUt9omNd4iBclNV80JUmg8cOMoRxZ4Kr2guAk8o6hehSvx Tx9/yw/qqH5RWosbxvTzeATq6HKI77x8iAe4oca7UkFl0xeuc/dV4jDOtyjz07FbA1NFwCLRwb/5 zW/cK8jrUojYw+V/6vZLfW/cfUV3z/2PqqeXghG/8vNnHcnWpoC99hju1s8JUQ9S/AhxK3dfMUTE Yr/neSIepXPrpr7WEGK8z2AGPMW1kD6cNYkk27es7RLDLDE43WXP45kByiPGul8jZNtSHm2vzViu Wub1/FywD1nHaVrXIUqVwpkjwLFP55ZC6nu86lnk+FDDkTZBh0PEIPGDFFBPSHy7EDtcPzUQIFB9 xNGvk6TQrX1nZyToR+2E3spq/KyqnTXWPqdIz559Yn60Jw8d3W3XXNLbr10lF2ii2Gcv3SgYtD8n 8dLp2EcVHbN8QqADf0SVybbO3GE3Df9HK2qxU4Ese2331h3Wqn1rbZajKkK9RD7xA2zK3OXWXykR 2rVoek7mM6kqcSLHC6H8HE4KzFN3uDhIRzue9AocJFxDUXvUF4fsCFUIHOJDEBjqH9wqKR0I54Lb JOIwCP96IU3+hbO6V9G7bGqkixVC7CDoDjKy4zEEZ+RG85QX0TxxPRAROPrhym/Eveni+rpJbEYV N2fZenvf1cMVZKfANCH/S8QVcThQTSHqY+gmp3xLIWMPCNR/BJ1R+HyLOHaQDPNFbXWv6tJCBNbL JfcXT76tCOFePm8ISs3assfINnPtJX0c0YRv+81z05xYEAdBvqJ8cWhIBSAJ+pOXiYLohSnPoopu 4gutP0h/5cqVnjsIZqPY/Vd76EoVm4fwI2X17NjCkeI+ecS9NWejS40wF6NUIKZu3VoO74FiIsj/ RKbfyXJrhuFgLVDpIJGiOmG/BVUUnLjXJhZxIDCRfYxqCEZvhpA7NYyJNGcvEheCdDFBUepjRIAi IlDoBIL9dePYfo642ef75fFHjWPUPowJMYDRgEgtUS0T7qFaYi/wHUgJEArcx/EWJGofaTf/WKHv cwjJC+8s8jEouoOaiuBFCu2wr9mjnIlFq7dKYtgvhqarpJUmp0yGeKHto4p8T/mEABVKjSy76wt3 WI1aUqYUyiVQB/ZYIekEIkNPcZoJ/XEhc3WoY8j/8vTTT3uyLwJ6igmBvp0CPB6dq384UCBHNvNA IXuQMpsSrnyDOGRiC1DTLJdIT9FvOC2kCNRA14/p44eljRB3ODRwNthiEK3h1lAJIB6jErhsSHfP BwT3tHTtdtcbD1NkMq6cSByUJuRAcuiJH4ADH67I4RWyrZC+4lJxXqiN0A/DvSGSv6BIZ0R5Av6Y A9IDiINUE0gmTfQOyiJCSIhVgBOl/CHRxSAOxHsIH+8dr/nxN9WuDkpqaNG4oVQAS/StilQWN9cp t2mptomKbOQLpW/k8pttf/zjH50IkGco+P678VMI8OXpy+xKpSEhhTuquJdFsLEFfOGDVyiYcqWn Ixkk/TmqkS5yqR7co70jYqRHbAGUtiTOAwkVlR/7COTL+BD8q0Rs5q/YrFQpm126RzpFpeJxNOL8 H3tlrkuFSBzY2mA+goFZFiJH0qhm2Dtuv9KZYG9BPLyIjvrAxIDECZAkEj8KSI1yT+2VFyAxMuyf 9tqPPEuOK/Yh0jaEA7tEP12HSaGhZnQpV3ucDMeco0hNVEtEaoCPdaqMuBfK/qnsd5RPCFgevADk 51/kHJt+hOhwlUSHzIL2kiojMvTstP7adBdqw4+bMpSUiaREZYgs5ntRg8Bp4RbrnhvinhFNQXTo 9eHsgRViLpwWG/qINj/Gr1XSu5OzhyjdveLuyFTK/cuUhwjRHe55iTY+B5vyfuh80X3C2aOvb64E dH+TiOz5eyRSw4HhcQXnxpyQQjiAHPa7Lh9siyWRcAh7aR6oceDeQAzYNfgODhNzIblccL/lHXdK Lwx3ybONGtSzy0f0dGcBkEbUimy4VBBvKh8ReYqGyY24h+I+0OPOXLTO1VkcdDhJuDgQBASrtuZH nEfSUlDU/qHEKOcuFKjhd4g1enX2FOlKFslOEBgxVJJ/UN1iPPhAgAQEItlhVEX0QvoCObIHX5u1 3A3IGyTVIaHVrFHb1xy7FHYAEDn3saWRFwuVJ+/HBvT6rBW+315WFL1n1ZWkgPopnQFkX6OOKdLz POuShuwEcd0M8/vLmwtSMS/RtxMI6V5H+jDUmDO1/yFQqFZ5lnMEM8H5YC8u0DmgL9eRjvg3OFGg 0uK9pH1BgmLfjpS0VJaTysW8/zIiBH7Ey8gNBFc7QhzktAXosjsIMancYSzh24UEXBA8IfpXXXVV ichiQANihhMJXkIcSDZveyFq1DE0NircNHUGSO3gJQD138LVm70YOcnqMGCjHqKxiTkEGN0wjKFS 6ijJgYPYVJwZh3CxDgO5hojKnr1UhyblZQQHBJcE14iKifxFHDCIQl2plqYq6yiNwzxTKSsgGAtF bBbL04IDR4ZSDnfcnoK9AWTCd0V+HlHAGoh8subM+CAaRHe+GX02EgOIhehwGu/l4GJwZHyS2DEU WVZJYlcV+82FtNeC/Sl8E3ABEcPdg8jiiDcqQXlC8Rl8+jPx7Y9HnfuKZqA/TX9fZeGeyfzSx2Z6 7LOwd+NehaeaB99FYsWECJQOpYwJQWmPsyirN+1wCo3PfldxqktVhAYffjZtJpuqspvobD1XVmQx 3AeqmXCw2KBwJo58UwG5IH5UO/EWnbscR6zoV7nvCFhXGQPOjMYVEGVkTCxyb6MQqNdY3DnSBwQ4 ktIUiyHuxw+L+pJjCUIezngQ17kPMeEhRP7wfPH8SgYl+3wgJK7+in0EhwvEHgL1akiVyDeHurnc 5zvC3zzKNXdLlR4NN/HoQGeAhc7Wwp8D74XLRseeRAhXbjGCerRyT1/YT1WJEIBAcP/bKxUEoto6 cX+c8OaK6EW9cbEUnQOpUXg78hBKWkUhAPrHEJ1IA6eGHEQeYo2kCOOBuiPo5p1L1v+AIbCEaCB1 hqAq9OOe7kXPIpniVRRacBeGcfH4j5TkCBPBsDzLtXgaEtfpuwR4IsYEJ4AQI8LYzBPbkts94E58 ilJ3pQoqpX9tSD8fUsnnyx07sAahaBLzozFelKIkYoz4nW/mG2GonCHCTTwlKTFmaTEyFd2rF2r/ KhECOJPxSh4XyicGIBF4ciEbjUvbDGe67GJlxOrKbuJM3xVFukaSTUVbwuWWhFjcUygdlvtl4MXu RAEiJEHsOxh9aY0a5sgA21JxBtu8eBG2A5w58MrBdoTb7mIZW6+R88FhIVrWCkcD7El4pjVU5ln6 Y5tqqrEhNgRtYXcgaM0lOf0fdiqIEd46xBtgcOYaZz9kG0AtiEEaJpHfUYlCuJhfLTmeYIjmOz1N ud6Tp/TzbB0QNk4J1NSoJeSOBIuRmznizQQho4ZGIwXP8X4QPnYTsuMCD8/TJQJBFgMkXuYGPkJd eiFqKSp61krrXyFCELmYod8+kTIYziJEnpYXyp1pv+r4sNM1Bp5DwbOD39HlhrqwoaA4Xh64mnIf Yx/3KR5C43eMzMQj4B0SuOCQNZJroR/jMCY/jMffjBfG4hqNTJM8H382jMu19Dz0oTB66MM4/B7e FXFU5KbB2AZnGcVMlJW5km+hP/dJlkaO/HiGzLI4feYREB6/B8NogA3jhSyafAPfHeDHnIPLI9eY X5h/uM4zYV6hqhzw4p3hm0OfsK7hu7kevj9E+IZrAVbM73RJMWQM5b0HldsrvIO/IQJ/eGmmx4eA +K6Xm2+hDLIH5cZNQCN2IqTxJ1+f6374RAivVeDXR28ZrZTmtYtrRYDoewvRgiB//tQUTwPeV1Xl 8CBj3P/685uOwPEM+vU/v8+DCrGDIfPCjePl9trM5eq7xeNSItfQpjLebvaARexcxJZQAwOnAwgV jgk8i9MCKsbZsk3hCTekV3vvS+EigsNekVfUNXJBxlsIWxvvxe0VLyE84JbL2+3ffvuKjZDnG0Tr Cjkt5Bc08eJOM+TOeofSwI9Q+hkC6iJ36iyv4HeT6mOQrSBpJ0MgY0JA3eID+w4ole0Ba9lalF8G ylAMA2JAMEr3DiqIIo4A0Y9NBPfAIuAHjP6XABWoflcFpkA0EDnPJ2UKB5EgH6o/bdq0ySj+QfUo An74e8OGDR5b0LBhQy8pSJbSnj17ep54iomASKgk1adPH88Pv337dicIIDEKjmCIXr8eg6/ywQgR 8FxUsPyALVmyxAuUUKaQKmnMg/FAgtSppdA5dWvpAyJmDBAi+eipeUs/xuI682bsUHea50IOe6pb MUcyVpL3nvkwP3Ljt2/f3tc8jvwYj9gK3rtixQpr3bq1w4CiKSBSvimO8AMiZhxgFojO73//ey/2 A4KGmFCJq0cP+aePGePfy3e//vrr1qVLF0/HzH3muGfPHv923ss3UKOXko2kXKaoC3Akl3/4Zt7H OjLXUNSFd3IfeEBsgC3rwffjy0+yRd7PujI2+f0h5oHgVScxCNLXj3/8Y9u5c6d96Utf8nnxDs4T kieImij1RXIeuEpxHKhfdu09lEpdIldKccogbrhwIok7yXjfWE4DpPzGhZfqdL/+2zS7RTgRLzS4 asqNLlQJ1X5d2jiyJlYF4kCkMPc5z+8KseJ8MEDunsQVEGNCbQyCSNEKjB14RJ5u3d1DDM68mSQS uH6ikkH41KKYocA08AF2ReIcmBslT8kXxrym6dn7rxsuD7g+zskT3/KmSrF++q7xqViWAo+lwQW6 tzzQiBUg2PJJlVJdIikIgzDSQVQkK9+ljdbKWwY8dihyunkqlXpCDEpCIGNC8PoLz9j6dUuECA5Z 7Rr17ca7PmT1GpJmoIZNmrXUg8kG9uhg3RXt10/FYF5QBtGQDvpOZQZtKrvBK+8u0qIus1EDusrY 2dyzlJ5PHkbOkaWQA1WfJk+ebLfffrt1V/qNt956yxYvXuyIbfTo0V4rlmsgT5AG1aZAbG+//bYj yhdffNH+8pe/WNeuXR0hUlykV69ejrhBYhAYkOjjjz/uSCqklQD5gxBBZDwHEqNSGg2EThWrD37w gzZw4EAnHhAgECU/zBPkCZIB0eH9BGIF0YJIQaogYRAd8wjEDkIyYsQI/5Y40gPxUkR92bJlPi7f GAr2ABuQKu8AkTFu+rPAEOK0atUqfx6YgbipAPfyyy8XI9+pU6c6AuZfJATm8s477zgMuY477+c/ /3l77rnnfLylS5c6UX7ggQeciIVAwPe///02cuRIX7fHHnvMY0HI+887WTsIBt86ZcoUu//++236 9Ok+DwjBhAkT7M477/RykcwTuLJeoRBMdRED9hhzfvjhh23dunX2yU9+0l1JXRrDTVLrHFXtqyn4 RtX7Fq3Z4J5a+NqDZF+RayecNciWEqWoV+Cc8bMnPoTYEgoHEcxFMCO1tVG1dG/f3JE8AWUwbTgk XDqoiwpAbfTrNytuBM6e+BRUUxALVDUQB1ycUb0wrzz1AfmPU1Q66iOikEHMNyjAjFrezBV1z+Yd khzkDss8PK+WvoVaJHjB8UMEdFeppXDFxuuNeBm87phzV83NiYfiKYALXnfEFKDG8lxYIgCNRASR TPBkxG0Zj75EICidBJZLCGrosHNIN7z9R1ubV2jyQLecfbOtTqveduet19tKeQmRnoCiLxCD7tL/ 4flyqWrdrt643eYpqpXAoWUSIRuKU/n6gzd5ZTGi/c43vbD7cgtZgoxAEiAcECESAgcVDhSkgTgP ou3Xr5/17t3bETIIiucCB1xfEhbIHokBiQLuEsQLIgU5h6IjjM17kCJAbjwPYgBRMxd+h4sHSVLQ HEQGd85cCX6DaDz44INerpB3gfQgSMyVMaiJC+EBETIWhI558y7GRWqhQYBeeOEFJxhDhw4tVlPB tT700EPFKjKQaVAjBRUMRACiCFzCmo8aNcpuvPFG/56//vWvPkfmxnyJ0eCbIZLcR7pgXN4LUmc/ QlwhkPwLMQCG/fv3d0IIrIEhkhRw5XuI1IUQAlcQLHNh7Tp27OiEGaLGPIgTCXNkDQnoogF/kD3w CAQTyQSppzI2kbI4UsaCcCIhMUeYgaCSY16oVIiwpbobSJ+/eytdCTWzQebuoaVrpJ5AlRLVmo4S PE5VLh6i3PEoQw9PDAF5hOCcQa70o3QqOnfUSnDWr6qQ0ufuuczdi1EjQQhuHjfAx+0mwsFzBKFh rCU4ES7/8uE9XG20WAGUBK+RVoIEcNgtKDiFjh+Khgs0sS9ID5Eht8iD2XgncTPEoRBzQ9GmKfNW e7S6x+rIBoAHHUSEoMgrVB4VaQJVEKohJAS+ASLx6KRZnr5kqNRPqM6SoLJKEgIeg7o2y82x1j37 2e6219iO7Vts11FUDSpGI7HrqtF9VT1suouLHVo3c1GRzfboi9OcE+CHKEOKyhA4tFGBLDeNV+H3 8yzegIPIwUf9AJICcYHQUaWAQEHsq1evdi4YjrFbt27FxlMQDUgpqFZAXCAW+oGM4TJBbN///vft s5/9rCMmxgWpgoRA9CBIfg9qDQgMFdN4N/MBMYGoQ6AbY8C1QkyCKgmVFEgV1RBECqQJogXp8C7G Q+0C4eB7IRg8D/Lj/XD54RtQ+cCNg5jhxpFC+C6e5x2MSToOEDhqn7hvPMgO4kJRdWDIOwI3DzGl MT7cOfcgVCBFN24K8bMOEDQIEYQGwkWh9qAeYk70+dOf/uSSUpBYUPFAAIE168F3IukAJ56HYARi TR/UQfzL3JgnBAz4sg5IWdUlCcSPJ++HIeBbgGFQp4H4MQwTc5FdM8uNqWs27fLUCkSheyJF7ElC tOjPYbxINgjWXac8P+SCgnvfoshjsuOCXGmcT7hnvPzIRYSBeYwkBpAp3D8IlPxQIP/GGnOmSs5i MEbKIO8QkgHqKFQzm8Tl4zxH6VZSrRA3EtySqVuCR+EMqX/gzN3DSJ2XiUgETh3JACmGZ0k259+u nzpiAEDi05RCAzUUe7O7AhMhQHMUpc9cmQffjiTEe+mHjQJCh1qMORLMCFFMWkkIlCsRhAO5duM2 q2fiMoYpICp/t2e3ZDF27d3v0X3DFbHXr3t7d0vbvGOPTVWmw5svG+wpp1+dtsiL0qxT5PFMJS4b 2a+LJy/DnnC+NRDC3LlznePkd5DMpZde6rpsVCpBtwwSB4mC7EC6IA0QE8iXgw4RQa0EIglSBioe kNyMGTP8uRtuuKFYrUJ/kCcIHTUF0gPcKmOC/BkXpAm3C7ID6Y4fP965XTh9xuOH63DI6PXh+Jn3 uHHjioubg8CRLOCM+Ra+j3fDCYPMg/E1rBvfsmDBAldPgUzhwnkeAoF6A2TOHJh7MG5HyKdmsa0D OAR7B0iZfXXZZZf59wWCBfJFBQVcQ21eCCCqHuYFfCHEwIUf4AiBQB0UbBU8CyEDPhAzCAtEBgTP /K677jr76U9/ah/60If8PsQZYoP6B7gxHgQXaZAG4UDKOh3lH5EeSzaqwsk1VGtIvWl+x2CMHt1r A4BUPRZFRX50rvCWwY00VJWjH2qc4LpJfwzMkUNnKkhLv0T9xKToGmsN148xWG92CYEWeShFz8HN 806IDJJIfMxg03BPI/WGkwfxH9R4p2qMG54N/ZhDeguBZVF+LL4hmhWR7CEOh3EgMszR42eSVioE yoVMkQ56bm5DG3rnF52SL1qyzGrIS4HDAwdBBGn39i3dMLRH7lqEpVOHmI2IhDCsb2evF7BE4fBs 4m7qC2VeIxGUaFgXE8+TFurGomIIiAuEhioGZBlUBBxiuHz+BkmAiNEvu6ucYABSA0nDPYOYIAQQ FZASiIXnGZeDCAcKIrvrrrt8PJ4HQYEk4bSDERgQYjQOHky8F+QY5gRRQgXE+IwNomcsfr/11lt9 BYKHUfB44lnmGeYdvHrSlwubCM8wHn3Hjh3r++MTn/iEz5WWjiwZGwkCghGM1swlEMfgqcM15s34 4f3AA7hRp5f3APsAM2D99a9/vViFBGELnkFhTGwDIH2IG/ML3l68gzFZB56BgAXbDN/ANcbj2eAo cTqIQGnHAWTWUIh0gtKOJK1yEHAi6TmNkpYOgXIJAQ+AkC6dcJWNGnvcdu/Z6+Qa/WKhVDtbduZZ nnSTKzakhlZfjFkQhOnvrYpc9XRw31sZ5dtxj41U0ZLRqklcpzYI9Pxx6UKdAPKhBV0yCCKI8AHA cQQB/NI5PBAZiA2iAAIKiI4xQUyhQWSC+iH8G8aGQw1ziLxKomfD/bgqJlwLHH3oG54LSDIg/Tjy LO/YBAMn/YIKjOdBqIxflg4djjxdwkh3dWXewWsGiSuMx7cxPmOH+r70hbgGzxuQPHAPf4fvCO8M qqYAV9YgqL4C8QrwiK9rUBGGs1EefKrrPlJAcYLH6ho0GSeBgCCQESEAUodShj50jOEAsDHHyihc WaOvF1M5j4gA3x30x3EOtTI7KY4c47+n65zTEWP6u+L9K6KvTn+urGczGTO9T/ie8rjl0u6X9r50 AhhgUBpsSiM66WOWNV46USoL0WcCk8rsieSZBAJnCwIZE4JIIxglKYsfEPdI0IWIS4oqf5HXJnBh oTxdaX5brsdzLlbZBj0XDknOTnDaZ5rjynQRQDboztHLx7n3TJ9P+iUQSCCQQOBcgkBGhCBEE6Lb OUYQk1B/tsTowlTRDNxFMUzhO4waCPuAG6zImknVMhkMIRAQCk8Vm8o3gssYBh/6ok6qUUTRa1QJ KYdpJwrnErhwzavtLop4mwRCAIcYV8mcWzNOZnMuQ4C9g3SJd1LSEghUBQKV1czwznIJgetIpXt9 be5My5MnRifl28+T+10vlY3rNHS4+w7PWbLWC0ksXLnB4wjqqw8up+tUb3SJbAOfvPcKparuopqo B2RI3uTeQmNkH+AQPDd5viIRSdfc1APM+JktX2A8ISAUfbu0tQ6eabPi+WuqAtTSngUWGC7xiUf3 jKshXiXMDZ113GBc3e9OxrtwIQATEVJyXLhfmXzZ6YZAVVSW5RICJn9USG76ymW2RQRgeOu+dsXG VTZvxkzrOGKUB4a9ochiQtA7KoagVVMi/3Y6Vz9rsYpsixCMkt9x3y7tVNt0sXyRd3vYO5lK33f9 Je5jvH7rLs9rH+Uqwq94q8cbkASrp4renCtCAQcWV0k8XTAqoh7C2IuhGD/3e+65x42VVVmQ071Z kvHPTQgke+bcXJeLZVYZEQJhdesnF9IhrbvY/z4919oM72Z1cI8sOObqnkOSCiiOji/x2CE9VDd1 lec5IRdJh1bNXP1DvQKqd/XurNQGl/Szp9+YI2Kg+se79qqqGa6WRV7ViiAQpIwo0Vq2j1kVkac6 FzJE9eKiiJ86QUr4ziMZcC3h6qoT2slYCQQSCJwpCJRPCNDhH1ax6gb17WDdVnbXVSNs1cFD1qm2 MgkKWRMj0FjBYRSZphjNX16f7eliB/XsoKyHO2zn3gOO1IkZ2KSI4g5SAa0VAXAXU12nlkGXti28 8hWlGFdv2q7i1/1Vhm6L9e3aVkmlDrhd4lwgBnBtIfEawUn8jqqI1Ab80M4FFdaZ2jzJexIIJBC4 MCBQPiHAkJBdy6ZOm2G5zTcqIEzc8A7lCpIqCA+fHh1b2+iB3Z3rL5DksFg2AAgCxuOWQuzNchso R3o9T3x16WCSRjW2yXOWWx/p/rso3PvWiUOVjkLF0JV3ZJ3C5VsqVN5TW2u8LspS2kNJ7EKU4LkA 8uCyGCJ1w5zSfdXPhbkmczg/IHAuMDnnB6SSWZ4KAlVRL5ZLCIgsbqjAnPd9+ONevB6dfp+Bwy2n HqURj9talaqcuXC1h46HzIioeciRjpSAt9BWqX82TN7tCbKWqSgGGx+Of+GqjW5bICUFz5B9cPmG bR6ohs3gpXfec6lhnNRNlGMMrqvn4naoyiKci9+TzOnMQICzQG4losvjBIHfA3Nxqr0VDyiMMyXp DEp5Y3Af1WZ6AF1FoBCi4ZOzUBGondwX+yP5rdgTBEWifQh1TVgjMgCQ3oRrqKQJcMVZhewB8Ron FZlFuYQgDNayZasS44bgm4FSAXn5uDSLbvRn5A7K7yVq3KaulzXR9Gfr5aggSZI/tiLrmvStAgRw cfb9nSrVCJNSXQXbS5sWzgbkkAoFdUJ0c0gJHgLvuB+KD4XI71BgJ14cCPVkiG8JqsrQP/39wWOJ 7yV3E7miQDyMF1JvxCPU489DNOK1JnhX+KkC+C/aR0O0P7nMWAuQPAkuWWNSr9NwTpmmXGSHRQTq ao32ae8MUDwT3ovkBqtsy5gQlBXhSg5y1Djg6bJUOCUSQKVmGuH1qLh7ec8mevfKLm/yXEUhwGHc tCPPE5Sh2iSBGXEypHZo3JCoetW+pXKaUq9XV4xLQPBwexx0kg7ihUacCvEq1KqA62Nu5EcK3B9n 8ne/+51nuQ25r0hDDiJhLNJs49BAYsHbbrvtJG6f93K2fvnLX7qN680333SEQl4rMshCFBgv1KEI VdycxdNc4Egp3MMY/P2DH/zAs6aSUrysvFQVXY+LqT/wpTbHbkkDV191pa/54SOHbfKUqb6WZBd+ V9mKmwrWN19/veUqb9ii55+357RWEI2qBLdmRAjg0DkMtAIKRSvwi0Nw3CtkSQ0khI5dIGwsdPzg eTirKAVtJA/gEYTKBwKAFEFx7SIvSBFdZywC0JKWQOBsQACuf5cqXj33tg6W0iWvl3MDxV4GdG8j VeZ2r9uL80Mv5cgnj355pVkr8w2cFdQCZIcFweKdhnoA6eBXv/qVF+QhoSFpsEmeR6EcCAEEgqys ZEeFeODJRnZZpAuysoZkh/wd1EkQtOeFSCAWOD3wzAc+8AHn8rlOJlsS7JGoEM40nk+LMZAaSGvO nKnIxxgQr/JSi1QGLhfDM8CRNZh4xZX26tw1tmPXHsVkKUvxFVfZq5Ne8H2Rp7X6oNzU14vortbv bVXTY8Lll9sSMQ5kEa5sK5cQeEIxbZg3Fmywo8ezrHPjImvVQJyEOKOmzVvJ+ydLJexWe6BYrmwC TZWF9NJBPZwIrFi/zQ3B9SU17FCOcy9Is2e/u4ReP3agV0CapKplFLXepcyl2BTGD+vptoJEz1jZ JU2eqywEsHKRB3/Z+u3Wdmgjr43bVzn/py1c5+UUybMF8scR4roxSvXtcS/V10KUMcifEqGPPvqo V1ADAcChoxdGD0wFuv/3//6fI2gIBH1JhkgjPTpcOogbbp7aCwQ/onpCevi7v/s7T9ZHY1zO9ze+ 8Q3nRCEoqIVCUj0YO5A9NR8gKqQBD1wnfch+e+211/pZpV7G1772NRswYIATr8QAXrl9AfFv3CjX Pv2hO4uz+R49qBoPqj/h1faEG+tKBXRU0tpWVRbsIOmriWqIVFVrUi4h4HOOHiu06UpB3bNZoW2t O8gObp5lW7fvtOtvvdtroL45a4ltU/Wg+kop0UhG3WF9OnsKaqqSkXK6sbyGXpm+yF6bvtjdRPcK 6VNmDu7///76lqec6K1aqQSQEYdg509m6sqtdvLUOQkBHB5wfSZnP4xJFjpwSasQgLnLN3opRHL6 w/x4/n//cQE3Uou6mjOSfvm9oofTmS4ddtQqSAGhOtn3vvc9TxUOt0hxIO6RDhsCQEEefshSS3ZW qtJRehSuHk4fSQAVD8iftOCoG8K8kCBQGREYSelOkDpjU88B7h/Jg+ukVPnHf/xHr+YWZ9CYL/0o 50lUfSiFmhCBym1v4EZhKOpddO7UUcg/0qK8M3tW5IKve3hmzhO8O6hWSVeVZz2oSn5TVLa2pda/ Ki0jQlBD1Cjr4G6rt2ex1egwwDpoQ2zbsdsPwxrFBOxTkRpKx5FS4pIBqmOsw0MFpAXKTT24V0ff eHD7Q/t0cq8h1EscNuqi5pLNVIdnx559XuYuaQkEzhYEQPzU86XQOwSB2BeqglFykaIqVPGi7CEH luIspEBBOqCqFmfhWP6R4qBC1CMg3YrobUGycOAUwuHQh2JGcOKogm6++Wb/989//rNHt1PPgRoU 5CkKZUjxNKHWBEibAkEQE6QG5hO8TwJ8+Q7uIQ3wTgoWYaOgrjZEAYKArQIJhHkFW0B4nm979dVX vcocdoFEJVS1nQt8sQNMmjTJfvfI7126Yw1Qv1F8CRvCMNXIeFk2oJGqAdJchH+m1HEwDz1SZVgr G9SaESEoKiywnDYDbEvRSOtaq764etUb9rz3hV5oppeihVENNVNgGZu5QMVq/vj6NHFOteyNmUvt jiuGKYdQJz8sc5VuAuSfL0LBh+/XgYLr4j5Vy7xQzflTnqBqK588fU5BAMTesXVUAH50/07yzChQ beDmKruY6wXWKYFIdbCGIgiohSAAEYcciQWhtgQfBVcPl1zRFnTvcOoh5TnIAf37Rz7yEX8HdgA4 fPr+6Ec/cgSBBBAQdUiAGDfugvDTDbjMnecgMPzOff695pprXDLgnbfccov3Kc1zCMRP4SSqyWF7 KMu7qKIwuFj7B0bgehmCQ7lYiDxEOdQvQTXINYjvChFpJMGeqtJXUekzHcYZEQJSTOzZvsqONlVw 16JVshzvcLETURrVT6e2zZwbIABs74EjHjfQRkWyP3LLWBWv32CvzljiSeaob/zBmy5Vn8OuLiIR 3d/dfbknoYPD6tK2uQjDYREKHaCEGFys5+GsfTeODaRLwTFi5hJVWtIeXLCCOshKsS7Gx0sdCvkS 7f7ytKWRa7SrgIr8HFyuIuowNRxormfKIdM/vT4F6pz0xpmjkc8KpMtzIP2AwCsLuPSiSaiYIAJB 1RVqYJc2fiB2p+pT2XldjM8FYk51PAg5f7O+/ARPLWBOFUAae4x7FZE8S4NruYSAzVa3Tm27eVBj bT42Z029tLWN7DHAx3tdSB5PihZC8sdSlcfmL9/ghbOfeHWWHyASyL2pxHToU5nwYXFWqIaefE26 r9RB4oNJSNdOXhrpcQcX44ZIvvnsQKBX51bWWYxN5BoacfxxnXf4O92ZgX2uiEv3hKtoA/Gir6/q Ya7oe5P+5wcEMpEsQwxCZZ1syiUEgKqmRMNLxlzqB4PGVif6Fy6gf3cVaCegjOtp9QPC33Ejmo+H US1VdyAcMg4e/clMmgSPnR8b9EKcJZx9jQaVyHervYtqqTIt2BISI2tloJc84yxLynmhstDIiBCA oQ8fPnLSO0DezRs3rLbAGicwOkznWhAxVLaylLayC5M8d3YgUBmOvryZlrd/gmooIQTlQTK5XxYE qrp3MiMEejsGo5rorFD/6N+CY/nFek28hHwiKakYnT+icnpZS/SnQXpwKqYfng3GNk9VkbqG1MAY cFnV7a9dke3Ed2GoSQhBRaCW9E2HQEgFkUAmgcC5CIGMCAHIcMeO7bZty2Zr3KS57du7x7p06y7v oTq2eWeerZfbqHs7kKNFXzmwR3svW0m0sZegdMNZoW3bu9+a5NZz1RANn1jsC0gAlLekP2Ut98um kKfn82RUxocbw3NVKV5VgJ+Jjq4q4yfPXvgQqCgjERf1g1E42BCCNxDSc0j9Es5Hee+BIMWN2MFz KLyDcRjzVIbuMEZgkIJhOaxieXNwJjDFYKVn8b3wd0L1fmEmsM7kjeUTApC4NsaLzzwhb548a6S0 0osXr7bV3cfajbfe5Vw9iH26MpBuEVGoo402vG9njyLuosjhjcrbgvsdHkXvzl9hV6nWABlHsxVN fGh/vspcrnMpYYae/8cPXWvvrdhkf540zQnAnKXrPcDsM/dc6eqns6Uyqi5gZ7IgSZ8EAgFJhiR0 Yf8R3UvDywcJHQaFiGIIQ8gcCgIPCeZA1CEZHciacch0ivthcDflX6KQ6ce4/DRu3NiD00rb97yH /nguke4C76XR8mkPyfB4f1lEJHwX3wARW716tcdaEOtQVffHi3HXVCdeKp8QsGhaXKIpu3ZtpqDf /bau3nHbt2eru821U4QwNQOWK50EKpxP3DnBXegIKKPuQIc2Ta21OPqgJkJqQEpYpXTTbVs0sVsm DvG6xcQQtG7W2F6autAJQOtmuU4MCFbbdyhyN63OD78YN07yzecHBCAA7777rtfGxiEDX/0XX3zR cCkkwOjxxx/3JGP4lP/0pz91JE5fcgORMA4kDde+ZMkS9zcHyZIzCJfUj33sYzZ+/PgoXYH6ELT2 7LPPursokcoEpH3hC1/wVBScN94fzh3vWaEo1q985Ss+HvP47Gc/6/f/53/+x90YiSkIRZoCcQgS AARk8uTJvgikvPjiF79on1d0LCkuyLaZEIOztz8zIgSw41mKLj569IiiK8U51DhmhbWPeWoIdPhL 12xxpH3/DaNdQiB9L/p9UlSTgA41EUj/iAJ0ViqPy7zl61WYpo3c9Jrbpm17vH7xHvVZo4pmEI1O rZu6Gyl5iQhYy5H76tmSBs7e0iRvvpghAAJ/5plnPLCLnEAEhME9g0BDRDDcO8j5W9/6lqd6gEjw 3D/8wz+4hPDd737XEfewYcM8TcSHPvQhf55gJaQLEDWBaYxDxlOQPs8Rr0B+IZ4ldxDXIE5c+/3v f28f/vCHrXXr1k5ALr30Ur9H5lLmSOQzhIhnt2zZUuwSSx+ymELAIEB/+ctf7HOf+5zP6Te/+Y1d rsRpiWRw9nZ8uYQAxF5wPMpX8vrrK+zw/m225XBd6zuUdBCFbuwlURd1iAm4wRZArWHiCChL2VUq IXT+JJJrpoyOFLbv162dqpp1s9lL1ko1tN4+fsdltmrjdpsrSeDKUX2deCxfv9X6qx/xCS5qEsxz ltrZtE+cpU9OXnsaIJCpRAvi9RTEQtAkggNh9+3b1znvJ554wrlnGhw4Cd7g/MkLxDOko4Dbf/31 1x0hI01885vf9LQT5BQi7QREgJQU9AehQxwgNkgHSBUgapLVkdmUmtz0oyE13HHHHZ7e4j//8z+d CBD/wHVUSaiiUD1BIED6EI5g1+BfIqKZD3Pg2z796U/7HEmlkDhknIYNV4Ehy8WuGH+ztBF79R9i bff10CbaaUMb1vdNA+e/cNUGLza/cOVh/zsSA83VRCuVvZH6xEHBn9sgxyUFNjSpJ/bsP2itpAKa uWiN2xkIXON3KplhU2gh11RyvhyVJFFfxWkqHqpTAUiU0ZW5wm1leoir/sZkhHMdAiDKuHE2XvQl 1BYIxl7ugZjh3MvSu8e/Nxhr4drR5ZPemRQT5AP60pe+5Bw6CBWETeI5xkS9Qg0C0k/Th7QDqJF+ 9rOf2QMPPOAInfTQcOzBDkDdAewLIG2S1lH4BOTPs3DzEI5/+Zd/Ka6MxRzJZgrh+PWvf+3PgMhp 5MYBH0AEUBt96lOfsquuusrnGj83SBwQI7Kg3qj0yUgjnC1y6fBNEJzknJ2d3V8uIUAnU6tWbbvs imuibHikAhJGLlBGUjaWOwDpBxtAyhnIv4Tsoyf8p4k0S2VkVD/cS2lICDTUSziO1qurZ0RMyGKK RIERmSRfGJcJQDsbjW/AqBVCvENFpzAX9JqZphJIn38w5IWx4/fTK0yV9u0gJPrFw/vhHkO5umC4 A7nEk1GVVa3qbMD3fHtnKB5CJlAanDhINjRgPm/BAtusVNC1xCEPFhJvI+RJEjkSwZXXAiLEAAs3 DhEBSaJmQf/+hz/8we0HSAIUgWFc9PUgaPqTNwjpHeKB3h47AknqSBwXVC9cQ0VD4wyTMI6EdNgI uI50EKqTxefrBXnEycPt33777U6E+Jv9+9BDD7l6Ce4euwHzTk87wZioriAQSBbB24jvC2ehPPgk 908PBE5NCIhWA/NrAY/IPpDeiDge1LtzsTvo6ZmiRGClo3BCU80v4NtInldeCwQNhArX43mW9Dsb O3hYlDYGSCNwj/zLAQ0HnXsgEwgJWSQ5FOHggMg5XFyDS+LveCnCoMtFJ4wBDm6Ogwd3xSGmSAlz 4+DDVXKPdwcuFnE+EcXLW/WT77Nm6Nrzxdm+/757LVvqyldeedWmTJniBlgaBV26iDu+6/77bbc4 7NeVMri3snrCaVekkXgsEPqw/0DajENK6uIiUNoj7BNUPejnIRA01pp8NOyjL3/5y8UlJNHLhwC2 0I9/QfKhqAzPguDTjbc8hxQxYcIE36v8MI8777zTxyRRHnNmnqUZfrkGAWE/By8m3oW6KG6Urgic kr7VA4FTEoJjWtAj8iLI1mYSJi71jSeTh+qZ2JkYpaYkjaNC6uWJo0HMZ9ODaJEQ2MzoWikWAgeU LvYHSQIOiOcRf++77z43/tE4aHBsiMeIy1SRgsNjXBA6nB/IBREetcACcZkgcBA7/Ti4v/3tb/3g oxeGk6NCESoCxH0OJDpcjHBwkxQrCaUQKSgCB5l4aWS+y1jDyIi6w0aOmWC/e2qS9k2hDR3Yxw4c XOzEl73RUUTgKg2bJTVNfenC7xMX/5jKCw4TzCvSghto+jMQ9dJiBtL98dl/IOSA5MMeD/aFiswl 3pdx0pPUxbOalpd8jvmnZymFKCTt7EKgdEIA950lj4LmTe3gAiWGk2rogkwHqsNdr5Yih3MbZqR4 AnEifgdPiqUqCvHwww87MiaHewjuoR9FOigmDVf+3HPP2Zw5c+zjH/+463y5DzdPjnF+vv3tb7vR DK4fokBJQpB44NB4Fk4Urh6RGoTOmMyFNMHogjmcIXoVF0AIEwQAogL3/8orrzg3B5fIu8ojfmd3 W557bwf5An+Icc/efexYbQU5appk3s0uPOr3ILZXKmVwjmA+RTryVjfdZAO15m3EOFQUAZdFpJ0p 4TSmVLG4cIcW5fCK7qUj75AVNdjxSoNwGDvJ9XXu7b/TPaMyJQI2Rc/rrrVCGbsuSCKQgmzNbOwP fnrKhXVQDcFpwbmDzDmwIF0Qfzi8HEQ4f5AGyAFjGkSB+3iBwO3B6aOrxe2OcSkwgoEQP2s4Swxz 9OeH/PCoiFAlgcjhulAHoatF4sDIhxseXCnSAY0x8AZBiqHwNcQK6YV5ow9GKgiEq9wPTzo4BCCo u3fnWbMGteyq4d0d4WZr/0x7Y7MbblETrpfk11qSYhf88EWc98nwukPqO/ZIRRpEPbRgQGaPHlUh HLSZxOKccM4QQyObHLY3UsCE9C548VELnLoJm7bnudMGSfUayBYH/eD6YXnoUVwnOysy9hVob7Jn EkahIqt1dvpW5xqdUjUEasQOcMG3DIgAMOBAglxR1QQXO1Q7IAiMhmFh6MfvBPlQhPzv//7vvZIT ATjBAIjhD6Q/TWoDPDsYD2KB1IDoHMR63gtXj/hNYXHeBQJHV4x0AaePIRCjIQQBZI/BDmkCVQbE Cknj/e9/vxMdJAjGS9RCFdvVwAvprrbUiU88+ZRLciBMpDVgTnUviAE2gmby2x+oIKl98ux5Rh47 TbRHgkowk7ci8W3fpoDNFG8Cn99KqjwIwfoNO+yXT08V4q/jQz102xhPm/3azGU2Zd4q69e1jd04 tr87brytWuLrt+627XsOuOfdlSN72aDube3Xz00jY7YX2rlmVG/r3qG57h+3nz0x2WsxfO7eCX4v 5P7KZM5Jn/MbAqfG8mTdPL+/r1pnHzh6uH8ayD7oO0urzgTCxoCGKx/RlvPnz3dCwEEPBj7ukSoA Lh/VTZAOkCaQHHgnHDxGtrjemPfhhUId2lBNCkSFyx9EBVsChID3MBYeHbjsEVwUn3e1AugiGAy7 DcSbIKhQ3B2ijqQF3Pl9muw5C+QieRjYiwjgOZSpZ1m2xpgzZ64tWr7aVPPL6gjhE3A5fEh/Gzdm jL08fYktXrtNDhqSUESUHn91rt0+cZD955/e8IDNbbv3u0v2wG5tbKvKbr4xa4W9+PZ7dsmgbore V0oKIfqfPT7ZerZvYUvXbdNejOoyP/rybBGNPYoJUunDPx63e64c6jXEEzXRRbCp9YkXAbtf9YU8 4QYbdLMn/Jc4/GVx1yANnkV/DNLAOyIY1ngmcInBWBa8OeAu40if66VVoULXTwvGO/qFBHlIFMyN H4gGQUDBG6TqELk4R4hUQdnuNQORDSrAuAsxUsEVqfuBIEPkM5XAUNes27jZWnYbbE2Pb3MpY3/2 Dlu1brNdNq6GKv11taZyu16q2t/rFZU/ekAXL/t67ei+9u57CtSSqufgoaPuej153kpP3NhS0fpN GtZ1yWDBys0uHQR37fnLN1kbEY5tu/e5BNBWfd+YvcLGDe7m7t2kl0nahQ+BhBBksMbxerCldS+r slTQwYecK/wdj7QMY6U/H7jHeK6WU02ztPenF7FOn0sGn510KQMCcSLO7xDY+FoBe6QzGvdDUrjM AIoxuMh+8ZMfWbfWDSTZEXC52u697TpP6YIWEz3/W3NX2o2XRiqgbqqrXF/BmCD1BvXqeOwN9oOh vTrYzxa85ZLD5h377MFbxijKH5dP2QyUDHKbCMMQSQMQkc2SHlAvdWjV2CYO7WEDurV1e0HSLg4I JISgnHXmkAdD78WxJZKvrG4IBP/7TMaFcLRo1lTpVdrajl27FVm/3UYM6GFtWjb3oMoxkgA2bMtz ZP25ey7zwEui+Nds3WXXXNLb64jvUk3lti3I2aWkjuMHOpdPtt+tu/YrmWNDu33CIL+GHYAo/j37 DlnzRvXt/mtHuJSDZAAhgchkaD7L5NOSPucwBBJCkMHihKRbGXRNuiQQOAkCINdM6xG7Gm/UCJsw fqyrB3kWFROqwe279tpbc1a6d1CfLkr69vbCYkTttTyUIZh28Mgx2QaWe3qWTsr+26JxA1cfbdu1 T+qh/eL6m6iyYH1H9iR2fHXGMhGUyPiM5xBzfVuG5zEDu5zVOiDJVjpzEEgIQQawjtsIMuiedEkg UAICFXXzq1GjpkfTR4FjNaTTjzL91pfbJ8jZvfl0Lx5DUBrIsTdE5V+jFC+hIBR949fSx0HywPU0 SbZ48WzkhBBU41qnH5yKIoBqnEoy1HkMgWB3SP8E4gNaNlWNcN0Awcf/jfeNq3NcvcPNirj/uUqo qFxCcx6D+IKYenXil4QQVGJLBLfBEHgT/kWUx2c/qAFCPhYIBAFFiPdx75GgcgpeJzwbiElI+lVa QjqmHFdXVSXxXSU+P3kkAwhURYoMSQLjjEVwIAi1vPEKqqVgsXw5IER5ryKVTrZ+8BwikSNuoZ4a HoO1rvPMUUka5bYQv+ASSdLOZQhUFzFICEElVhkPEYLKcCHE9x/3UBA2qR1ID0y+dRA/ybiGDBni Ol6Cv0IOePrzHC6ejEFQGn3w9SfYKxAB4hWIHk5fbBA/ud5xGw3lCkNZQnTM1bU5KgGa5JEqQoC1 Yy0PHNgvt98IyVPzo3GjxlIX5dt8lXKduXi93XLZQLcDTBzWQyVi99pM1fWgoNPCVVvsE3eM9cAw YgqefG2eXTa0uxeHongURuhkf1RxkS7AxxNCUMFFhQiQdO6f/umfHBmTMgLEDeInLcSsWbOKC28Q REYwF/ngn3zySU8AB2EgsyS5if7rv/7LDz2pCcjjDnHAzZOx/vSnP3n6YQLGIByhgRggGuSMh/BM nz7d4wTIV8S8CD5LMotWcFHPoe7sL3JYzZn3nqKHqe2dbVu27bBRI0coMK2/zVm2wR6dNMveUdTw mi27be/BIzIG17fl67bbL56aYseOK/pY8QVf/8g19pM/v2lT1e83z73rHkP//NFrbUiv9p5SImkJ BOIQSAhBBfcD3DgIn2AupACQOMj57rvv9mRx5BYCSaPmCZlFSQNBYBDpKZ56KkpP8MgjjziRIBUE BAVCQVGR0JAgIApIHkgKocYAKiECmviBEEBMKAQC8XjjjTfshhtuyKgASgU/O+l+hiBAJb9FS1dY 696jLDtvlVKHNLX9Wc1s7ntLRQgGuAfQtaP72Kvy+cdNdETfjh5ARiqJjTv22hERhufkFvp3d423 Ns1zFRRW32uD7Nl/2GMMKmQrOEPfnLzm7EMgIQQVXAO4f/L3kNwNQgD3TWZJColwHbUQXD/VoiAI JIcjFQTlBFHz8Dv6XuoakCSO+rJ/+9vfnLCQggLkjmSwePFiT02NVAARieuLgzrq//7v//z9SBfX KuvlyJEjXVWUiP4VXNRzqXtK3//oH35nAzs2UmBaM3tx6nt27WXDPd3D46/Ps7WbdtldVwyx3zw7 zXKF3NdJMpgt1dCBA0rnrEjiJlL/QARA/l3bNbO/vrnA2rdsbBsVf0BEcdISCKRDICEEldgTqGLg 5EHIcOpkBiW3DxIBNQbI9Q9yvvfee53rhxhQHOSTn/ykEwK4epLAgfjh+Ek9DWePageiQsoJioyQ lwjCE1JJMFX+hlj84Ac/8PtPP/20q6lIYMd1VEMJMajEop4jj7iNQAbefVtW2bNL9ipYTBJoqxZW VzECNeVWesWwnrav9xEb3qejB4mRV+g92QWOS93To1MrRRgru6yuYSOoo2ewC6BiulS5hj53z4SM U12cI+BIpnGGIJAQggoCGm4e1dC//du/FRfs5hrIHWLwxS9+0Tl96gagGgrc+de+9rViBI0kQQI4 EtKRuRJOHoJBcRnG4RnUR/SLF/1gqiHtNbYD6sQiKXzve99zAkJaA9RJmea1qeCnJ93PAARgMsaP G+s/+Rj+U2nOefWevQeUXVRZSNUOK7ZgcM/2Nm/5Rk9B/aMv3ukpp/EUKlDwGAFh3Gd/DOzeztNS LFyzxfopEI0U1onUeAYW8zx6RUIIKrhYHCA49IDk+ZvDBvKFk0dXj0qHFjKS0of+IZtouMd9kHfI Nx+vD3CqYB7sD7wj1B4OJTOTWsQVXMxzsDt7hT2Ep1ADL/SdCv7SXA8cOuJBYUQE11X+IFoRjgq5 tayl8gtF8QOR7yeSRIN6UQ0EXEtJG+GFZ1IxAufgpydTOosQSAhBJYCfXhYwPkRZ3Hg6Zx+eyTQ9 cfo0488lEkAlFvEcfoS1LW1f1JXaB5VQpYt3i0YQR5Dsl3N48c/S1BJCUEnAh+Iz4V/nvDwLpcpH pTgyuC/C9wn8gdMjoAfujGvuBqq+x+XuBxcHB1ggLo773CORGI3rpAoIf0fSR8kwUUR9xvC0AyQN 0/0i/TAWXCL/kkmSoKL4vMk/Q8gQ8yPoKJpX9HdUEJFS1aq5kJpLJUGVPFZNEGB9yDOUtAQC1Q2B hBBUAqJ1lPI3XwcSf344tzpS1RyVPp9DunlzlKe+s5J9gWjR365RYRGQKxkhDx7ONzg7csms3pTn KQPov333Affw2CZ/bxBv+xaNnfPbK88PEoV1VyERkDLvyAlqAU9mVkMBRuussfLNH1ayMXTBJCDD VXCn3Aubyn1wZ95BVx3s3LvPg5RyZUA8IJfDrqpsdUR/r5XXCdknc/QcBGOLUhKH2rc5IjKMkbQE AgkELlwIJISggmsL0p4xc5atU21aPHS2KDagbZu2Nmb0SJurfPAr1m9XPviGtkRVpJAO2ind76pN O53D7iLEu0HBPjeN6y+Xvx22aM1WR/pUgjpw+KhNW7TW6pA2QJLD6P6draPSCD//zmKrrWsEBEEE SB9AKcJAECgysk4+5H+ctMZzBkMkrhvT1wnEYo2/dssuLzBy9xWD5UY431XIpB9u2qie3XX5EGvc IMcmK7c9RIEIVPzR/0uBSCtUErGxCAZZLj9/3wSrJ+KXVKuq4GapQPdIf5+kdKgAyJKu1QiBhBBU AJgc1KOHD9nL77xn77/9envz1Rfs0nGX2y/+8Fcb0K+Xq2RA0OR/wTgnnO3lAG+9bJAj/D+8ONMl AO5RJ3Zgj3Z+bVT/TlZL3kI/evR1u15IvK7KE1JmEK4eTxBKEf5p0mwb0L2NI/0jGhjCAefPfdQ/ y9dvc4LCNSQBkDhug4tXb/WMlQQqtWqaq37bJX2Qlz7XI0xzhOAHqo4t1atQQ6Ei4gfJAmmGPgkB qMAmqWDXkGY60yJEFRw+6X4RQaAqjERCCCq4UQD2zt15Nm/+AufUV65eZbv37Cvm5gbJVa+j1EIv vbvYGgoZB30/nDtIGz0+kZ4QBjjxkf0iIjBn+QYvLIIxDwS8VgifMoOFXiQksh0QJLRWaqZccfH1 lJLYkbbu43dOaUGqUNUTIeCdTcTxb8/bb73kW46E4s8L+e/VmGs37/aI0wb1avvfSDLHRLzITZNV M8uuGN7LrlP06lERgUnTl7rtImmnDwJ4fVXlEJ++mSUjn08QqIpLcEIIKrjSWQog27lxlf1u4TRV hcqzbm2bWmGWEL4QKBz5nKXrhYAPFCf3IqKTdADZQsQ3ju1nrwix/vmVObIVHHXEe6lq0L6zYI1K CB7x0oK79u53Hf3lw3t6DplXVDTkmbcW6F57Ifxa1kZ2hkOyM6DeaSXpYn/BURvUs537lyMpPDNl oTVvUt8lipF9O3tB876dWzuH371DC6mY9tnVIjh4n4CAiDrt07mV17T9yxsL7FJJD82VxqCFxkaN dVjvwb6RtNMLgaoc4tM7s2T0iwECCSGowCp7pamsbPvy5z+l1A7i2tdvsk7t27qhuFbtHCHQIuvZ saWXFCQnDFw/P5QFrCW1C0h1gNQwGGqzxJ3DrTNmr04tXQWD9w8ZJPEBB6mTPKxzm2Zeaaq2IkW3 qsA4kaLYHFDXYARGrYzaB6SOpAEnz+94CKHqgQhQfWrT9rziSFRURgQdrdq40w3YGJLhSHt1bCGD 8kEvX0ig0qbte106gWhRFCXJU1OBzZJ0TSBwHkEgIQQVXCyP1BzQzxF4P6WBQKXCtfz8o6573yFp AHdPkDQN/T1/00DswYUzlBYJnKCrnISEg7lwkxKIBZdQEPuu1HhxH/KTuUhSFqdcRjUe84FIIAUE PT/cPYRos8bnnUSivrdyi+N4d31NVTUhtTHPQgB26N3YFAoTSlDB3ZJ0TyBwfkAgIQSVWKcjR476 U0eP5pd4GtXOqH6dXSK4UBreTrjBYrtIfFpOz6om9oHTA9eLbdSqqBcTQlCNuwVkmVEFqGp855ka KiECpwfSEAGSBZKKPF7gPv57dUYCh2p6VUEapwcSF8+opIihABUp6/EW69JFdagJBFUMD/uB++Qr y8vbqzT3zZTEsoXS1xz2Pl6FTs+slfs62QpIcEn6Gn4noWVIV19RaCaEoKIQU38Wg2Cy0Eg5wSKG 6yGdRFi4cOi4H1IHBC4wvrhhvLJSDHA/zj2GcUlUF5BF/IBzPZ6qgDmzUZhfuB6C4sJzYT5x5BPe yb9hzHiOpfh7PGI6FWhXXF5R3x3Gjc8HeFQnkqvEUp4Tj1CpbteuXb5/gB+pxVkjChKRdygQhYAE mHRILhhKo7Ku5K4i31Uoecq1kA4F+DMufUKZU0qpJgThzG4BYA8SX758mSeNPHjwkNcbIXU9iSc9 Tkl/7/Xgz3zbsWuVdewwwCZOmOj2QAjIuypGVaRx6mo9J0+bZj2Vd6xfv35VOksJIajgPuCg7t27 1+sJhCAgKDKZRzlY1B3o27evH0DuczADgQglKjmoLDhIEKQJ9ecnINxWrVr5eKUd0oA4w6Fm+mwO xom7IYIEeDf9QnbULVu2GD9smjCHDRs2+AbkfYEAgZh4LswnvJN30J/02/TnG8N7uEZjo69cudIz tIZ3gNRCzeZAJJgr7+FvnrmYmxv3BQN+WLNpOtyLFi2yQYMG2dy5c+3DH/6wpzoH3qwfyLxDhw6+ 3u+++66XLN29e7dzhKNGjfICSOy15cuXG1XyqGfBGkydOtUr2tGP9Rk+fLivZUIMzszu4zxxVqlV MnHiRGvdpo2fuaXCGaSkv+qqq3zNWM8bbrrJtm2dZbXz1tsfn3zEmqtA0ciRl9jb77xj7VVz5IZL L7VGSoW/6IUX7FnVRmGsuBRZ0S9KCEEFIcZhhXt7+OGH/UBywDh8lJ+kyhiHcPDgwV657LLLLrMF CxZ4BDJpotkA9913nx9yqolBOOjTrFkzJyCMTT/aRz7ykRIUnsMK8Xnttdd881AY5+Mf/7gjW8by eAXN5+qrr/bsqFQ44/pDDz3kcwGBfOc73/GNxob72Mc+5sjliSeecKQAsmcMCtxQ24CymtwH0S9c uNB/KLTDJuW9EMP169d7vxe0GdnYzIvxQDaU8Lz11lsNovbss896fYWXX37ZHnzwQX8ftZrpR7rt RCoouQkhkNSziJwQoip4wJs9BzKnWBHZZyEQ9HnzzTe9kBH1Llif73//+74HIbLUuWBPsE7sTWDO PoLQJ0FsFTz8VezO+ebcDhw40PYW1LHn//KmvBBr2m1XjRUh3+nrg7Qwbtx4e/2Fh21o1wPW6Ogm G9S5lm3auMZ2d+/p+OEj999vq775TTus/h31+wSt7QIRkgnCJZVtCSGoIORAduj0QGZwXej5QOgg YQrXU1tgx44dNnToUD+I/M6h5hmQPgsJcQCBw61xiDnAH/zgB30mHNK//vWvvmHg9oL6hFoFY8eO dSQOl4j4iCRCVTQ2GIc9SBxwjiBzGhw895kHBWvCvJkrGxKiwXtALCBtEAnP816+CaLH3EFG/E5J TvSSFNPhu+H0+RsixzcjKYBkkDIYG0kHIgcnxLdzD7hQxzlIT6FqG/ME8V3MHCqwwWbAulLWlD3D 79QxZm9QjOijH/2o/ehHP/JqeEFFxPqwJuw/mAj680PlPCQL4A/xBb6sCevF2KRBv5jhXcHjX+Xu MD2cgWsmXmJXjh3u41FEaNmCGcXqZVxNNs2fbrU35tmBohrW//KvWuGmA64qwpOvlta6QJJjns5V J52z+jpzePtVxekgIQQVXFoQJJww4nZQEYEM4cDh/EGeHFhEbpAvapJ77rnHEW0ofM/h5QDCpdGX 4jQQlMD1wxGCsDmoLG5IQ8CYbKQ5c+b4e0D8IE+QPsj4UomLGB0hMtxH0oDLgHCAYEAoVFYD4YOU GZe58y4QRVBjcY+5vv766z7+dddd5/f4XhA9YyMtgMjbSCTlfYzPd/HOUKsBYgBMLrnkEpcIGIt3 872MBYIKyMyLtEtqGTBgwEWtKgK2rEtubq7vERgPCg9R7Q6un2p3NIgsewppFLUQhJ161TwD8Uca BPGPHz/e9yKwnTJlirVr187XmvGrgjgqeGyS7oIAZxeV3syZM30dGzdu5FXnli9d4jgFlS3ndcH8 edag80Tbmb/bhk+43rLrNBIBWOpn67j2xmzVQO9x113W46tftb0i6G9JUoeZqgpBTwhBBbcoiwmi g5vmQMGpw2HxNwcPrhkkCUcPxw83DZF4R7o9kBwcHWOAEClqD/IEidIHRAkRAIFyeEHQwSgLAUI1 gwQBV05ZS1Qt11xzjW+CSZMmOQcIYka9Qx9UNiB1DFEg8lAmEwLTvXt3RxggGtQ4EC0aiJ75//a3 v7WePXvamDFjnPPnOtzmM88842owDF18O8gJBARMgAMbGcTPsyB7EA/c6qxZs/y7eA5CgAQDdwoM GAcixQEBXvS7GNVFwaB7lw456wiiZ93ZSxDS+6UG6NGjh9e4hokA5sCSdYTAswdBKL///e9d+mPN WFfKoQJXGBL2HcgIBgXJA8KRtDMDAfY0Z5ra5b/85S/dlogEzloEDUKkJXjDuvcbbO07drKd27fZ 8gXTbMKECb4XRg4bZm/pLO3SmW4qRnCeGEnwB2c42AIr8zUJIagg1DiswThMqUkOLMgfDg0pAc6W hQn96ANy5G8QLFwYBx3xEBURSBpKD+Kk0Q9iAPKNN4gEY8Ph8U4QLMgTgvGZz3zGJQueY278y8Gn LjLPcdjhGNEpswmDYRhpAD0+SCNIG3CklNlEsgjV0wJShujwrcFL6H3ve59LB3wvSJ3+PMvfwbjJ 5mTOPMe3s5lBWkgREEHGgFCAoJgbnOrFSATS1xopLEgH7A0QBvYl/oWgA6fgIYRakTWE6ANvmACk LdaEvcC+oT/XuQ/cIciMH6roVfAYJN0rCQFgjzTAeUQLwJnAvsa5DWfpyiuvcqZv1fIljidQB3Om uM85gSgsE9O3Q+e/vTQB2IwqW+AqfEZCCCqxoIGLBmmzOCCyIPZxLYho9ON31CMBydMPJMi/cAFs DJB+HPGXJrIzFocXRBrcU9kUPM8cQO78MG6YF4c/EBaIB4iW/uH5+LziFdQYA6LGv3GkDFIBwYd3 8C9IJmxC/gYh0UBSofE94V30Dc/wLRwA5sS/EMR0AliJ5TnvHmGNwl5h8vyONBUayJ8GBw8sIeDA N7jkAvOw5hBj1ISsJ8gjqOlKq3993gHqApkwawcjB0GncX7Dvg+xBGgOgn0wfmZD/ZNhkgxonDnW tqpqvoQQVHJzxTmpgAhL467CIY+/JiDXspBeWbq+eE1jxgt/l/aOgFDCe0srr1kWF1HWeGHjhTHj RC9cK42bTx8vfF/8+qliJyq5ROfNYyBy1GNVPczxD4ZgJ+3igQBEIwQLVuarE0JQGaglzyQQqEYI oJZDGqpOQlCN00uGOg8gEGKaKjvVhBBUFnLJcwkEqgkCSEYhjqOahkyGucggUFUmIiEEGWyY0lQg GTyWdEkg4BCoiFtf/ECHvDFBBRhsK8E2wN8QEO6HyGTu8XdwOY6/P8SHpKvvQkR6iB3h3xCRzu9B rRhSjMRVlGG+6d9YWvqQ9GvpfwdngtJUlmGOfGcwovNtQR1SGozLGi/9mXQkGsYqbeww5/R78bUJ 8wLO5X3zuXJEEkJQzkqwSdC3VuQwnyuLm8zj3IEACCyTPRSQLP3x/QchY/THQIyrKCokjMB4YeEp xt7E3RaPIa7hiIBhnn2L51dA3iAlxgGJoooK6SwCEgwBZyHgkFgVHAYwbPIvDhHMbdu2be6RhuMA LUgywauFayH3VYgt4Vq4HzzqQlR+PLo5eDmF+ImAXMO/IYAT91e+ASSLnS18YyCMwauNufMDfOJO Crw7no4lSGRhbmHXcD04dgT7H3MMeZ1CahDmggcfcA9G++AWDnzCfIKjR9Dnnzu7Uynoz6XJnKtz YTMkLYFAVSFQHiEIaUJIQQLSJjUHe+9DH/qQB4jxgyspaTlATKSbwJOIyHTiSOgLQrpJeWrwICOl CMgNYgJC+vznP+/BhSBxEBouqvz+6quvOmIkDgUXU4jC7373O38HQYO4QOOijPfSc8895+6/eLyB AElZgWcSyBsvthD3wFx5DgJCI7UJOZTwdydwCndrAiGJUwlInfFDvA0xFMSlMC6R7zwbJJNPfepT /gxxO/QnvoVvhPDx3aRpwPgOvIERrrR46EDEuM5Y+PDjXcWYxGnwLsajEYdDI7IbQkJOJuYMIeJZ 7hPDwxjA/A9/+INH+uPpA0whCMT7EPsBHHAXBw7AmnghMgScay7SCSHI4HSXd4AzGCLpkkAgYwiA 3JEG3nrrLUeYIF0Cw0DQcMAEE+J7Tj8aHCrupnDzIFOQPAiOQDOQEhwp0ceMAWLDL53+eCsxBvEs uBcTZAgCI+AQxMhzuByDwPB7J5cWAYQhRxbXnn/+eXdrBjETaMj7kExAriBLUlzAwfM+5sO8kGwg OCFxI9IO8+Nf5gZC5v1PP/20x6DwHISBVC0f+MAHHJkTfEjk+8033+ww4psJpIN4QSxByiDqK6+8 0hE474SwknuLdzE3EDrEgIAuvp05A0uIGbAmeJKcTfj7EwwKHoBYBpiEZIrBUBuyuhItz9oR3Ecq j1tuucUJFePxPEFjSHZBWoi7bme8Saq5Y0IIqhmgyXAJBKoCAZBNyMuE2geOOASEgYBAGiAqkCgE 4cYbbyzOUQMiDRlfeYZAI1RGSAlw3jTyEYEkCWQEOaMyCUF8cO0gTt4L4oPDBqlxH2IAsv+P//gP nx8Il3cxBwgAyBIiA1JkTPIdEQUNAmS+qJPgqpFmkEBCDAqEi8ybEAjmSH/mxVwIduTdECmQPJIH xI4EiBAvEC/XGJ/+EEzmzJwgKEG1A+IH2SOhICHxw7gkSLzzzjudcPEM4/HtzJ93IOFwHZ9/JB8i 5pk34zHHoOIJgZfAHMLC30gREBcIGYQQwg4x4ndgGuIFWEcIaVWNvVXZc85MVHWA5PkEAgkEqg8C IBM47RAJTDoJOGQQL+oNuPFQyAauEq4e4gBSBkEF3TSIBoQE9xwCFkOqcNKHkPIDRAdy5l+QO0gP jp5niF4lujXo+UFwqFjgykHWIWgNbpffmSPEIiS2YyykC4gEyPs3v/mN58JCqhg3bpwjPuZLGhTe wTgQEogE8ySHEgQANRmEAvUPcw15uEi3AYfNt4OcmTeIF9XQH//4R1frMCaqGcYDifNdIV6FgCyk qpCTi3eAkCEESE4geeaFtBHsBKxySOgHt893oW5CFQURgthBVLjOc0gDwAZVGvBAAkE6YU4QRAgD thgyAZ/ttCoJIcjgDJ9tap3BFJMu5wEEMlEx0gekBZKEKMChg+RISxC8aUIgIpxqUCughw5GVfYr 10NuIvqjSwfhf5VEZeJm4cTRW6OCQXLgWThmOFd+BxEzD6SMYJRGzQOSBLGCJJFQSIbHvFDHQIRC ShEQLEQBhAinjV4fJEs/EDLImznTIFjBeAwHDYEDDswRRApiZa70gfCFiHfUNhBM3hlsAhAT5hQM 5/EMq0GaAmnzHHPjPRAr8mVBDEO1L2AeUnuA9IEHcOQ5vgfYQizox+/AifFCRD0SCQQ7GKVRB4Ua InwP34gRnn/PhbQqCSEoB4GwUcgVFES58wDfJFOsIgTgAOHcOPggr1BUh2GDOgDkyN4IxtCApENV MFQyQQUBAmIc+p6KGHAPZAHyCsV6+Jd5BLULc4h7t4TxwrXgOcOckSD4DggDXHgYA+4T5AtChQig KqKByOFqA6EJxmsQXEhoBvEJEeHBYyi4mAa3Vp5jHkHNwvWQ/iSkReF9IEBaSD3ONzC34P7KPd5N i6cs4W/GxG4Q+sZdTuNpX4BDfDzmHNKeBw+twOgx3/i3BzghKYQ0H8wVtU88tUNI5RL6MD/2EBJN gFWQKoCLZxEV8YLIoSqKP1fFrVvpxxNCkCEhCG5qoTRgEMG5zqYIhT7YVCx+yP/BwodDzeKz6Jlw hpVe0eTBKkGA9UJNsG3bVqsnzjdPJQNRSYTEXqw3apXgt4+qInCYrD0c9Rzpr7PJCUVabiG2kUIc HPpANE41wcAJl9Yn7JvS9k/wQon3CdJCfMz0Z3murMRz6X35Oz3NSWlz4Ro/cc+YgKjjz6fHCwSk Gf/2U3nXnGreYezSYhLSnwvzjb83/q3p/ePEgmdKe0d6nq74usRhkQ7PKm3eKjycEIIMgBcyf8L5 4P6FYQquAC8DRHe4HYxJoUgNXAjGNkRDdIiIliw4nAXuZYFYZPDqpMsZhADrvGjRYl+v9p26WW6j XBvbqb2nfQaJI8qj9+7Yob0NHTLY13H5ipVyb5wm4+SVvsa4Ol4jlUV/vF+kO35F/WdLD3yr9NVJ SyBwrkIgIQQZrgyHHiqPIQ+ujxzvGKtA7oh3jzzyiF8LwSNf//rXnXPEOBZc9dBpkoc/HkST4euT bqcZAkGvvnbtGs/rv2KrjKdbNthyEXv01kgJcP5ZKi3YqnMf+8UTb/qMLrtkkHzju0jXvk3eOZvt Enm+9JQefcu3vmVF0mnfJnfF38jHH305uuGkJRAoDQK1axFweCIK/TiZfcWYFOpiVk15YhWSobbw tAEvIQQZgja4omEowwMA3WUgDHgF4IWA9wCEAUkB1zkIAVwinCRubQkByBDYZ6lbUPc1EfffbPcu a96qvk16Y45dcdnYYpfJOnVybNSQ/tanZzefZf26dWzKG3l2OFXBbYQMrLXk0rhSwVutJP3VlZ6+ Uap2wFn6rOS15zgEYEIWrtoSGZ+bNLACIfxmjerbxu15lls/x/bsV52RBnWtQU5to4zl6WgJIagA VFkwuHt0hBiC4PBws0M1FHy2iTzE2wD1Ea5heCHgjUBEZZKqogLAPsNdIfSo9NDf1vJ6EUWKwp1h A3p2svnS+bPWrB/eKLt3brNWLeX5gi1Ie2GVGAPWvKOYgDki/i11oEcoMveI/MU3KPBph54JhtEz /FnJ685xCNQUt7999357fupia9+ykc1ZpuC5Ns1sYPd2tmz9NjtwON/2HjhsbZvn2oM3j3bJ4HS0 hBBUEKp4L2A8whsDxMDvuNQRgIKLGcgEtzrc2XBLQzWEpwTX+UkMxRUE+BnsDkeGZEfUKWog3CkJ /iEgi8AtHAJQA+KHjyslasBQD5r1xpUQv/g3JQUMk7vgLv39lvzieyvVAGuftAQC6RCoYaici2zT jjzr3r651zDu1bGlEH6hTZq21Lq0lWttgZxR5MQgo5QeTwjBWd9FIH18n0PIOKqEUJIRpIG7GS0k qoMghFwqQQcdMkqe9Y9JJnASBJAGINoEGhEMhNcNa4qPeQisgkBwDbUfDVUg0kAg8NiAFikNw0sy MEMohsv/v5UIwrniHZIs+7kFAXD7rr0HrXHDurZ9zwFXD+0/pIqFxwpsk1RDDevVtsE924NVrCZk QA/wDPYEGlJpdbREIsgAisEVjMNOQEuwD4DcOeAg95B5kOHohzoI5BH8rrkW/LITqSADoJ+lLiB/ 1HkUhw8OAiF3D1Pid/zXsQHRWP94WmSeGSKnAA40zcsQ6plkzc/Sgp7jr0U1tEeqn70Hjsg+0NA6 tm5izRrXt2XrttugHu0sp062bd21320HeepDO5x/zOrUilB3owY5LlFUtSWEIAMIwvWjFqiOCONE RZABwM+hLnD1EPSyGvfZG2U1mATun6rPOfS5yVTOMAQwDLdo3MD+f3vnHV31deX7DQiBkIREUaGa XowBg22wjXEJ2AQbO65xEjseZ+zkJZOsl5nnWZNMWZ41K5k188dMJiv9zfwxM4ljT+wkLonbA3dw wY1immkSICEJEE298fZnX464CAmB7pW4ZR/nRtz7+/3O7/y+5/z23mfXGxdMN2KPgD9sqEZP6+8T Rg230WRnZUp9Y7PsP3RU9wXqQXRC6xzoXzzYstWADDOJtTkj6AZBiH+0tB8r4H79+SMQXHLP/8rE uILdgDOCxJiLRBsFhB97AGukUo3GtP2HjslAJfL9IPB6/MjxelMHsUugmWpIPUkzMzNkTEGeDBoQ OxmPvYdEQ7YXxtNZ5GEv3KbXuoQIhayUvXaTXug4UnCkvxrjD5q+PahbeuFWvdqlq4V6Fd6k7py1 MXvyaJlndoDzazCRRlU98tfsyDE0ZwQxgJcsl0JAkzWGYffuUi2OslWTrl2mzCCSvsObI5BKCDS3 tKpnUOsFfSRnBBcU/r69OXmOiHA9gXEpRgmiN0cOrQ+ZNFevftsM9PHQg/bmmGPt2xlcrAj69bEg 4IwgFvSS7Fo8Xnbs2CWDNTq6s0RZifI4A3QHg19+v34nzOsG9VCqNhhAyHsfD2eEVMXJn6t7BGJZ P84Iusc3pc4YkDFQ8tQPPmtwlj5X4qlZ8Io4qimc8/KHSo3+TVa7wPksGp7Rjcnng5if2xkCsewq nRGk2ZpqaWuVYfl5mh45P2GfvLWtRZo0oCadWiwvcTrh5M/aOwg4I+gdXBO2V0wDHXPXJ9JgI0Fc GnyXSIPysTgCKY6AM4IUn2B/PEfAEXAEukPAGUF3CPlxR6CXEYjFyNfLQ/PukwiBWNSLzgiSaKJ9 qKmHAEwAl17Sm/eEIXi1u9RbE6FmNvnKqH9CCvNQdpT5xsuM6ofkuSIvVkiISMLEnia1dEaQeuuo 2ycKBKcnhKfbzuNwQqKOKw6P1mkXFLqnzGnwkOL5IQa4zvKSh+LuHS/mPLyNqI8R6ilwDudHe1t5 5tPemrn49wsh37Jli1RUVBiRR0igTOrcuXPNtsfnfS2Xe7C6WrJ0jdTrGrlcj5EenQJYPQ0cdUYQ /7lM6B4hGA0NjdJwkngk2mAhbo2NTVo4Pn3y94fIb/7y/FYLWQsbkeJ6+/btMmXKlE6niQDBZ555 Rm677TZLjf3kk08aoViyZInAXGAmJDmMV8LERFsrqTYe5n/v3r1WDvfmz95kOwF2Batefc2KH826 +GJ56623JKOuTr6qNbBzNQvuJq13sVIZA/Mfi6u1M4JUW01neR5LfqYSZp0upH0N9QkYRRAJeCbY LVPT7DY2pJ/vENL7jh075Cc/+Yl88YtflCeeeEK+/e1vG1MIOmD+knuJHcPrr78u1113nUmRr732 mixYsMCkyVBbm7oKjz76qKkYYtEhp9FrcsEeFQGAMrfX37BEiftuOXCwWuudDJHPLV0mb7yyUsZo lbwqrXb3Z1r7pOrnP5dqPX+8FlK6Rud/q15H7ZOeNmcEPUUuCa8boFkKKbSeo2m1uypoAbFAqszI iBTTPls7QdZEPYHI37OdC2GPRAefG2EPqiH05unUeG6w2r9/v1W940MlvMrKSpMM+YvUx/xQE+MS rYJGW716tV33d3/3d1JcXGwM4mKVHmEglFAdMWKEXe8tsRHg3WPuCgtGytfumyctGktjNqDment1 2AFmquoob+JEKVEbQblWwyu4804pVNvANhUEYmnOCGJBL+mu1ZJ4ZeWa4naAJXCzFpW6sElL4qFj JL3Dzp1lKpXreSHXedR5lM4jj3peXq6pHSorD0jWoIEnK+md5B4QNY0HaGk9oWm8C0zXyUIerKlz T2vab+A3EcOn6rg1ARc1IGBG6dRCuuqlS5dafiWMf9S9vvbaa03vP3369HY4YAj8BlOYM2eOlUeF GQSV0B//+Ecj/pTaxP6A/jiR04qk0zx39aysf+wBG9avk9smjJc2fU95B9559yMVAAaY+qdF53vr G29I4aJFMvb++6WlpEQ+2rPH5jeWHZ8zgjRagRCCZiUeTQMHyYeb9+uuIFJNjZallZCunTNB8lQv SWtp1vNO6Hnb9xtxtgpr4by5EyxFBeqGw4ePSIZK+3sO1ciO8sOWtYIe++uinjulSCaNKVSilqXq ikotCp8h732qBbkbmtv3BrYzCdsJvaYgL0sWXjxe9aN5StRq0mh2Al+O7MhQ8fzDP/yD6ftRA8Gg OxbIgXBceeWVpkoqUYLAHLFLWLlypTGBn/70p/LrX//aajDfd999aYdlsj0w836pVrd78cUXzYY3 USV/6mVTD53yqQhds3Wn96zaBK7XdTFSd3/vVVXJAf1QIjWy8+6Z8OSMINlWS0zj1ahdvX7d7mpZ fPkcK3OXoTYDFtDWkgpZX1Ity68sMmOyCvKyTr9fe8UcGaGSf5tWwuC8baWVsqHksCy9bIT0U1UT Cw/Cvvtgo9x83QLJVqIPQTp0+LisWf+pTBo32tRC7Bg+3HVAiopHyRLNvz5QDZmNDZTei3i+wD6Q cFev3yFlh7VsX0FhWjICpheCgK3gW9/6lu3OgutgR4kPY/BDDz3U7jUUlsayZctMHcSu4ctf/rIc OXLEaybH9N70zcWhFC41stevXy9vvvmm5ObmCjtEDMd4h8Ec+O3DtWs1i3CbjNT1gbAQy26Ap3NG 0DdznBB3oXhFY7MaYpXwzpxQaGPauXO7jFLJgsIYz75+sF0657xBmXreRYVSWrLbXNnyRw5XY/MA eXHNJ0q2T0nyDU0tMnJYnowvzJOV/+9l21VcrhLtx59mab3eVsnNjjz+sdomueGqMVKYO0jW6fb3 0nnzVZ3UX159ZZWOKVOu0e3upNEj5egxKjUlXkK83prEYJeJ7h8GCxOA+Z7tJQ/pQqJdblEp8TsM hN8hHK4W6q3Zi2+/zBs7Pwy/wR7EPAZhgL+oiJYq8afZLt+K08T2vjgjiO88JnxvqHf4NDSJBjEd kXff+9jcD+sbW0/L+Q/T4Dxyv3HuB6+tlltvvVW3rFovtUONVIgNOsxXX31DsrKHyYn+A6V0b6WV 2ouunMR1KujKjt375LHHn5SCYnWPVDfJgYNyZJCqmkr3VKgOVI3PcajBmvATETVAdkRIfLG4/yXT 8/pYzw8Bdn5dNZgGLsLB7binDMEZwfnNSWqcrdJDoxL+srIKlT4GKwEapARePXQ6OPWwqGrrmtWA VaDqheNSXV2rhlyl1J3UxVNBRsr27ZerF18vo0cVq1RfowW4K87Aq6m5TV54/kUZO2aCPPvMc2YU XqzXjBlbLHU19VJSzTXn5l2UGpOhxckVA7x9zjWQLp7RxPHsK1XmIxmfIyKM9bxuhzOCZJz1GMfM LrKutl4NivVmlKrRv02I/R0am03OadJzGtVuUFNTKy2qyunY4AtsT4cNHykff/yRbNyYIePHTzj9 ND0Hg+fGjRukXvuaPv1iDZbaZnbi9RvWy6ZNG2Xc2PG61c1QQ3OMD5iEl5sx/mSkcJDugnoHqS/8 xsuOrrizaGGO8Yk+Fq4DknCPYFAM5zeoraankmQSQu1D7gQBZwRpuizq6hrU8ydbDlcfkQOVB6Wf 6ug70l9TDTWqIXh3iRp8B6reWb+3nvL4OQVdP9VhNsvCSy6V1WtWS0Z2puTm5MuJquOnbR4wOA/M GCwrbrlDho8okIvGT9LrGqWkdLe04R+dN1yqKg7JYGzHadbCbuDjjz82fTCutthlcAslujgS25Fh sQQEBN57772n6Ya5Hk8hiDqGYs4PUiKMAUIP4ef4IQ1KghkQr/Dcc89ZvAF652BvSDPo/XEVAWcE abgMGpVoN9Y1Ss7gXJk8YZrU19RJvxZ8/vEpOtUalAk01jdLc32TzJoxR040tUmdEpKO50Fk6uv1 94ZWuWrBYiMo9N/QYZfRpLuGEcMLJXPAIDl8QKMmB+fYp2Bekd20Rc+nn7PpRFN1uiDSe9QfnChg 8COYbJEaz7/3ve9JlboHwhyIDeC8Rx55xJjDmDFj2nPL8DsRxVu3bpV77rnHGAnXvPvuu2ZQ5HOZ RqHCFGA2nL9WPU/QL/c0P02qzkU6PpczgjSadUtMljlQk1U1yssfbpL+Kgegdth1dL80ttTLlZdO sohjVEJZJ897Ye0GDUBTEV3jBVpLD0pTW6Ncfelki0HAYxmiNTR7kBqbD8kf39uo6v2I6qi1TSMk i3JkiO40UP+0KpOZWJwvb67fIgP7qfGrPYosagL0xJZ+TbJ8wiwrTpNuDYme4K9Ro0bZB4me3DNI 7aiDyCt0p0aSQsA5hpEfj6Cg1uE33A75u3jxYttRQOi5lp0Etgjm++67727PXgnTCIFp6Ya3P+8p BJwRpNFqgEDkDc2VFVM0UOVAjRLriPoAQoKf/9iRxAtgC46cd6uet+/AcVMJYQeASQwZrOeNyFVv IryMlJUQiTximNx742ipPFwb6U8xJaBsjPaXmRFhDAPVFXXBrCKZPH6s1OlOIxiEo+3OjCM/J0tG DtV6yp0YpFN5qnh2pPbRmk+mvLzcCDd+5F/4whdsd/A5TTKGSgipn2O33377GTsn+iBLJVHJmzZt MhdEchTBHK6//nqL1+AeqIfe0OhUIpL57iqhVF5Z5/ZszgjODaeUOAuiXVhUqJHAA2Tq2OFmE4Bo W/lK/QcqnyBdFhUXqhvnAJk2VgPHOjkPHTNEJCdniOqbMyy6eFiuEvCoxi7A+lV1RIHmT+GacYVZ ZgzuTN6PlNHUXYGFPEdS7qZL41knT54s3//+9+UXv/iFvP/++5ZSAhUPKYYJKuLfYAlBh7gXFhaa xB/mjPnFDXX58uUm8ZuKTncD5B1CjRR80R9//HGZoJkryUOEkd+bI+CMIM3WAOoHCEQkFiBC4lHd RFQxeK70V+IySA2PGl2shL7z8wCNDJgZKpWSzVRTQeD1YsL/yT6VhkcS22nGU4scjuTJj3ixBNBP 5TsylVQ7dzihKoyMtPNkIWUHKSL++Z//2Qg4ieWYq3nz5hkWDzzwgGEJjqh5YAqBWTJXEHtUSuR1 gilwjB0BmEdHJ8MogkE5zZa/P24XCDgjSKOl0aLqnL17y9SjJ0ujfBva9fCohSDoMAMMtRCbPXv2 aZbSLDmu3kVBXx85DwITcUVEB41EiepikF5fU0+BlIhWJztr0Em/5n6WdK6yskqF/FZLmtXQSFbF CPOBSA3UxFpDBmfa7sFYjHaSjgFWwdMHvT/Pz/fg8hlh3mR5VTuP7gKCJ1D08mXHxYdzwi6ho5sp eJOgLPSdRsvfH/UsCDgjSKPlcULVLRDs8uPNUnao2VLakiG0ueWYXDt7gozIj0S34t0zSIl+5Lwm zUIayUfUogbl6zThHOcFplFVpZlHVZLdUn5MNPbMiHqDeiVlZTTJksun6T0GygC9DzaDxn4DNFPi UfsNRmA7ANLrNtbJZZqgbtr4UWa3oA0cmKkBbNVpNDunmGBXFcU6pomIDgbrLjAsHOfv+aab6K7v tJukFHxgZwQpOKldPRIvdJ26aO6qbJRbrpypInmLqRg+2lEh28uPyMh8NRYjeWoHtSrd765ski/c eIXUHDuqwWLD5Z1PSuw8S0Kn5wUp9eDRWqnXQLC7brjEdNPkuvn1yx/IgSN1MnrkUCP42BDe2VYu l8+ZafmLIqog9W3XMe07cFTe+GibTB9f3K7qgGmlawtqnWCH6cpWEnYQIV4APIMraFAHhR0Ff0P5 S3Dl3yH4LDAePIpCecyQ44jfQlbLoIoKNXJDGc0wT+H6dJ23ZH5uZwTJPHs9GDs7gCy1AVTu3yfv r31P3Q+z5ZKFS2VfBZlATzUE8yx1/dyw7gOrYVBcVCB5RVPkYFPkvOhI1AihF3nz9VcsSvniGdNl 2NAcle5PHyDfR+arC6N6EsEI3tDqWlcsuMJ+S7e0El1NHQQaF1Ly0h88eNASz+EFFN2CWykBYcQa ULyGdNP8m2PBoEzaChgDdqE1a9aYcXjDhg3ymc98xuoWcB1Me7gyea7ZpeUQKYtJjAL3RQWFB9MH H3wg06ZN02jx8TYWziPQjZgF+qTBVCiviWHb4xJ68GJe4EtiYgQhGvICP0Ov3p5nDHrXXr1RL3Ye UgpEdMgq7ysRvmT2HI0sPWieJ20n+tvv9pyqq8GEG6kodkL2lFaYUXiPJoSbPGyS/ZvzLI7gpE6a F79GCUvtoUqZcfEcefvttVI8e7GqhCI6az4QCvrESYVEdlVV1ZZkbvG1OVJ9rLH9/gNO2gmir4tc e0r/3YtQ9UrXMM0wB529M+HZ+It7KEQdr56dO3ea59BVV13V7t1DX+zicAGlrCHzB0EO6SIgxhD+ l156yYzOEPNf/vKXpmaDwF9++eW2G/iP//gPO3bjjTdaniNcUwk0w7hM/nuCzzAw/+d//qd5KEH4 SWlNBDL9TZ061UpjUhWNfzOWt99+2+oehGfkbzp5fvXK4umjTnvMCMJkd6XP7KPx9/ptePF4IZI5 F0sgxJF0thop3HxCicIelTzLtADK1bK5dL8WrGmOPKeygTa1B3BeAxlJVUWUk5Or+YFUgqytUyk/ khKXOIKgfsDDZdCgLBk1YYoRjROtLerq2Kh9Zti5A5S6o3Jo0mI3xzWKuUaN0W+9tVomTpqqcWr1 ariORMFyvEnTX4cW0u+Gv8nKkEN6Bxhmx3UUMIzgFCkqgs0lFJ2H6BM3AIEPaYkh3EjsSOYY7HE7 XbFihRFdYgN+9atfmWSPtE86CTyEKHSzefNmueKKK8y4j6RPzAK/cT0EngI3EHdUPPRF3+wecFuF geCGSpQzhmx2BsQpwCCgAUQ9w0zoA+YVVIduX+h1EhWXG/SIETC5FMv+p3/6p5gy3sXlCfqgk2T3 tQ4SNc9xXBPH1bf0k/9pjbhyvv7aSjlmnkGt8rgWqgkenJxXoyklTqght6iwWAlAhQzOfcZiAH6V HTmP6+mzTpPINWifYwqGq9tjk1RV7pcMlUhzBmdYaUrLcaPE5NDxBlmpgWqDlNCUl+9TlcQIlU41 yEmJTvXxWnn9qZx2F9JI3y2mHoEw/f73T51zds4+WBLndYuwI+iqelRIAUGnSOs8MwwVN1DeM7y4 oncS9Ec9ZxgwhP4FrV1LZas/+ZM/Mak+5Cr6UCtZgR3qGnYDEGiI+KpVq4zwwxAofP/ee+9ZxDKx Cqiknn32WSPy2Hs2btxozIudCt9xUWXXACPgL8wNZkLf9Mk9Q1I8mBdFVmBmySxInddkJ+nJPWIE PCuRiUz817/+9fP2Qkg2rJJdBRb9EtruoN1jBw+SFjPYmm75pFI/GB8joQb9242FuH/SOC/aC8XU Ev0iuYqIQ0AlpBdplTPKLkZYi0UhU4/gpEtkhnoOwXzM4Kn/mdro5C6D84ORM0jR5+vpkmhrrDtC GNYY50UbaLsqTBNUlhyHcaCiCW6lf/qnf2q/Ue8YtRKEmO8zZ840qX3+/PlmI+B3CPzNN99sqiZs DJS1ZIfALgIbwuzZs61MIrYAdgbMB78h+VP5DKLPDibYKti9wHhQa3E9zXcFibYazxxPjxkBk8uC YXF5cwQcgQuHAEQdAo/ETvEgdmnECqDWobELwNgbIpNRGX3lK1+xa2AA7DhQ70DUFy5caAyCXQW/ 00dIhx0qnfHOk8qC3+kDJsG/Of75z3/e7gOzQU0V1EwXDh2/87kg0GNGYJIh5aZOSm/hZskuPZ8L aH6OI3ChEQg7jGBjgPiiJkIKj0SE92+XxGEMQb0ZvIpQLfHv4Aoa3mOk+7D74h4Q+o4tunQix6JV p9G7AGcCF3qVnPv9Y2IEHW8TEmd15T4WtvvnPryOboonfc9PLnL6Cb7soc/uVAjBN7srfS39dNfH +Yzfz3UEegOBjtWoeLcQzKLXbnfqqOgI5DDGeHn5dNZ3b+DgfcYHgbgyAqQHFgCpc8vKyszvGDsC rmssXP7NXyQXfmP7yncWL9ID17MQMUSxqJFYcI9DAuE8tqr0j/TD9ZzLNpetcdAlsw3G4BZeCgh+ 0FEiuXAtOVwYH9ti7olOk20xjWvxlvDmCCQyAqhhOhNmAgF2QpzIs5d4Y4srI4Dg4onwr//6rxaE govbTTfdpEXNX7VF++CDD8pjjz1mQS0hQOXJJ5+UWbNmtXss7N6925JsQZB/97vfGVEmf3ppaamh h3cDXgo/+9nPzIPha1/7mroivmV6UBgFhq3f//73pqPEPY7x8FKEvOz//u//LhjT6PsPf/iDMRBS +pLyt6SkxLwv/uVf/uW0rI6JN20+IkfgdAR493hnUO2g4+/MVdUxS10EmP9Y1PJxZwTmL64SPAQY aZsP0nnYJSD943uMRDNx4kQzKEGAw84gGJ9Iw7ty5UrzXcZDgR0DEZdEU3I9v0PsYQB4MUDsYRZI +ewWuAbJ/5133rEdB77X7C5wySP4hfvDkGgwKHYKHON6mns6pO5Lk4pPxnqF+MMMEHrOpvpMxef3 ZzpdjX6+eMSVEaCqYRfwpS99yaQSDEcQY4gw6XEhvvg6Q+z5HQYAAUdyx70NLySYRnBtIyVvyLEO gSYIBs8ImAcBLhxD3cQugpJ8d911l12L6xtqJz54UQQDGYSf76im7rjjDtsR8OLgAYF6iD4YI+OL zvN+vqD6+Y7AhUAgWi3E/buzEVyIMfo9ExOBuDKCELhEmTwCVWAMeCegzgk56QPxDsEwVF7iGEwD YoxUDjPAjW3JkiX2HcKO3YDSfOwACKGn4lIosUeulIcfftiIN43gFo7BPKKTcME8Qipfxoaaiu9s pxkD92T3wDUhZD8xp81Hle4IxKIGSHfs/PnPRCCujACCGlpYqEj+HRuSCpI40nfHFn0+qpzOruW3 6AAcVEMdJSD676oIelD7RBuFGVNgVi5J+aviCDgC6YRAXBlBNHDdEdPujnc3CdHXn29f4fyO151v P92N0Y87Ao6AI5AMCPQaI4iW2gMQTmiTYUn4GB0BRyDdEOg1RhBUN59s3CCHDh+RBfPnSlZOxD+/ K4bQld7zbIFoPQlS626Sz/V+HZ/jbHrbrvqMlTl2vGfor6dYdoeNH3cEHIHUQ6BXGAFECE+eVe9+ INUDhklzf3XjfGKVXD1jlCy6eoHltO+MiJIhETdTshq+/PLLlgEROwFeRb/5zW/MLRRPI/KfYxjm Q4wBnkS4leIyx33xQMKzCBfT3/72t3bdjBkz2jM24nZKIBrXhMhkDNR8iE3A84nc6rjC4u3E9QTH 4U1Eel8a48S4Hd3wWOL+0TsgsOAajN0EsXEOxmyySnKMvC09ZRJcz7NyPYZxxhoC6MDk8ccft7gK XHF5XuIzwJP0xYwjGMQxkGNwxy03VsaUeq+IP5EjkPoIxJ0RQJwgsE+velPGX7NMhucWS4sWIykv q5cf/PF/ZN/+CvnS5+88A1mIMAU5XteqVTCCTZs2WSwA3kEUz8DDJ+Q2on8C0iigASMgRzrxAsQZ EHtAQQ4Mv2RCxHsII/YzzzwjBK9BLDFIw1jIvAjhhhDiUor76I9+9CP7/Zvf/KZ5KEE48VIi5uHK K680V1j6orDHV7/6VUu4BQHlQz94OVEUhDFRyAPCGsL2GT/53mF4pP4l7uEHP/iBMZ5169a1MxFi JpYtW2axE121QLB5DpgAWBAIh4cV4+XfpCRmnLjy0hgP2WLB77vf/a4xIrDm3nho/fCHP/T4idR/ 5/0JHYEzEIg7I+AOEKajA8ZK8chiaajTkoTrSqVkb7m0ZBVJRVVZp9OAyyZSKdIqRTSoukTEMIT7 2muvbY8cxu0UbyAkbIg9xBfJnQA2CDkE+Cc/+YlJv9/4xjds10C6XIhxKNCCtxC7DOISyLdONSj+ wlyQ8skFjycS1xJrgNsqTAApGyYCof/Od75j0cgQ4r/8y7+0/titcK8QSAdBJlANgs+zPf300yaZ Ex9BIZFvfetbxriIu2AnghcV9/j7v/97Y4BgAoPi+TqmKaa/4P0EJjC84CoLLjBFmBaEnjEzFuIo wAHGCCPhN/qwOgW6Q/DmCDgC6YlAXBlBIFaVFftl++b1kjnqYhlbXKRlDvfJ8WM1Ule5XeoGt0hT fa1kZp0qVsF1xBGgyoBoQZTx6YcpEABGsQyIP6ko/vEf/9ECwJD2Q2pdiB59QBw5RoENiCOEEQaB aofKTBBu7kMZPog1kj/fkfxDxSaWAVI118AgOEZOdxgS6iYkb4guOdzJuc59iZmgoQJiZ7Bnzx57 DnK0Q3iR7BkLahqugRBT0YndBkyGxq6AD/ngGR/Xw+SQ1mEu0YwARgajQLXD+JH4YVowkRdffFHu uece+au/+itjhGABVqijSKURslJyz3vvvdcYJ4F8YRyuGkpPQuBPnd4IxI0RQKiatDrVH15+SXY2 ZcrC5ctl/Tuvye4hI6SuvlWGNn4qC26cr1L8CPne//29fPmWq2Ta1CntOmmIOcQWIowunQaRCo3A NI79xV/8hTEICuOgvoFgYgt46qmnLHUEDOO//uu/5M///M9NlfT8888bkUeih/DDVJDQkYYh9Oj+ 6Y8I5ZC5MeRtRx2EeuqVV14xog0zgVASBIfKBcJLziII92c/+1kbCx8imqnOxHFwYRcQIpj5Ti4m iPnf/M3fGJOAaYVUGNwL6ZzrYXQQ8s4a40DNtHbtWvnxj39sVaVIlYFKiXtA+GEO/CWQjsbuAOkf xgIz4nd2N4yZHEveHAFHID0RiBsjAL6jRw/L+tJj8rmv3C/vb6qRmox9svW1Z4zA/p9vf03mLZov L6ypktV7B8iYN1YbI6BB1DAAo3PHRgBDgFCjKoFAQkhR1SB5UzgbqZvEcUjPRDFzPeokruFaCDlS OYbYkCs99AFBRjVD30jg/BuG8Ytf/MKk/dDYCVj1LCp36XH6gkE98sgj9v2v//qvTcpHF4+UDXEN uniIN+dQto9jQXp/4oknTGXDDgNmEmrwcg6MBpweeOABu28o79eV9w/PiKrp0UcfNbUUqjIYEuOi cRwVHYZinpnEf2AEc4DB/u3f/q3ZJOifZ12zZo2NIURnp+fr4E/tCKQnAnFlBBC20opaeXdjo0rS e2SbSrXzLsqVy6aNlvc2VUq/gjZV+2yRgxV7JWv+hNMQ51okVBgCqheINMQa4o7Eit4coo6kHyKC UYugDw95ikhlwXV49GBshsAifUNYIXD33XefSdmoiJC6A9GDoHPvwFQgrBBY1EeocELNWHYQNM7H IM3x6OjooFZBRYXeP7oxBtRJ7GpCC+ezK2BX07FxvCtVDWPn2biWczBgBxsB3xnzv/3bv9kuABzI rQSOXIdKiAYTBDOrKaxMo6tI7PR8NfypHYH0QSBujADiM0yLkT+0fI689N5vpXTvYbllSpt848vf NAPs7557Ud569X+kcU+ZPHRNkXzu5mWnETmuRyLtmFYiOm0FxC2kgWCKQjoKJOHoxv2Cayd6/Y4N 4zMtmsiiOgq/IY1DJDtr4RoYF0ygM0Ld2W9I3oEJdDzeE708/QUmEJhT9DPBFKJxgTlFH+d6VFih dfUs6fMq+JM6AumLQNwYQYDw2muukvmzp0uZuolOn3FKyr3rtuVy9b49WqC8RcZPmHQGIe5ImPt6 SqKJ8bkQ5nM5p+Mz9OSas+FwtjF3d6/ujvc1/n4/R8ARuHAIxJ0RQGBy8obLdP10JO6jxo5vf1In RBdu0v3OjoAj4AhEIxBXRtCZYbMrY+fZ0jH4FDkCjsDZEXBByldIPBGIKyPAmOsLNJ7T4305Ap0j gA3IhSlfHfFCIK6MANdIUiz4Ao3X9Hg/jsCZCPB+EQSIy7A3RyAeCMSVEZDSINoTJR4D9D4cAUfg TATwnmP37UKXr454IBBXRhDt6hmPwXkfjoAj0DkCroL1lRFPBOLKCHxxxnNqvC9HwBFwBPoGgbgy gr4Zst/FEXAEHAFHIJ4IOCOIJ5relyPgCDgCSYiAM4IknDQfsiPgCDgC8UTAGUE80fS+HAFHwBFI QgScESThpPmQHQFHwBGIJwLOCOKJpvflCDgCjkASIuCMIAknzYfsCDgCjkA8EXBGEE80vS9HwBFw BJIQgbgzgo4h72cLMosuyJ6E2PmQEwyBvki3ENZzX94rwWD24aQgAnFnBLwolGWk/i5VvCiD2LGF l4hzyFgaSkGG82LJoeLRzSm4Ss/hkVhTJDwk8SHrjqY/WdMlqb/1t3XJv0Oz4/qdnzL0eEtr26lj dn2kA9YUBZXod8aMGfbboUOHpLKysv1e/JY5cID2M0DqG5vbO6Zvuhmg74HVv9Y1zxj4LXos0Y/I O0FJ0SlTpng233OYez8ldgTiyghY6Js3b5bGxkb7y4J+8MEHzxglBdV37dplNXIp5E6yOs6l9GLk Be5ndYsprk663fHjx9txCsRTlJ3vNIrD79y5066DCNx2221nlLp0xhD7IkmWHqhhTRs6dGg7AWUt QeTLDxyVvNwhkpWpa0yJMCS+P9RY/9fQ2CIHj9RIwbBcGZihDMNqRfN7swoy/YyJNOma3rNnTzsj YC2yfilryhobmDFAtpVWyZaSCrll0SxbwxD/thNtykRapba+SZqaW2WoZgzNGZLZzgQ4ZmVH9R7N JxkRdbrLysqMEXhzBPoCgbgxgiA9lZSUyPTp001Sog7wgQMHrDA6jd9ITIck9fHHH0tRUZEVbSzj AdIAABZbSURBVOfF/dGPfqQF73fILbfcYoXWYQRvv/22pdqlAPvGjRut6PzYsWOloqLCspxyH/qn eD1/YUDl5eW2G6Fxr+hi8X0BqN/jwiHA7pP1kpuTIxt3lsumXfulpaVNRuZnS+HwHGk60U+mjs2V w8fqZNueKvlgy14p0GPLrpopuyqOSeHIYdKg5x+va5J9VUekSYn04eN1cvUlE5SJ5JxWL5u1DCPI UUbwwdY9Urq/WtZsKJH8nEHS+OYmyR48SBqamuWuGy6VsspD8tI7m2X7ngPynQeWylsbSqW08rBM H18oy66cYQxpx96DxoCm6W8wFvr25gj0FQJxYwQMGIkMgn3TTTfZFh0GAIHm37ykSPfsAJB0YAYQ 6qAWuuKKK4zAT5oUqWfMtRxD2t++fbtQfH3ZsmW2G1i1apXMnDlThg0bZrsJtvx33323MZpXXnnF dg/8Nnr0aLuft/RBACKK+mXq2JEyafQIJeS1snLtNrl7yaVSUn5Ifvbbt5T4zlQG0aq7gONKhEXa VBK/dfEsZQx75PWPdsi9S+bL0OxBthuoOnRMRuTlqJBRfwaI3KtV19klE0fJkEEDVfJvkyVXTJMX 394kt183W3776jo5eLRGdu07INfNmywTRg3XvobY+MqV0cCEUCOt0vFtV8b08O1Xn1RfRemv0mfq /EkvIAJxZQRsZy+99FIj+LNnz5bXXntN7rrrrjMeLxDp6667rr24xpIlS0x65zoI+bp16+SGG26Q F154QbZu3WrMpUX1tKiVuAeM4fDhw7Zdv/nmm42p0G699dbT7ueqoQu4ui7QrQcoAd+lEvfOsoNS pyoZdqvvflIiW3ZXyPwZY2XquAL7HKttkKtmT5S8nCx57q2N+r3RmMSokbm6K6iXVz/YLnfeMFdV S/2koQvaTN/NStj3VR2Va5XYZw8eKOUHj8kbH22XvZVH7JObPVjmTx8nFdXHTU312asuNlUS9+Lv glkX2a5lyOBM2xV4cwT6GoG4MQIILhL41KlTbWubn59vxLuzxrYXtRHb+GhCDYEPhmJ2CHl5eUbY UR1hPPvkk09k3Lhx7bpTdKmLFy82JtCZN4czgb5eThf+fuwKB6ggMlyleC3bogPqZ0QWQ/CkMQUy fOgQaWxqkeP1jTJ32lgpGpGnKqAWmTVpjIwpyJNBmRmmyx+elyt3fmaeFA3PtWsRbjquJ35jx9pw tE5mTxkjF40aJnUNzXLjwpmSp8Q/f2iOXFSsuwC9P+qfz1w+Q7KzMs1esXjeVMkeMljVmG1632H2 YXdhNo1O7nXhkfURpDICcWMEgJSbm9uOFQs6+ns0iKh0QuvohhdeBJgArbCwsP3cSy655LS5wF7Q VT/83hcufqm8OJLt2dhpokbcu3evGWoHqCRPqziuxl/9W6UCyva2iMQNYUY6/7hqn33n39UVe9qJ PWohztlXEvEkwv4EgQ4NOxQOEQg15hGkznEHykuM9QxVNVHL8WMyVPusLDsq+/difD5hqqY2vT/3 ooW+ba3qJ+wFUIuGHW5Xa9iFnGRbnYk93rgyAlQ3vIxOgBN70lN1dKgL582b12sulxBn1JY0dr/s enursVvGYaKrd4mdj79nvYV++vUbV0aAJBORfCI+0yzkc5VcQsxBeNE6m4qOAWjhPsFLKFyDkfl8 7p1+056aT8xaC/MeTyIZ1nCIeQE9BB6+B1Umf9kZIPWjSuppLEy4F0LV2TyH2G2HeInUnE1/qr5E IK6MgEWM7z8EuqqqynyukWxs+6wSDIyCF6hj46U9evSofXAnraurO0Ma4hz654O9gIZHEvcKaqSw G9myZYvZKpDggm95X4Lq9+p7BEJAWY3ajbJ0fWAwJrjLiLb68mODRfWCt1DExz9yHOMsvvwEg/E3 EuwVUQtB1FHZQNjrT3rA4czAmiOgDAEEGwGqHj7HapvkyPF6tTsMjcQoaGts1kA07SdzYIadQzyB xSZoHy36LjAemt1Lr0F1xHtSXV0tc+bMaXeF7ntE/Y7phEDcGAGLGOPtu+++Kxs2bJDLLrvM/PyR mp5//nkj8itWrDCXT3St0dHFAP7f//3f5lI6efJk8wpatGhR+0sA8afv9957zxhBQUGBvYAQen7D YAyzYSeAC+qjjz5qRmakqgceeMB+D5IWEmPHHUQ6TXiqP2u+2pYQDPZVHZayiqNGyItG5JrHTkF+ jsy4aLQadBvNQ2ivGm1zhgxSg3C+rN6wS67SeIGhauQ9UlMvtXWNcrC61hjD2KJ8KVSHBbzUQmP9 spaH6Brcvf+QHNV4gzXaR2lFtXzhxvlq+FWBRQ3PsyaNkqrDx+WtdaXqQXRY7ta4ghN6rPpwrQWw FRXlGoNoUAN2tcY3FKrHEmudgDVvjkBfIRA3RsCAeVHw6//0008t0nf//v22K4CoP/fcc8YAkHQI DAv2BOICJk6caAFivMC4nC5cuNDOh3nQ0MUi4a9du9YYANHFxCJA5NHVIvUTP4A7Kq6muKy+8847 xlQwHhK8FrbRMKgJEyY4M+irFdbH92FX2KaSeqtK2jD843UN8smucrl36TypU5/9Nz76VD16smT9 jjJ57cPtxhy+fucimTN5lHoLqdCyeodMHV8gu8oOqYdRtqz7dJ+MK5prfXZsIZVKs0r9VdVH5ZDG DNyy6GJZvW6nuqVOkDc/3iHF6nW0Vd1Wq4/WaiBbre1Ofv3yB7J97wG5ZFKx/K87Ftm9Ptq2TxbN mShtGmfQ2a65j2H026UZAnFjBEjcuHaitiHS9/rrrzfJndgCCDFMAWk8R6M+L7/88nY1D1I9hP72 22+3XcGCBQvMUwjGEOwFMBAYDAwFiX/MmDEyatQo20GQqoI0E6iU6IegM3Yl6FBxQSV6maCysAPh HH/RUnuVm/uyuokOVu8dIoP3qeTf2npCPtlRrgygXB5csVDGFuebqoh4AtxLK6trlEmUGqGePHqk +fS/v3mPzJs+1hhCTW1dp6DRx8UTi3WX0aRBaZfILP33TiXyk8cWaMqJAxpTcFSDyuo0wniOBavl 5QyWr+j9n31zo1w/f6pe3c/cSZuUmYwr1DGd9GpK7Rnyp0s0BOLGCHgwiC2ue6h2YAIQ3EDEkdwt J4tK9NFun1wH43j11VctmIzdAFtjPECCOif85TqilLE/sCuAIbALueaaa4zgwzhgAozhkUcese/k ggk2BO6FlHiuBuxEmywfT/cIsPNjjZXvOyhbSyrNN3/GRcWyu+KwMods+d/3Xm+qmOOq+hlXNEzm TRtndoJd5dVyhQZ2wRiUFyhhb5Fc9fNfMGuC2Qg6eumYnYF7qZBSqn3XN7XKlapaIq1EixLz1et3 S20jXj/95ZpLJ8swvffUcYUapwBzapDLZnCvQrv38qtnKbOoVRdUkjRG+vXmCPQlAnFlBBDYuXPn mjEN1Q/fkeyR3oMXEYS4o0SOQXn58uWmc2XXAOHu6DpHXzCCL37xi+1h+PQ1bdo0I+7Bg4OdATaD YFjmGGPxlvoIMM+oJDG2FuYMkFFzx6q8rU4GJgBAzPuZkZe1wfdpozTv0OFq+z5/0gg7r3x/pX0f ltVfCqcWyP6KSgOOOAKEj9BYnwgw7IBP6H2nFGfbd9b27YumnTQ+F5nEP0CapKKySkblZ8oRvZ8u SBk/YpBUqkATvIswHh+qO27dcx/69+YI9BUCcWUEDNp0tCc9gyJeEG32EoXWmVtfyDcUktNxbmeB Zh2ZSHAXjO4b1U9gQn0Fot8nMRCAKEPoIaTn4j56tlTQHZ+ItceuM/TLvVBNYp/CIB0h4ZEWPNzC 3459cd+aY11jxr1QhfrONTHWVTqMIq6MICSR6w644P/P3852CN1d78cdgc4QIBUJ6sLebMFuxb1w OujNdraYms7qfPTmWLzv1EYgrozA8ryco36TWAH0+9gCQjh9akPtT9fbCOByiXNCcE8Ovvzo4fHl 5y9++kFq5zjJJzDQZmjyt1A05tRx+5ddF1SVs2bNsuuJYeFjgZAn6xpkqr0A+0OkMA1xC5H7cZya Buj/mzWPUegfiT86yVzYocAAeIZQBKcz3Hy30NurKb36jysjCFlDMdhi0L3xxhvN7ZPvQcfP4iaj aFAXLV261KQ4X9jptfDi/bSoYRAuIKDDhw+zxHIkj4O45qgH0H4K02iW0eHqtQNxh+gTQIZuHtZQ duCIjBmZZ55G/A6BtsylSryzNBhscEuTlJSUtg/7+PHjJsDgjICBmLZ5V4Vs1sI0d14/19YzjIFA NYLKMAbXavwC96A4DhlLYT4wCVRLGVoQBwZCkBvOEjg88K74exHvleL9dYZA3BgBLyIuoj//+c/N lx/ijjsphmD0tiH1NBLbY489Zh5CXEMiud7ezvvUpwcCqEuwN2UNztIU1OWyWf33KTFJGuiJWptA tOBMTs4Q8+nHj3/tplKLI1ihbp+Vh+s0cGyEEux6C+4qrVSjrnKIqsM1ll46X2MPQgU90OReBDFi K9hcckAL0xySt9bvkmKNKn76zU/M5ZTANOIXSiuPaU2ErbJD6xJ858tLZeX7pKjWwjQXFcmKazSR ojKNTTpWMp9SrAYbV/S90mP2/CkvJAJxYwQ8BDsCXg5cRwnmCsFf+PrjOcT2GnUQEcdIPfzbKzFd yOlPvXsjQSPtz5hQZFG91cdq5I9rNsuXtO4A7qQ/feot8+nPVGkcCbxRiS4S+U0LphshX7upRO5f foX2kWeSPnEIhRoBXF9/ZhyBqXbUGeLSaWOskA3qn+svmyovrN4kX1g6X55Y+aEWv6m1wjTLtQra 9r0jLQ12dtYgS0XBToFymBSm2banUv7s7sXm7uq7gNRbl4n+RHFlBASL4QJKyUmih9GhIjER3EVE L8FgBHcRTQwjIBIY5uAZSxN9mSTX+FD3EE28RVU1EHutUGmFYnZrrMDSBdO0UtgImaIBX8QSLJo7 UVNBDJSntJoYOvzbr5ujVcSyNVK4RovZlGq6iHlnLTTPrrZGo5d3anTwormTrPbwbi1b+RtlAp9q 1bHi4UMt99AMlf5L9HcK0dy0cPrJwjSq+lEbwtUaUTy+eJgxJ1JaeHME+hqBuDECpBjc9ojs/e53 vytr1qwxQzBpgd944w0rLXn11Vebl9DDDz9sW3j0udGupX398H6/1EPAjLf6mTi6QHP5DI3UB1Db AHr/edPHS9agTJPEjykTmKOFafJys+3YdRrlO0LVRJSupOTkOC0o88AtC7XiWKblDepYLIb1HilM o4Vs9HwCz4o1pxGFae5eMk/yc7NklharQVU0LFfTRuj5y67UymRqMyhTewVBZoy1rd8JK44zqiDf xgFjoV+Pfk+9tZnITxQ3RsBD4k4XXOooHxladKUyFj8GttCiE8IlMlA+tsRHAOJMnivUjejwQ/bQ ipOpR81DiCyk+n8hA2jl3kg2XL7vVoIfkcgjx/kPJoDBGYElZL21M/REKuZFCtNEKqGV7owQ8kHK HCqPaFS97g5KjuyXXe2eSsTZRDyUDpoKq/PaHdyrq6JOiT8LPsJkRCCujMB1m8m4BFJjzKw9clRB QHtL1WhRxCd1NxdddJHZwnqrRZdf7a17eL+OQEAgrozAYXUELiQC7DaxU/VmC4yAe/W21O6CVW/O pPcdjYAzAl8PKYNAXxLOvrxXykyQP0jCIuCMIGGnxgfmCDgCjkDfIOCMoG9w9rs4Ao6AI5CwCDgj SNip8YElGwLnkvE0lmdydVQs6Pm1Z0PAGYGvD0cgTgiQ66i72hcwC1xbO8YJdEfkQ43u7s6L06N4 N2mGgDOCNJtwf9z4IwBxpxY39QnOln03VDWjhkHwbgo1C7pjIASZkZPL427iP3/eoyY9dBAcAUeg 5wiErKdUJ8OdFEbQmdQe1EYvvfSS5dgaMWKEEXZ+Ly8vtxrfHaOXo0fFDmL37t0yadIkC2LznUHP 58yvPBMBZwS+KhyBGBEg2SKqG1Q+XRFojkHIIfr333+/PP3005aTa9u2bXLHHXeYpH+2XQH9cz73 InOvN0cgngg4I4gnmt5XWiIAkUea765hQ2DXQBlKSqqWlJTY7uBcIqG5B6VcqfPhzRGINwLdr954 39H7cwRSFIGuahTzuBB70lK8/fbb8uSTTxpBp9oZGXi3bNlihe/J3NtVsjlUTmTzhYF4cwTijYAz gngj6v2lFQJWiUx19iFr6Nnqa7AbQC20c+dOWbRoke0OkPQXLFhgqiXUQ501+oZRoBq6/fbb0wpf f9i+QcAZQd/g7HdJYQQg4KRXf+6550x9c7bC8qiQ+FCsCek/kgk14k7alX0Bu8D7779vuwcKPLmh OIUX0wV6NGcEFwh4v23qIABhHj16tOn+KdN6NkbQk6fGiLxixQq55557enK5X+MIdIuAM4JuIfIT HIHuEUC1c8stt9inN5vvBnoT3fTt2xlB+s69P3kcEXACHUcwvas+R8AZQZ9D7jd0BBwBRyCxEHBG kFjz4aNxBBwBR6DPEXBG0OeQ+w0dAUfAEUgsBJwRJNZ8+GgcAUfAEehzBHrMCPCbppg3rbfzsPc5 Kn5DRyCJECAimeYG6ySatAQbao8ZwdChQ+WXv/ylHDp0KMEeyYfjCKQPAghhtbW1Qh6jsyW9Sx9E /El7gkCPGcGtt94q27dvl1WrVllGxXNJnNWTAfo1joAj0D0CkydPtpQVxDOcLedR9z35GemIQI8Y AVtQCms89NBDMnPmTCktLbUUuq4iSscl5M+cCAiQ4whmMHz4cH8PE2FCkmwMPWIEPCPbUIprXHPN NTJv3jzXTybZxPtwUwsBspOyI8Be4AJZas1tXzxNjxkBg8vOzpYhQ4b0xTj9Ho6AI3AOCLha6BxA 8lPOQCAmRoCKyKUPX1WOQGIgwPvonkOJMRfJNoqYGAEP6wsv2abcx+sIOAKOwOkIxMwIHFBHwBFw BByB5EbAGUFyz5+P3hFwBByBmBFwRhAzhN6BI+AIOALJjYAzguSePx+9I+AIOAIxI+CMIGYIvQNH wBFwBJIbAWcEyT1/PnpHwBFwBGJGwBlBzBB6B46AI+AIJDcCzgiSe/589I6AI+AIxIyAM4KYIfQO HAFHwBFIbgScEST3/PnoHQFHwBGIGQFnBDFD6B04Ao6AI5DcCDgjSO7589E7Ao6AIxAzAs4IYobQ O3AEHAFHILkRcEaQ3PPno3cEHAFHIGYEnBHEDKF34Ag4Ao5AciPgjCC5589H7wg4Ao5AzAg4I4gZ Qu/AEXAEHIHkRsAZQXLPn4/eEXAEHIGYEXBGEDOE3oEj4Ag4AsmNgDOC5J4/H70j4Ag4AjEj4Iwg Zgi9A0fAEXAEkhsBZwTJPX8+ekfAEXAEYkbAGUHMEHoHjoAj4AgkNwLOCJJ7/nz0joAj4AjEjIAz gpgh9A4cAUfAEUhuBJwRJPf8+egdAUfAEYgZAWcEMUPoHTgCjoAjkNwIOCNI7vnz0TsCjoAjEDMC xgja2trsQ+vXr1/MnXoHjoAj4Ag4AomOwClan9Ha2iZ5eXlSUDBMR92qnxOJPnofnyPgCDgCjkDM CPRTwV8p/okTkpGVlSn5+WNld8kR2bX7A2cEMYPrHTgCjoAjkPgIoP2pqWmQ3NwhklFRcUBGFoyQ qgPViT9yH6Ej4Ag4Ao5AXBBgJ5CTM0T276+U/w/uRHTzJVlZVgAAAABJRU5ErkJgggBuHvAn8gAA zbK5H7kwMaLYp7BHsakduv+JUE5HDQoaCgAAAA1JSERSAAABegAAAXoIBgAAABegk5AAAAABc1JH QgCuzhzpAAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAGXRFWHRTb2Z0d2FyZQBNaWNyb3NvZnQgT2Zm aWNlf+01cQAA8ZZJREFUeF7snQdg3EeV/596t4p77707dorTe++FkEAKIQkJEOCAUO9od7Q/HBzl 4AglCSGNhJDee3Acx05c4t57L7Ikq0v/95ndt/ppvZJW8lqW5Jlkrd3fb+qbme978+bNm9THHn+p vrqqRqReJCk5WXzwFPAU8BTwFGgPCiQ1U4gCsjT3nqSAdpLU64evwZCkz5Lqa6WqqlpKSrZLavmB Spk6dbykpaZLeXm1xm+cIvp3ezTfl+Ep4CngKdCVKZCsQFxZVSXVNbWN4Bz0TU1JkcyMdKmrr5eK ikqp17/RISM9TVLS0qSmtl7qyisU1KNwOyVZCnoWSXlJsSxapHnW1yfL9u2lsn3bHqmpqdJPtWgc qa1PkqzMHJd/fX1dV6a5b5ungKeAp0A7UiBJDlSUS1pmsvTuVdhYGlcGsHPXPikvrZLaujrp1Sdf 8rvlNqpbdXWNbNi4Q9IkVYo2L5X++TWSlJspNRofST5FY9fsKpP30gbIoBnT5UB5laRWVlZLRWWV ZOem69tSGT9ugJRVp0jZ/j0y74OV0qfvCMnOyZOM9Ayp04xqamskNTVVKrWidXVBLlIv6RmZrtKV lRWSkanfNVTp93iWIOmaP5Ukbcvx27FPfFGeAp4CngIJpAA4V1FbIcdPnyB9FOhrAziKpL93f6m8 9Ooc6V7UTU45YYqUlZVKdXW1q0GyqtcLCwokNzdX1s5dKBP3rZP8nr1lp1TJkJ6FUq6rhC3FZTI0 XXF920opLh0n1YrbqSrzS2ZWstTWJsvCTTUyvzZf0jSjWyb1kNdff0NS0zIkp6KbvPfu25KVnS0j R42TdWtXy/HHnyQFRd2lRitA4ampaTJ37ru6GkiWY2bMlPdmv63qoDSZPGW6WyUk63KkWivBPkBq SqpWvEoZQ4bqkKocE1m06EMpP1AqkybP0LronoEPngKeAodIgYOX/IeYoU+eAAoA5mlpKtWr2nzH zmKnorEAE0CvnpqarLiaJPtLDshf739Ctu/YpdiaokL5Abnk4rNVLdNb0lQ2ryitkJzSFKmaNFkW vPiM1PXsJT2OOU5KX3lRoT1HMjJUV6/St+JziuTkZsnWDZtlfUmd7K2tkuKd++TaCbly3nlnyLIV u2Tb9q2yYvlHMmToCFnwwWxZuWq5jB41SubNe1dGjBwjO3ZsU5A+IGvWrJB0BffsnCxZuWKxrFi2 WAtKcyC/asUymXH8iaom2ip7d++SUWPGy5zZ78iYsROcDuqJxx+QUSNHy8yTTg1L9QmgqM/CU+Ao pkBLW3lHMWmOaNMBcwRjdPSpaakC8AP1tbWqr1csrFK9PbiM8r5CNScDB/VxWEzYum2Lgn2FVKn6 Jl319NXVtVK3YYMMGDRE1l9yleQp3nZ/b46UFe8XUZVPVnaGpKguPjVDlf5ZWUmye/dqmTt/rEw5 LkmGZVRKWlKqViZFsrOzdJmQo5FTlKMkSV5ermSqWmbxRx/KCgXv1197Xrrl5ctNN98mW7esl4cf +qv07dtXevfpLdVayUcevs+peSZPmiqPPPhn6dunv8xWgD/t9LNl0YK5Mv2Y6XLffffIkMGDtR5a Vk6mNtIP0SM6En3hXYMCXqDvkP2I1iN9734F7GoVavepaqbM4WteXp7TjrBBGwJ6lfrLK1W1UyO5 3fKcqrxX7+6yccNWZRI1qh5Pl3p9VqqgvvyDuTL583fJ3q1b5aMF82WA9n2yrgpy8rIdjitDSZEe PQplzMQz5fQtH0r3vvkyfWxP5Qz1sks3YTOz0rUCWfrpJkU9uit4Vzkd0axZb8uwYSOkrKRUpfZM 2bV7hyPqCSecpMuNfU5Fc+BAmeRm50i2AniVqmoqdXd486b1UlBYqFxMpKcuP6ZMnSL/+EeemgCV qk6qh2485EhWdWqH7CBfKU+BzkQBj/Mds7ewqtm+K11VNLWyZ9dWee212SrNV8o5554tPbr3lEqk dbWoCalxamTf3r2yYMFHrjE11WVOzZ6WUy1F2ZmqDq+W7UX5MuSKK+XAvX+V3CGDpeCqa2T7fX+V NFX1FBbkqYpHgT5D/ynoVqA69zzJSt8nVQe2SZ2qYt7aVKvgWyaDh4yUiRNOVJVMqtQqp5k+fYZU VB2QLZu3agX2acV6SJouF7Zs3iLXXXedFBYWKZcq1xXCbtm9c5cMHDhY8gu7yZKPFstE1SNt17y3 b9uuuv6RyskOKNgXyte/8Q1ZsmiJe9atW5bqrEIbuT54CngKHAoFPNQfCvUOV1qE6/T1abJ9a7EM 6DtALr74AoeZNTVJsmdPqVTWIMGnqiFLrezdWyFDhgxToVlNKJ2iI11y1Dhmn264DuiRoSbxVdKt okYqH3pc9qxdK8nzF0n2iBFyQPOq103YHt27KXYr0Geq+J+tUjtD4rjjp0tZ6QH9pjnyv+aco2ob NlWvuurSRu0eP250q+gwYUIo/thxwxulw3SzqHCCTJ0ywT33ppytIquP7CnQDAW6oAo02KRYfCz6 fQckAdujA/p1l4WL1svuPcVObYMGBMMW1DN1ionjxo+XnbpRu2jRBqfSTkpSjA5v2u4t3a+allTp O2qCLB82WnYsXyayba8kpWWJVOvJp4XLpU6l+d6TJ0tuZpoau6ghJhxh/vxlyhkqVT+kBYbYRiQA vBQefEx5UdFC8Zs6zNXcIa9Y78Id6OWRzotiseajPbN+jZ6Dwf5uKn28Y4L0TZVjVI1+H/wdbznR PdQUrrSmLm0tu62j5VCxMBYdg/SPt17RaYLjpTV1jEXrePu2uTpYOw6Zl2gGtbV1MnxwkW6mYmEI 9PMnBObo1A/sL5N0Pc80ZFC+e+ZwOQz09WpBn6Nqm027S6X+/AuldsaxZNgYtzX+/n79ZeHClSGd /86de5wUPWxYPxcRI/3GDQm5RXDPokagnqk6GODNVMgdwQ2/tsQwCIx9ItQMc4zokR0Gfxp40KCP 1WOxeifGbInmKU11fqPsLFF0fm0ZyfGO+EOIF6uaDVw72B+BQlo9U5vj3A1DInpiNAWsJiSExlMo lhv6bixhkeAGjo6nkHVC40GnTyIDMfxKB55ODUm28XcQ5AdqwiSilEhxjFtNHxnbruBwtWKxKnsX aLeTgkJ1dhlpenMu4kp2/7QwgOJAphhDvKFTo9M3U1yL+USjbCRB6EuIgnb6JUT72MUFx030aDhY TmzchHDaYGUbgVK4xMAYSXL9FqpbCEmaqlcD2RqGV6Agk2ojZpBhgrgigwDRJKEi1LG6JCWpxN2z p+6YaprgeaTwQKxW4E5Ti5x+fdUQRiqkqHuRCuLsXTKuklySGjVHLypSq51B4yUjJ1/qlHmAmbX1 2Nxri9UiZ/HiVbJfmUaq4rr06VMk48cPUrPHPZLTrZuzhY+MRyVOOgabmpADU0j9VZWVoYkRDfRh 2qSnE19XEWo+xLIE88raulqn47exHxrs4QmZlOw4lstT6+PMjMIzI8A3Qp3l5g+TJ0TkNMrSyFV6 6CvE+Q7uNJ6zm52sZka1NRBDC3HxQrOb/PRppDNsaKSrRZLChTODcmnCDcZcKUk/NboRQr1tSRUa 8KF/U3RPo17bnKx140AEtrLQhTMFdEhDRRuDTnTtQ7ULTKhwG10pEeKE+j/4yGaeMdtAhx6EizFx 0OZNjDkQgt4oQkehRQMzDzc1gIfRcGl1SzTQRwSNJoDeaBgYCq6yCQN6N8RDQN+ozTGA/iBc75BA H65Uo4lvI74B3hsBfaN2hEAqFKLycsM5LLmGXx8M9A3Jwpw/MDobBmyE8RwE9GFBMzDXG0uvgZFt 1QvDRJCnRIZ6qGujhNGYozuMLTaPQ9V24zNc7YPnvb3ipGupWjEiiAfmXL2uBJ79P5GP3pXS9FGy 46pbpHe/EQqFtZKd3EvjhgB0h9rf79y1S1KhOwDOCVmQPz0rV2qTGlweIOEvWbzU6ZC6qeXNzp07 5Nhjj3UHnQDXaGYHoC1dtsKB9dixY2Tn7p1qdrlN+vXvJ/n53RTkbIkRqjRAWV5e6urA6S8YQ69e Pd1vd/I2DGbVukFhBwuMQOiylq9cpfWoluHDRzgzUHd6FzcOCrQhNVS9pCjY7t9fIqWlygG7d3eA 6waVAyy1W1XADjHmhqEFsC9estTtao8fP0F1YnrEWJdZabobvmXLFikpLZExo0dr3e2EsK0+lDVo uXv27lZ65eqeR5luMHfTXe80+fDDD2WUnj/Iysx2trCR/YhGINnQ86HHYaBvJKmEJkV4uERGWxhT GsZMs2BNHuGRGph3jcZSFHhHD8ZYgzPyLAqoGo9nmx3GsI1PBRiaGxsNEzsyRdyzIJMJvwmXF1zi Wl2MAR80qSJ1bGClLo1NwIYMGqTzqGltfdQAdw0TNAQCkdIb+iuYRxDvYoF7U0AQ6LpgP7gsgn5P nPQUxoiDQNdoSUUDNA0nOThdLPQLldcwVg34gnmGBLCIcBKuk0sDEwx90SrwvQEoG6qLMOViBKrp OENokATGKXmEfpv0HpxFIUI0wHkzA9zNjTBlIyqT6DxDbWLl4ObSQZAfWIGGGhAaXpGx2nioBZ9H BDeEUHVOVusOnYYEbieMbFossu4dkY1rZbs+/t9XvyFFI5NlaK8xcumQ70lOejdXFnhIONiO0YgH STCRVLPHP/3pL+r4bIru9ubo4antsl/tNguLihTIRzvACVUwJDWXavw//+leOfHEE9TsMkNeeP5F B7BJCrZnnHGaWu0c44DYAtLx5s2bZePGTbJr127JU3vRgvx852ahoCDfrSZwuwCjwIwTu1FoqjK1 HtKqkAceeEiGDhnizD/feWeFmor2kEGDBujBrB1q8rnb1QHg3a2rlQULFsgxxxyjoJ3lzJdYGlUq s5qmbWvgWKGvSbpyWbRose6C6yonN08Pg62RCbpBsnDhIgf2e/ft0xPC62TKlMnKwHTZxD6GowKS e4aeL3hdd7zV5nXTJq3PQPVDUSubN26WBfMXyoABA+W4445VZpQcAGyDChuiRiFbdDYMysi8dQXa wA6NgeBcbhh34UkRGv+hwRaNegagNqiDWBrpragvQZBqqG5gwDdk0uSUCo+dhuo0TKbQ3AgLBI6y lnUYRIzjB4Et8P0gigWZY5gKoexD+RkEBHvAGGqsadxoRQV8BNsSHgsHk65xrSLvwzgQaWOQ/rHA PoqgbkxE4V4jDAzGt++B8RIYGgE6B2sfjnww9w1EirHSi4y3MFAHGxz+3rgpDeraBsi3MRusZfh7 SEKLGnM8a1yXINVtxRHVuoafEQEoVIOGuRJkNLxoKDesYGzU3U05hDxoakX1g7WoodWNKUT6fRX1 sqn35ZJVsVE25dXIrtS3FLNKZFzqcZKdlhfhgVahCNCTGBVLY9VHSF0DkA3WA01LliyRRQp0W9Uo f9DAgXoqdrha5KiKIsytaBgSe1FRgUydNlVdIsyT0aNHyTPPPC/9+vXWNAMcUAeXIEj+/fr1U5Ce pdJ8qqxavVrBt9KtHmpUiuf0F34drv7YVerRLcumu6s/KpAsBf+hw4bKBj0d9uGH8520zqEuGAXg jw3q6jVrlVFNcjapHPZ68smn9OBWb+d6YdCgQSGVlLY9Qk5tDyfXpk6Zosuena7duTm58otf/FKt j66UV155RZlerpo+7ZExY0Y7+oRCuOOV4SHpr161WrYoreZ98IGuUnq5t7QlMzNLNikDGDpsiFv5 NBUaze/oyR4DiGPhQaBWBxcTnUdTGTRZw8Yvgtk1CexGp6i5aXAeIWNohjWESPzYlWxIb4gZDRMx GhGocDx8LRYZDpFkAakxPII0wyDfam5sNN0t8bQmipPESmLPDmpkPPk3muZRHRl6Z33W9FhpoYOs XoH6NTVNrIzG7+PsvXC0WLHjpEQQ8hp/j+rElmrEe4TKJ8vGyezM0bKr5gO5ZdByOT9pm6Rn18rU bmcF1MkNtWsk0WN3GQkhpugSTZo0SWbMOMYB/HiVarNUjTF06FDnTjOiQojor1O1IqKnX99z0vRa lXoHDOivtqCD3GqgV6/ejZrGoGalkJ9fIL1793I7zqhwkIIrKirc4Syk53xVf1C/0F4FnDVEkunq ne3ccy6Qp5/+p+zbV6wHto5zKpExY8Yoo/lAdfhpcvLJJ6nKptAxjnI9tAXz6a3Ay57B/pKSgKWR jb4QgytVtQt1yFEfP9u2bdO8T5C1KtkPGzbMrS6gR43mQaUiunRtD8yup260jFPV1Yfz5+uKZYsy vyLNs9Yxo8KiQqfGckwvMspNdo1Gt9DMd0+jsStqrgYljBA7NTkjDH4NrCiCoo2WkeEfZHuw7vFg ucmw2FUjXO3Qn9B+i3vW6HkoYkMzGhoQ1Pk7l6uuEqFMXLXcWAyAYHBGOPqHIhkVI4XwxNGvsYDh qhmWyNwfp0d3X8Lxo2bgQUvzcIUC3KhRmwNqQCNmBGwCwNF4CRYuM9DQUNTGiGYtiR4pRAuOk8YA 2vDL5RdQmcTcc3FFBmnWMDdCtTy470wVGg3hptZwczbS+aEvDUofimssFzeWiEN9Ewo2qMjPBkUg v1DzGgmFNoBs1eVycJJ7o4EUHmiWf3g0R5oa+tKg6Au/D0/jYE42Wxo/ixpT1qIYVXDpY3F8fbzv QJ2sLUmWvTv1hGzJLsnb8KycMmS1msn3kbrs4Y3kIysxAvRU2TkTC/atfgfkAPSnnnpG1R7TFOSG SvH+/U5ybjzzQiTA5nOUHnzauXOnnHnmGXLSiTOdFBvSxVe4TdlgQN2zX/NDjcIhqwsuOF9BNN1t YmZkqkdL/a9WATq69oB9rkrup55ykpQd2K9Hg3upT4gByhjy5bgTjnfpe/fu7XT+MJxaBf8pkycq cFfp4bAZrgqAdLZK12wwRw8qnK7t0k2Mffv2qnpmqhwzfZra+xeqSminHgpTL3HlB9yeQa4yKUyl gqFO6wuj+te77zo6XXrpJe54MwO5T5++Lq/srOyI/uzg7vdPPAU8BTwFYlMAQfbMgdUyNStDilVo zNywXNKytkpV8jjdC1RLnsYc3mUSAXp05d1VCk1RidqkKBhNWnqqHs09y0nJzpJE/+arHh2gdZul bAwYcyRDBdbLLrskxBn1DRJ6SI9f71QqSMqNbfVDzy+44FwHnKhcsPoJrRRC1irJ4TxMrRSxunGS o8ZV5jFu3FhdbYx1UnKSmizxjHxdLuSre9fUMydHm2wSlWZI/m6lYNw1TFvocNppp7i0zs+PW2nU 6B5Ad/csR5kXAendNn1DWl58+dc5tRZMESkGmqS4skRO130KaOAsi4J6sihJx7o4RNsG6ck9D0ss Tphp9Coiz4YFgsDvwJgJJonO2mUfjtCUVB/JKlwP95tN/sgAC38JZO6yjBJvnMVSkO5h6SqyIcfY ihLEQ1mGGx4laYXoEjDHDFS0MQUjxA4TMxTRPXXlNaajvY3qhXDu4acmSlOHYOeFfx3UhVGZWT82 kCi6NPt9cJ82FfNgbXejioUrGkodnaurR5gWwf5234PLhnCnN04fPV4b6h4ZJNbXkWVIqA7RGHUw PQIDIpJtoxF9UHUjDyJD0AZ4pNcDUQJ5McyCvRzu22iLM1PpR6+wQuYeLYfI0AmsDEJkjhTo9j9t 7HfPVS2FfmRItsj0nlK85hdSk7JWUopOUBW0QXq4X8MDT01TkGzV4qUKaxF1G1x5cNXYmFSDQY0T BsUgXYOrKJvfzjwzZHborilsIbgVndqVEiijWneZG4fmyGXLK0A/VCYmlKEQW/8d7LwgNtlktGfJ Wie3olCJvUZtUkNzNlaeRoSGUeFAP0n9VeirmipNH+7ymuqQIacL0SMj8KzRAItBvyj8i0nhxlQz QLJOarpT4hmckdQxiRl7gIdW2Y1BINx7gcqE0rrnAUA5qBgDoUhlQ/mGVrvRKNpUW8OTIdjgaPKE kSakuYmG1FC+jZ8acAbLbPysUd9FY6ImczPBuku/OkO5GHSONUaCeTeQhsxi1z30vIl3KbGea/+E pmojvt2geAykCXIvA/TI6+h4oZpHGaKGwb+l0R7upAjJYwBUk8Pd2m9z2MBVfzNew7R3OUb6xAZF +GFYDdZI/RilIwgNzkAlglUO52uCVaPW6I9kdQmDS+OkpDCWhqvoStdJlTHwbMW8UP1wlWDSE0Yo qJ5D3jKVA2zbtlM+0uumnATQ1HiwOqJ6IdeW4jVJ2KZfWJax8M9SNYWNh6E6bWhBOyQBLTk44Rhj qyC5HSpnRcTqyeaKD8aPThs9aWO9j6ZDS6MhGiKjgSQmXIYb0Fzeli4W92uqHUG6tARojWnY1HyJ xQAazdfWFdOO48YX1RQFQpc8NTffGzO70N6nOpNUM3h3Xwg65HXrVsmf/vj/1D58e8O6PUaJTrLo pSaVPUeis/C90s4UCKlq9J/tKyRp1yo95OWDp4CngKfAwRRAHX3B+efIJZfdqD7s93BgKqTuWLFy tVrIbGyZZgOLFG0mqlRfGVor+NAOFFBIR/eGOdOG90XWvKtl4nzOB08BTwFPgdgUwPSb/UGC09w7 PY9aprQUnOZdT3jW6T6A89Hggb4lkh3y+9BpQPU+V68XEGyYq6fhZmmn6alkVDcH7WUccnE+A08B T4EuQgHzABABer6Uqj15S8GpCtRWXfTy2mhvaS2l7frv2d/Q7Rg9pJWsSpWQHU/bdegO4PGvo/r4 ZAX0mjVzJFlBvk5vm1EPOx7ku/6A8i30FEgYBdSpWcjc8aabb1alfYPP45glKPAkFw0RKeyvQIYT Aq+6MTpxke8udQ3xl+c/0JvYMZ1UU9Q2dpO5WKvX/lCbH5Xi35PktQry6sgolGdbc25jhXyylimQ ni9SpRYPgkozjhAyQYojoo/iKXDoFEjFaRm7sjff/Cm1+9ZNVh/aTIEtesDq4Wdel7JqtZtPV788 IUO5VoeQ/a3ulCvIJ23+UGrWvquqG3XqdoirhFZX5ChKUFCQJRMn6jVulRnSTU9T16lZ2mtz17RI gcyew+WOL94txx97jDtM99v//a0sn/VMk+nGjBkkfUaNlZzBY1X7WSfP/+530kd9Im3Sk9c+eAoc LgpEDkyV67V+LYXQISbgJqSfb5BHWjIni8rZCTOaBm1HrBM7RNd3TlWkk0EdDLdUNbddwF4lVurJ TuURdn3c6Bh3MBu1t8ceVW19Q3bKIdfBlJmsaZzixW1Uh8ynna1/E3bUrpoa4YBevVi7Z4tmUCj1 3PbSxgWPo2yK2uDvWiy1K99SVXyFVGPT73XyLY+DNsZIUZvxK644VXr0HCrd9Ma11e++JwfKSmXO sp0Rr6kHZZ2WI9/50c/lrJNmyN+emyXDB/SSX/78Z3LjjdtlxwrdNI8Rzj//WPn8XdfJG/M2y0sv LpCv3nCDXDZtmtzw/e/LcnUR4oOnwOGgQMAFQlgp0OJyUk+iHlQT00fjjpRTrfh8b8ZSU9/hosDc DsdsmGbJaVKOjzgfPE0xBEvMSV1i43ce6K6tViAHnVExHRw4uEP+YHedngvAoRohRXXgsLIazSON E5JJtcpA4EygefNdgK1rfWWZHidW52uOAG3rsvrkNEku3yU1q2bp5QFhBqwg7xf6baNnPKkmTBim zvVGy4UXnqmnwevkKXWBMXnFelm8dreUVMQ2Jc7qOViuv/g02b23REYO7CEPvfCe3PeDW+X4E0+T p5oAeg7f9e/bQ648u0CyV+2Rj51ziWx/8QX5krrruBvPsPFU1sfxFGglBQ52U9zKDILRa+uq1Jwn 04F9S7hMOvTagH1sPKyR4uJ9erKrTgp76gXkLaAmMJ+iUu+2tYtk4Qr1ma8+dvL1XsUmk+nGacme Hbp52kPy1M/O0g/elo0VWXLOzOkhlwm6ktize6+kZedKnnq8bPD/3jSBYIFJyjSS0tj3aMpJaUsE VuYCY1szS5KKt4RPCnqIb4lqh/o+P79QPbT2kZUrP3LO6tKzU2SzmpfVO5cgsYEeAaFUTyxOGT1A 3pm/Uj5z5SkyrG+BlKkfpKYClhC409ixebd8oJc5V/zhD9Jn6RJ5ftUqbzB7qJ3o0zdJgYQAPTDE cdsDezbKT775PzLl4ktlUC/82uCMTOEPydkJxHpblTosqyjeIX978FE55ryr5earLnDeAl0IS81O nVNbKt+761ZJH3+Z/OArN7qXsATK4TuXjqDUadCCh96tmf2afPX7T8kjr/xdinJVheL87Cj4upia LqyCwR/Onp0b5Q/f+rGc9anbZEyPPPnqpz8nS2//vnzhmjNk87K35NrrviiXf/778rkbL1Lpnso1 r3OPbJQ6zhWHuimqW2ghDtaSd66Q+q16sYAP7UaBzQq8GzaskNWrV7g7BjIUkDOzUvSTrl5Mq2LW o3LnWvnFnx6V//nO52Tq2KEyRq/jfOzVD+S9119sst4vvjhH72R4XX07nSJPf/iB/M+chXK8Og58 80DLqtN2I4YvqMtRICFAH6KKgnllqTz78FPS8/SzZcyQ3s5ffJIa7KemJukmV7m7WnDLlq1SmFMl 7z//hhRNvihM0JDKp5H0nZIlezevlyFnDZY0s9nXuxDXrd0s3fXijpxk3DAgsTcG1DRF29z83tK9 SK0g3D5CyLcMG86uljAIgFjrNmT0dDl+zOPyvR/8Rl566rfymWvPlldXrtCXZ8iD990r48/9mNz0 sfP1kt4QwLck1Tugd0wtPlVPcDShLMJePqVKb9taP1etV7m9y1tmtNeM27p1pzz00Jt6ZLxCvahm ORfVb76xXHbvUlVcU6GuWu752X/I+rWrZeyESbJzxw557omHpHT7qiaTLFq0Rq699tty3nkzZfuq 9c5Gx4N8e/Xy0VtOAoE+BHK5PfrJyJEjpKx4txxQN8B11ZW6lK2QDPW/XrV1lfzh3uflk5+9UUYP UO+OepmJk7NVt714yTzZuHmHO8nFreWiG5AlSeoHfvFsef6FanVZnCq71iyUn/7iXrnkjq/K3Z+5 VjLDABxiMyEwxv98ij7PyAj9xjEZfmFK9u2Wuoxc3WjLcDH3bFgs9ypTGjJ8tJw2baM8+/SzktZ/ mpzcp1Yee+AeeW9FhVx241R5/9Un5GW1vvj8Fz4vg4vUG2aLexhtHUy62ar1rtu1Wur3ro+LsbS1 JJ/uYAps2bJTnnhip3vx7LML4idRxV556W+/lJfiT+FivvDCrFam8NE9BdpOgcQCPfVwV+rp7eUD +qpmM1U+eOUR+dL/PiV/u+8vMnbQYPmfGWeqhH9AHlfJqdLdrhTate3Vq6/s3qEWDrlFMqJXkboE rpSf3fO3sEvfGlm9dIEkFwyX+x59SJfTuaqz10NeqgJatmyNqENIzYUN1TRZumKDlOzfJv96413p ka17ACrJV+/dLv/vxz+W6h6j5de/+YWM7J0rrz/zqDw3e4P87hM3yCmnp7prCevdxm21VCqjOe38 S3WFUiGP3vNL+dsfn5VeIybK56+/QDK1VXW6kmi9Yqb5TqpTZpRSrXbYW5d465q2j+cOl5JrJwlc ptNcIF5LcTpc43yFOg0FDgPQi2Rk5cugoXqDk4L+rj7dJaVbDxk8ZLDk1O7UwZwjvQuyVTLmUBGy NUpzkZ69+0nVvnXyy/97TK77wtdk6qjCBiLW7pfv33ad1E24XC64/GJR/HYBVQkWOfWqi6nTrNxN 57oi2Lh8jvzfQ3+Xb9/6cX2nF3rn5suXvv0dqU3OkILMJCnZtlTuefBZOf3OH0i/gnS1f97ndOOY ctZrnXLSkuTVp5+SotFTZcTUE+W5l++UYUP66koAxnR4jomRa/J+vbHKbcD60J4U4A4EbgTDDcjG jRsPut6R6ycHDBggq3TDNBi4UIcrI7lbgLRjx46VsrIy3dBd6W4hA7yvu+46FUaWqVroIclWXTz5 oJLjKkni3nnnne4OBi6c365WNyNHjnQ3oc2aNcv9JR82h5cvX+5udVu3bl2z10+2J918WZ2HAgkH enwmJ6kvlqWL5sjiVZtk/dxFUre3WGa/8pKUqlpiV1WR3HbD6eFN1QZCoRLpP3qmnDj6RfnMrXfI k/98UPpkh+TmXas/kgXbDsg3f3C5A3lTn+Tl95IZJ/RqRO1di56XnqOHSrrquEceM0MKo/ZPa1RH X5U2QH597/2qthkp61Z8KMtXbVG1iUrpqRmSmVorf/+/n8uby8vkc1/7htx6/ZVu9aBe5R1D4SBT 9GUYCelumNSedZJUU+6BPiEEjT+TcePG6V3AV7nbwH7zm9+4/RyAm1Pj69evd1dpdtdDTcXFxe7m NAK3lx133HEOrN98800H1qeddpoDcICeO5ZHjRrlQP3DDz90aXjPlZKMXwAcBkB+U/RuYu4htrJK S0ulm16decopp+jm8Gq5+uqr5de//rVeiXmyHuqa6OISxwdPgXgpkHCgr3O3EqTIiDHTZMiIyTIv ZY+k6KbW3r3bZMiYU+S6kyZLauU2d9tSxNomXFs2Ti/42M3yx3vOl//+0zPy489f4vzGLJz3jhQO PVbOPlZdJDtr+ZBI7yxq3K+wTY8ymdmz5smxF10r46rXyp8feVW+fN2ZurJQn8xar/pkTmElqZl7 Nxk1usDlMWrcsfoJVaBaXf/+5L//LBPPuVF+8OerpEdepntecaBcMrK5mJzVg5ap+cR1iCveXmBR o4ypVqV5WsYRrlA7fWgvCnAnMBe4E4YPH+4ufEei5ppLgJ4LHK699loHuAQYwVtvveUYAICP1A1o wyyI//rrrzuG8cgjj+h1lPtcGm4qmzdvnhu3I0aMkD179ui9xnPdxfa2CkCqf+mll1y5MALqBMOB yaDaIS35z5kzx9XPB0+BeCiQcKB3B5R0gKelpetHpCBHNxnTc2Ta5FHyo//4tlR851dy6bF5OuhV Wo++baguWdILBst5Z0+X3z/0qHzl1vOlV2ayzJm3UE487wrpns61hAzuoFElzQzdLrV30wJ5adYq +fp9v5KxVbPlk1/8hZxz5nEysXeOTooyd1MLB7XY6N28dZPaQGPto8nhE6nJsurdJ+UvD78g9zx6 g5Tv2SZrttXI/HmvyU9++Re5+KbPyVdVfZQCyMdxeCoe4jfEUZpV7JP6sj1emm8d4Q45NuNm8+bN TlUSuhC+1IG0BSRrVDOAMdI7DADQ5TcBEAeUjz32WJfOVDWTJ0924G8gT1zUPFwwTyA9+Q4aNEj+ 9a9/OdCmLJgH+RG4ZxiGwHvqNl8vmkeFw/fDZxRwyCT1GXRACiQc6JF0d2zfKG9sXSBVNcmydsEa yVCTwY27quXcM0+Rtx75P5n3cppsLlEVRUq0ROIcEMioMaNk6wMPy87iSumZUiYLVu+Vz956vL5T tRAmleFggz3kRqFafv3vP5IeJ1wu50wfItnSWy497lH51K2fkyf+9gcZwH21KjWjg4fBbNq4Wbbt 3O8ObTmtuzKnHdt26WXh6bJq+VKp2K7+TnQiVkue3HbLzdIdc1GdYCkufoIDJpkV+yWpWl0oJHyb N8F17WLZMYa4lJ5PrADo/uUvf4m8MjPdYFwk+RdeeMEB929/+1sH6Ej23O4TDK+99lrkQnjyYTyh 9rHw/vuN3SYg3fOxsHixP1vRxYZfuzUnIUDv7jo003H9W5BXIMN7dlegV9XIaD1W/vHbpVKXnVmT J0l1RYlay2yXeQ+/qons8smw95zwcdpT9FaUewqPkWFqHbNqzktSOPpkOW50P0eUjXrydff+dBk7 cZTa9KjbMGcfXyF/+uG3Zd7OTPnFX76penwUH1nyle//TBZcfaNcdPHH5I//+0uZPm6wxsXHTZoc N/O0g4i8fVCN/OWfC+Sciy6XIZjhRwU2kJ3vm0SDPauMqhL1aaMOiJ0LCb8d224zoJUFAc6xAiBP AOQJ0SDPs2DapvJpZXV8dE+BuCiQEKA3rTmQW1dTIrt2bpX63oPUJh41TugAUZqaPlarSWVyWqbk 5qi0w7xw9yCqmaS6InhNJZsDyhlYEaRqnJzsdHn+74/Ih2+rrjN3mDz997+rfX2VPP3YX2T51gz5 2W9/LSdN7qvAv1buv++PsmV3nvziz7+WYT1zVBKvVrPKVMkoGiZ/fuh3cssnb5PzTj9TPvP5L8nn 7viE9CrMa+SLpqbqgGzdvlkW6sbxvpIaKVN9bF2+Ol3A65k7rGUhPtcOcVE+OpL6VnF01M1i0ya1 KR+fyFPAU8BTIIoCCQF6p/lAisGiRU8Lrl+7RrrVqs7ZWSNGKzoU+KvUh0x+rvQoCm12ZmbnyAkz Z+KtJmK8qNbqzp78xNPOUCZRJxVVoe3Js844T+pSdXWQVSg71i+Xx556QUaffIXcfeZJah2j0roy A4rEg2WNLjNye02Qvz7xlPzj0SekuCZTN9XK9X1e2Bd4aOuzVq9F/GjuG/Jf/+9PMnDcRdK3UJ2K 4QkzZPnZLsE84yRc/d8utfeFeAp4CnRkCiQE6AF51A1ZBYPkl3+9R6afdbKkt9Dqk05SL4GFPUIO xDKzddM1p5kUseCvXtL7jZLP3TlRN31DMjDeIzGTdKb5mkTPmbpnadk95Nqbbo3k7zZ0I64T6tWi pkguuOI2mTLjLEnN6SGF6cqMnHjdTjCPqgbzTlrh6uVOgPngKeAp4CmQEAokBOitJjm5PWSmgjyh WT2zAmj3Pv0b4qH3bhbZYisz0jNCKwIU544VBIHZYTQrhNB79ydCsijj+rBP5X4DhzXUqR2leVeo ujYOmVW2E3NJyPDxmbQ3Bfr27Rvx23Q4ysbqCKuiuENaNjMv7ujNRkQFUMMtXXEGPffi/F21V8BJ o67+4w6p3EmRwDP0esYmJIG2PiSUSnFvIoaBOf7qxhZv4y6vEcjHLrU1ecVf7zhjKj2S1Q9PPQOX zjSpPs7kPlrXpkBWVpZ84hOfkEsvvdQdouJw1uEYrwhKnNDFjv/++++X2bNnN0FYBfai4Wp1MVSk mwps7oT7oS5BNU897yIlW0V2q2PB4pD5asyQ21dE3ZlInpadirB3qGXHM360fjChkk2h+lHPpoKa iEuh0qfbQLdST0z9tPxytQwrXh8qv6oZZ3sx6hUBeszBCE3e+BQPLY7yOLi2TVI3Cq13Uax20Vl5 kpSR407G1jVzk9VRTuKjrvm4VfjjH/8oM3UPqz0Ch8XuuOMOuUFvvsJU9Otf/3pjpqJnYmTwqSL5 g0IghpSbqJCiGNRjbAgk9+o1jhveUnANSNC4KRmgdOgxJgTwqGDb00ItVeuXPUmZnF65unu5mgCq Y7q6wF0FKSqoDVHaFCoD1PueQ7RJIBOCqcLceugJz43v6CEOBf04gzoQDgXsdXPVLLI5SQH7mZBv +QQuR+KsaEePhi/8DZv1GkHng5+NZHepYXzVRnWllkZJeb300NSuxA6O+GrgY3VACuAX57HHHhNc NBCYmwhi9teeOQHN/dNYhdL4nEmDOtWEuWA+1nxLk5OTI3fffbczE/33f//30GtWnEPPUJBXiVWN LkTPpSQ8YKZKO5DYAfbV6hfU1BUDT1LfExNC4NoaFUqiKglmUzYMrvfkEIZveDuUO8+GnqZMYFRo ZRKrfjAlLA05LNqWoK7VXchU2++hZylt9N6D/brCiCPoKlCvoFbifuELd8nyFWua1f/puVSpy9Fj 4tkFmjWtbGOF46hYp4yiknh5arYkd1O9Zat0c2zG6jHiwiFSv31Zm/VwnZJmvtJNUuBzn/tcI5An YqUCLytHQhCouantLT05W15Z6W5t66M+daapgzRAfZWe/B2gTtsyw+m4xD5dj6330FO+2PPPXrJE clU9lKVuHUYqcwnm/YUvfEGZzd9lwYKFIt0VxLqpJB8EeL1hSzJ07Bp4OTDkzmY2ucKMB3AD5CJx wr95z4f4Dk7Cd1IQV02kpVD3zJCO96zWSyZQ16gk7wSpsJRcrd/56A1x7kOIVZa7ilTzNlNpA8wg 4PLMmevFqDPFqRsUJbwyOw5cYpKn9aM+e9XRHWqcgiGhlYijTbh+VRqnRuOma900XbKWl6an+ysr NU74fgzXFurciF5hQLc4rm5h+rg2aptZ0fSZqrbpeql8HKuqiOqmRC9aOBDPLTd0aoYuH+BsrQKz o2BGM27VVJSN1dZa7GAllFTYX5LUD48c2JfIBd9RQPiu18QePXo49UkQdGsVsH726KMyWdUrgHxP Beph/fsrzqbpIcL9cr/q1nmerYANaA/r00eefvdd2agnd8GJm847T09+Z8qDr74qOfr3ylNPlY16 Wcr/PvmkYwI8++zll8uoANjjhoH9gQUL7lagV2Az6dphWb1cceHxMvujNbJl+94QeKnQmK53PlQB ZgQFzwzFDOpeU6nAB1DqM9ykcMq8RkEsWZ9lKYiWlegtW+7qxlDebhJQ5h5V45iEb6DGxUF69eO5 x4+T+Ss2yvsfrQ3dQa0NzdLyy8tUnx4uKzc3W92d6O8woKZpfbj3orxMwTtNy6umzpxkbqwKKizI lX2lB5y7lus+doa89v4y2bRtT2huO8alWAjzK1Gw7akqJ1fhMMhr/aZOGi6jB/WWecvWy8q1W2Vg n17y+Y+dJt/+3VPqPytUP+dALystVBfnQTdEszRlXNCmXhlZqtaX7xGG4MBeaZmnzC+nt5a/ucUJ EAH61AiBm0+TVNBTUvqPU/WYuhNoMfujLQJXFWpPoWtkMLei+UzQulxdLRWpBHPgw1ak9FG7IgVO VRDuo0AdVKVWqz+c7uoPZ5EeEtxbUiIzx4+XtxYulD36/UL1odNN1S2ssdeoj50hmpbfO9QXT39l GuvUaVuRpkXiJ+0H6mHzAnXGVqUn1vuqY7Z9+gywr9D30eHcs8+W7/bRy4TScg9abV562hRZtWmH bNmkKseUejnnpAly0cmTZakC2+///oaepamT46YNlYv12Z+efFuWLd0g11wyU849Ybw8+PwcefXd xfKN2y7WDeYUma23b7341oIG6RwrHDWNdnrpnD5adkAfrgB4xelT3Mn4teu3O1cmqSp43nHN6dru LHnunYUy74OVcvF5M/Rg5QjZuH2P1udNXTinyPdvv0TpoIcv314oH3y4SqZNGSE3a502qbvy//7r S26V8zl1hrhJmdeTb8xX5pghd117hpQq83BAbwGml6cn9gHczKLQysSCfr9CaTNl9EApVhBfuXqL tjFZJuvvr3zybPnbC3Nk7brtUtgjX2659ETtkwNyz2Nv6s14efL9z1wi23bvlx//5QUZPLSPfPbq 06VEGcNP7n1BL3HS/rGVEuqifN3wbQ3QxzNZQqsH3fFXs6F63WzwHhYbUy0k5ITYX8RZWjyEDSeo V9qm9JsodahvqkNH6X04OimAG2TTxzdgR52MV5/0J6ur4gfUVTGqlwN6inu/OlubrG6P/0f1+Uj7 Q3QM8hyQz1ewf+Ltt+XC44+X7Xv3KoDsdgzg7GOOcSqbS0480f3+/dNPy79dc43LM3qfDl/9mXr/ cpmzrmkc2Jsa3r+nOgnco9cuFsvJU0bJ4L5FsliBDak9R0/B33TRTJk0sr+TvJep76upYwbKCgXn WfOWK/CmyrHjh8h7i9fKRSdOlBdf+6AB6CkKqTldVaFshEYFpFx8U6WraqRevTZnqFR++vTRskNB 8hh1dzJv9hIZq/dI1CjonjdzvPz1ufecZDxO7/ZdvGaLnDljjHzw7hKZoXHHDe0na/Xe4BRlBKnq muU8ZUT//vsn3XWoZaq2WbVxh2zeuc+dz4nYSjDXUaGk6SreWdcEgrb9ybcWyoDehXLtOdPl+TcX qN/EZNmqNBrQq1Dv2xgga1dskktOmSQnTx2hqrRUueeJtyVPmdSYIX3kh395XqoV3CcM769tGSQv az1TWX2oI8ZG2gJn3tpyaJV5JdICDWWbsd4t4bxMH01it/IKLztbZRPv9JK6SspX6UU3nJI3ve98 6iTrcjMgx7Tcoz5Gl6BAtAtiwBfd/DT1Zkm4SIEblc1OBfNPnHOOU8ncfvHFMn7IEKcmQapP0/23 06dOldPU332aqir4vV3jX3P66TJQpfy3Fi1yEv3wfv3km9dfL70LC13e0UBPXeqddUlgvjPQ9eeD L7wnPQryZEC/7rJ7X6nc+/QsmaigvmDlJicZV6g65HEF7zc/WCFzFq9TvUq6SskLZE/xAZWq1beT Xv35+8ffkm179us+gW72mq7detE5l0KHH4U1mu5xvYj9NAX2Xr0KZPOu/VKiEvevH3ld+vXoJi8q yCtR5OX3lmqWyfKv+at0taKuUTSf3+lKY8/+Mm27qmpyMuUJldp3FZfJEmVOFRVaJ23YT+9/0QHy wpWbpaqiSn754CtOveT2GYJ1cXWLgYU6d7fs3CuPvjxP81YupAxxx74SeUCZTYXq7lk9oLuHwVVo PZykrmGPxv35Ay/L5m2qClNgf0OZIQx/zeadUlKq6h7T20foE59dfauAPkRqDvUQ3NHRLjGpEtUI o0arAD5QOMvc2hQ9ITtoituASj6wx12F2GhJmKjK+nw6HQWQnnN00xQgLtDbrRzgq8oGACecPX16 pE0Dw771kdCD4ZKAmeYZygQs9A1fiNIqomh9nlewdYDAhqOC9Op1W2W1gnxogzRFahTEnn15rgox ihdufy9dZs9VO3A2H5HEtS3PvzovBKDo0JURxCU/avrNW3fL3x5/s9Fm7Ktvzg/l48pKkw8X6UYu 9aN88tbw/Cvh8piwWp8dO/bJ48qgbFOX+fu6qnWc5BwG99nvqzml+x26hqjFwJkEVfNs2bAj1FbN Z68ywpdeV7Us+aAqV2a1ZPlGWbJobQhKlTHtV6++zylz0I0WfZCkbq7L5Iln343Eb7HcJiI0bMaq jq6l4HiH3hYl+3XTxNm3equblmjWuvdhFpqsy7EeOgk3qIfPJrwlti5fH7uzUaCpG6RM2ra/DuRb fQCxddRAMt+zd5+ORZVMVRCJicRYmARD9G/e6V3M6jGwIVasMz8qPTcELHJU6t6j0m2u4lN6DMme yGyiRgek9egQq05YDVmIlU+j+mjEsOQdSqL107st9FYltbpR2mA51xSXKo/DFFXduTfUJZqe2p5g XYmIumiP4nEcIZVOZCPj9ttuV9Mf7nJteingJNbCwVJfoCZYbTyKG0edjvoouEKQ+kukftslklRZ FpeAc9QTrQsRABCfGpC2m2va4TghGyzPrR4Ki+S//0svDcpQCw9naddeKlusWxSPik8LncBtDkiP SP9TPwXgYrVp5wBZu9IGPqNWOxW75Z960VLTp5hDhElFn4cP9Bs+eYPu8KodqA8diAJ6OMWHo5YC hxvE4yVsN1X/fOmOm+ON7uO1MwV2rJzbMtBbnUpKQ6qbjjK42plWvjhPAU+BJijgMaFjDg074cx9 xi2FVm3GtpSZf+8p4CngKeAp0L4UaOqS+OBzD/Tt2ye+NE8BTwFPgYRSoKCgQHJz9TKlQGAVlqcH 5Cx4oE8oyX1mngKeAp4C7UMB83V0y6dv0XuxL5ce3YucuwZ8l9Xoh6tbS0r0bI6Cvgf69ukTX4qn gKeAp8BhoUBWZpZMnjRBunXLdQ7TMrD917Bp4ybZs2e9+94M0PvDUIelV3ymngKeAp4Ch0yBBhNX JPa9e0tl/ocfyX33/kHOv+ASmXnSaSrV1+hZrRCONw309SEDf/xVuIA9q/N1EW1nH77jNBSbiPqx Z6Hf9Zhwunwa4kaeOY9zQdtcy4P8QvHr3V2w3OPKX4trf6Nsejk8EnI6c1CZDSd5OVZtPiMazrNa /RuXE7LlDVke4HUPGtiNOu7289DH3UMb/u5cIJA/Lk3DDgzclWehutbrIZCQH5PoevI7dOIY+rg2 hF25NqZhKF4oTgNDjtDGlU150EjLdz60Q3UJkTtEO0sfqkuoX0PvwvbL7gFttfaFxkJDXUJlczze xkkoTwvWBxaPcRCikcVr8OdCXMqi3lpPlycHUIjfcIFDJF3Yt0goXsgHS722L8m1m/SYDWta99vy oP6hMVyP9z9/sjvQV/5r56AAoIGXywa/Q3jA3L59lzz55BMyddqJ8q9//UvyC/vImNGh61oJTQC9 Zla7X6dBnWzYUuy8rvUsyJHVm/eoV7wCdQEdOmSFg6Dte0qld1Gu8ydRXFqpR7TT1HFSifTv2U09 rlWp/4p0ydXjvCX6bqv6oxjQK9/54shTHxMl+yv1pG+aem4rd17oyKNMT5Bla5pMPT69fnuxHvXO lIK8TCnV5wX5ObJ5y151wpThysWZUd/uea4ezOnaWvUHkpasbj116aLPivdXaJ0qpHf3XKnROpdq fdBdFXbL0hPIyeqxr8K1rbKq1tX7gPq5yNfysjLTZOu2/VpulvOPQf3TOK6teSxXL30rNux2bR7a Vx096ck5LiDv3zPPnbyu0dN/GRqX7+u27lWHT0WOSazRemfosfB0rV//nkoDrUeK+ioBhLftLA21 R49F99H24PdiQO8Cd3S6SutE/plahz0aZ9P2/c7dxRAtO1fbYaFWT/XtVv8heUo7HCS9NX+deuwr VjepPeS4SYNk/aY96myq0Pkq2ruv3NELupK3uY0F/MtKq3T5V+NohIe/dVv3OalglOazS/PP1Lbl aV3Wb9mnzp6q1J1qiozk3a4ypx8sLORofgPzLS+rVFevFVKtrmAH9s5XnWGlSwMtoIsTCzjdqWMC N7Vbt26T7qprLCjIV0+Hq5y/lP79+uhyVPtA6ZXifKEkS3lJqat7ji5XS/S0Nu+4JW3Dps3SuxdO uPL07odK2a5ueKv0RGT3ogLZv79U275PCnXzqn//vt6UuHMgm69lIwrojEnGDTobrWHBUYW0tPQM ufiSa6Vnz14yZeoM/Z2m0NLgJatJiR7Ja+vOEnl1nnqbG9lXlqzZIbvU78KiVdsi4A2gz1+5TY4Z 00/dSKQq6FWr459U+UjjXnLyGHn1/dVy5vThMmZYL3lt7moHQFUKlhu27ZMLTh4rf3/1I70gIVd2 7C2TsUN7yk79G5KbcTuRrF75KtX7XC8F2nR5Y+4aGaNxnn1nuQOWuUs2y5RRfTXPFNm0o1j6qiOj CcN7S05KlWxT7jZ56iSZtWi9vD1/vZymblIBcedECX6ogHTsuAHqEKpMVm7co6CW6couK6+Wof0K 5dSpQ9TR0RIZMbBIwXK/nDF9mGM+vQpz1LXpcvnVo++69t79yZPVo12J+uPeIP/9hfPlg+Vb5c9P z5MRA4rkv+44W16YvVI+fvYk5zzpk9/9u4JzkeZfID/94sWyfOlyydTLzYeNHOqY2y5ldgtXbHV1 hUYwG+iZpnV9+OVF8qnLjlXHUGsdfajnzn0HZKiWU6WgDK2652fLb/4+W12jjnPMYo0y5ZWbdqtn wAHypvYh7YEZ3XbpDHn8jcXah2ly7fnH6BW15TJ37ocyZfIEqVXp96/PfSB7lUFeMHOUjB7W2zE1 +vELH5spby9Yp+/K5bpzJuk42C5rlXnBMAD+B16Yr97/9sqNF06TnkU56uOk1nnbW7F+pzLyCsec qmv7yz9eXyKLVm+XX3/5IumWmyHz5i2QwYMGSM8+veW119+WR//+pJxw/HT5zO03KWPbK3/6y4Py nf/4qmxZtkpWr14rl16uJ4Z1SfrDH/3cgfvnP/tpefiRJ+S9OR/Iz//f93QJq4KJHtOv2r5TatUZ 19tvz5Z16zfIZ+/4lFTpwL//gUfl2BnT5KprrtAKxXEs3cOMp0AHpwAr12q9kCY7J1sF6mLJULfK rNyrFXeQ9puR6EHbJKnUiN31tqShA7rLegXnEQO7OxBHGkNSRiruhrSrnvGG9iuSOUs2OSkJqS9f JfZeugrAK1ySvkfqnja6t072WgfsO3bud1IsAQAFQFgFrNi42/kAqqxOchJoX32WqZd5FCmQ/fON pXLM2P6OAVC/cUN7qeS61gHitt2l6op0tOzZqe5EN2+TSZPU3a82Fu95SPKUm63gice/rerGFKAk UH9WHYCbksatOt5futnVFz9IrBjSVNImDixoj/r5maCMixUI9cjQG2MylXtm6sqkR0G2k4R3FZc7 xpKr5a3cuEuBv7tcefoEB7rLFfgIFRWVUlxcIsNGDNV2FkhfXSmxAmFFwaUD85ZtdfFrw7fhrFW6 sPJgdYKEjTS7XqXtMq1DppaD9/uC3CxZrsD8xrx1cvEpY5zUz4poydodjslW64oH0GUVtX5bsazT ug3q3U2l8b2azwG9LyXX1fU1ZapI+0j21OfMGcPdSujqMybI8++ucCucC08cLU+9vUyOGd3PMUxW eUjqrHAObK3W9le5cXDs+IGyQ/sZcC/My3aMjDzz89U5l7ahRCXz3QroAP2ECWN1XOySs848TX1/ H3C3KZ1+6onKmEO3oJXpxTjLlix13gW3bt0uReqIq7i0XE4++QRdeVVJoa4E0lSqnztvvvTt21tW rVyreZ0iHy1e5lzNFmtZUyZP1BVCX73AqMp7aurgAOarFx8FMtVz6f79GxUHQg7v0NSiWajOzVFh K7RybkZHXycZCnCrFAz2qkvPkOvPlTJDgXa7AvVundxI1lNG9XHqjTXqyxn3m5lclaXgCqDtVyc8 GftTZckqvWpLC3voxQXqiL+PrFbQeqziIxk/rKcDL1YGqGMAE9QWgGqeuix984M1KjXukYkj+rh3 oYtd6tySJD1N72hVV58wCSToXQrcddrCLPUAd+YZJ6pKWm+2UUm3f4/csFqmXhlMqVPh9NQ0z7yz 1KmWUK3sWFqqfriz1Y1omZP0qStMaPTgHlKuUiFtq95Qp8wrQwar+oFVyzO6sliqAHrchAEyTKX0 VarSoY55KilPHztA7n3mA1fOR7oCQtId0iff1YdVUZ06hBsyeICCXTetc408o4C5QONVaeekJNc7 9cx4ZSbb9pTIHo0/YkChqi5QB9U5Cbma23WUOUwYyGUMoT2JBUpj4i3T9/jo3qMMFretH67Y4m7O GaWrExjKnCUbVfrPcv16QJkN+uoTZ06X7r17ypKVW138KSP7OIb2hq4EUNENV/BHDfXQSwv0lpwC t4JiZdFdV0LzV25xjKdQGQP9SR2H68qFpRPPP9Q8X39/ldKoSMdNqVt9TB/bT9YrTQfomJo4YYz0 6NnDqbAylGFedMFZ0rv/QFmzYoVU6om/yy+7QDapOmbggL6qcxwuRQrm5fr8W9/4kjLG/TJCr8ur KS+RsWNGuNXP0iXLpL+C/PhxY9zqrX//PqrSUfWgOuVat2atXHj+mar+2ypVupLJzFJf4j54CnQq CjDzGu9LIqSN1rmRl9dNKhQ/wVBW+qkpFTr3i91eVRNArzKT6oGq68tl0qihET/3M6eMdlJY/965 qkPGG2iowFxVNfN15OBu7m/P7j0coA4f2N/F2bi9Ugrzi2RGQXeVkuvlrONVTRC+o1GZjvQoDKWH 8wztrxcf0BT9Pn3ciEj6lJRMOWHSKKfW6K7qnpO793TA2E0zAFx6ds9WhpOiUp3e+AL4odvVyxuS U3NcXvl6O05BNwWgMJlOPaa7AzHqM85tRtbLRH5rvSpU8j33hIkOUPO0bZU1IV3ynpJ6VUMNkrEa /5ixwx0BAf3B6s+bkJmZJFeeOcM9q1TVRY4yLNRF1VpPVj97Suvk+ImjlCFkSFEvZShaNswBep2k F7MTh7jjhhdKrdZn/dYK3WhMlZzsfGVq5bq66aV016WYIhjxlq9v8HZHHNpz3EQlpoZ9Zcp03GXv erWkrooI9EX3wtBFBSdPG6sSuN5IlJanIK/v9V22XmM4ZuggtxrbU1Irg1TyJc+K6np1WpiqY2GY k8bX71AGofmm6E1arCZYHo4dxv2jKk1oPss3ht0SsjKrSpIZ40e6dBu20Z4QrWu1zwb2yZEeygBR xZBfv4HD3MY8v4eNHCvDRk3WmlbL6Hy9ecsGN5dN6BJ15JgiZZi66ap9lZqR5y51qFdannjqmRqX 71UyYfIM5/2wd/88/STJmAm48dVVSvf++j7KO2Cnmuy+skc1BZIO9pKZoloTVDWVKmwfUAHb7bPl N/jOb8a8Mlsneo5+9KqqThTCvMcZnIwd3k0/HbPyYSMe5/X1xKn5R6ySzprIXZlTL0MG5OpHvfC1 Uwgxd4fLLjixIfw78l2ibhYKx2V1h1GOyyNWuuTMUN5BIy73HT/flNmwkd1OzfXFeAokiAKNJXo3 /MPAFzLSU0VugzGeK7PZA1NBZ0aNzAEDpoEJqvlhySYC+ocl98RleuTrabv3Bw+gxLUysTk1SbPm mtB5mpdYYvncjnoKtHgy1jykVenG2MMPP6wbd7vk5ptvVjM6VAShZXh7huh7NA+lbGtbMI/2bs+h 1N+n9RTwFPAUiIcCzQI9QLhNb49/8803ZYVujgH2AP0Pvv99magXFJ+qd08O1cuKwyd/GpXXHIjG 8y4W4JIOj2yp4avTGi9ZwodyAownupyYd2GG42OqF523ZwDxDCEfx1PAU6CjU6BpO/owqL7zzjsy TG+Y79mjp9uYI7AJNnffGrn/73+Tr975RcnR+yuj1TyzZs1SE7itbqOOdzNmzJCBAwc6MF2zZk3o wJBuIBAGDBggWXoXJsD87rvvOrO50aN14zcKtEv0usP//M//lDvuuEPNEytkuN54D+gHAd2+k3bD hg1qR/22jB07VsaPH+8O3QTDs88+qyaOxbJ48WK3QtmyZYt885vf1Jvrc2Tjxo2u7nxIR91jMaiO 3sG+fp4CngJHEQWaULA0K9FX6w3xgDFSO6cOBVtpBdY3dy6Whc+slBEVue4WeTWcaRR2797t0vXp 00fdZ+aqjXaZXnKrppB6YTFgCQCTN88A7meeeSa0MtDw8ssvq9lhvgN6U9NYmnvvvdcBdzd1v3nc ccc5BmTg+/vf/96B8V69v3G6XpI8ZswYV96QIUPk8ccfd/UYNWqUPP/883LKKac4MJ87d64ce+yx MlMvTL7vvvvkuuuuk+zsbLVJ3S9r1651AP+Pf/xDuL+TshOpNjqKhp5vqqeAp8ARpkCLqhu3g6sH h2Zt+EiyUtNln5pcPjTrOTm3+0QpSdoXU0e/c+dOp/JBqv7v//5v+djHPuaAdfDgwQ6kzzpL71jU 8Jvf/EYuuugiB/LmchOG8oMf/MBJ7HfddZeT9HlXqcfZAfZBgwapX4fteihqs2MYI0aMcL4dAOJy tY1GQn/hhRdc/hwkOPHEE92H8PTTT8s///lPOfXUU92KYvXq1fK5z31OevTooX4inpRzzz1XTRLz XB3791cTPC3317/+tZPybWVyhPvLF+8p4CngKdBqCrS4GetyVI1NWl2S/Pz9vzuJ+br+J8kxQybJ m7Pejlkg0jQf1DRs4F5xxRWN9Ookmj9/vnznO9+Rq666KlRE2B4IQP30pz/t9gTuvPNO+fnPf+7U KgA70jbvAeYTTjghAsaTJ0+Wn/zkJ45BAMyUbYzDKvjWW2/Je++9Jz/72c9cPlymC/NBTcTqA2kf RoBUb4HVxksvvSSf/exnW01Yn8BTwFPAU6CjUCAuoK/RU4uT+oyQ6WuHSZ6eOL10xhnqG2Z3sxY3 SPU//OEP5bzzznMg32DnmSQffPCBA+Vf/vKX8v777zup+sc//rFTr7DhO23aNLnmmmsEHfoBPfYO GJ922mmOZjCaJUuWOGAmkC/pUOXwbOrUqRHaonKBYSDxk8+Xv/xlxzRgQAA+dWMTlsAqgxUGqw/q 8NBDD8mHH37oVgA/+tGPnDrnyiuv7Cj95uvhKeAp4CkQNwXiAno8CKaoH5Nbj7nYSd4Z6magbnfI Z0usAPiif0dXDnBaIO3SpUudmgVpfsqUKXLttdfKt771LVm4cKHTlaPG4WoswoUXXhgBc5P4AWeT 2C1fykOf/n21BjJVD+/YvF21apWrBysAYwy05xOf+IRT1RgDmjBhgqsr5Tz66KNO9fTHP/7RMRl0 /ffff7+cf/75bhXgTTDjHl8+oqeAp0A7UoCzjyGTmcYnplo8MAUoIvViQeOSclhqT73Thze3OTlS fZDwMXC1v2yOorc3E0ny/ulPf+qkbADUVCfRYGq/0Z2b/jyafqh0guX17dvXrQyCDIHv7ANcdtll jeKizwfIKQd1EoBuebFKgCnxzoN8O45aX5SngKdAQijQJNADaAAiOvHly5c7PXYQ5LCaYdMSgIwV mgJEJO4gGId4hzrdCat3guaRrck3Os9Yv6MBP5h/sL5BkLd8vGllQsabz8RTwFPgCFCgWYkecD/z zDPl9ddfd+aQ0WDXFlVGLAYQfNYRJOaW6ngE+skX6SngKeAp0GYKtKi6wdzwkksuabKAjgDMbW69 T+gp4CngKXAUUKDZk7HxtN+rNOKhko/jKeAp4CmQOAq0LGCb69ZQmTGBnkw2bdrkNkg9kCeuc3xO ngKeAp4Ch0IBjGPQsvTs2bNVhiEtmle2zDkOpdo+raeAp4CngKdAayjQFlcsMYGejPAb44OngKeA p4CnQMejQGsF8GbNKzte83yNPAU8BTwFPAVaS4EWVTetzdDH9xTwFPAU8BQ4MhRQF5R6tSZHW1tx MvbIVNWX6ingKeAp4CmQSAp4iT6R1PR5eQp4CngKdEAKeKDvgJ3iq+Qp4CngKZBICnigTyQ1fV6e Ap4CngIdkAIe6Dtgp/gqeQp4CngKJJICHugTSU2fl6eAp4CnQAekgAf6DtgpvkqeAp4CngJtoYC7 4zt8LWsw/SE7NYu+mzVW5YJx7Husk13x+tVp6lRYMH0wTvDIcLxlBNsRvAaR59F5xxs3Fm3aUrdD pXm0z/9YdwA0RctgG2LRsi11szyj84vOK95+iI5nfRZv3zdVLvkEadVS++OhhbU91rxoKv+mxlFw bLamrdaupsZ1S/Rsbk7H6ttoPIi3/5sCvlj9FWssBfsvekzEM6dj0am5vmhtf8QaL03RPna5IrV1 Ne4TStdgS98k0FdWVrr7XLt37+6cm3EByfDhw2XXrl3ue21trbvyDwc7BG6c4lIRnq9fv95dv/fR Rx+5W6Ysjy1btsigQYNc/Fj+Gsib6/+2b9/u7nYlbyqMIx/rOO6Hzc/PP6idvOcCcf5y+Td1Iy0f fOlziUo0g9i9e3fknlruou3du7drR1lZmcsHf/x79uyRsWPHuvIqKircBSk8D4YNGza49nIJSzRA NueXInowUjYXmA8YMMDRgQtQ+E49KRPacrWhXYxidaB9OKHjHffpjh8/3l0KQ79xM5i5s7C6RA8o 7sglQKNggO70dVOAY/QlDncWkP7EE0905fJZu3atyw76kRf39w4bNszF27Fjh+tHroC0AH25cYx8 aSvxSEewevCO+lInu6XM6rd69WrXVutr4q5bt0769evnnkHfOXPmuN/0MeOV+LHou3jxYjdWbXzb mOUvfcNzG5f85m7hyy+/3D2nP6gvfUY5/CWO0Zd201+UT9mMVW5Ho/3Bi3wsf9oHLa0dsSZ59DPG M22gfOg1adIkR1vqxh3K/OU6zeCFQtFjFQygzkZfaEm7oAvPrJ+JY3VvilnPnz9fRowY4eZbU3PJ xhs4wHfmFOkoB/owZiZPnuxoZmMPGjLuCcH6Qq8+ffo4GpAP/UzdNm7c2Gg+QAfysrujjY7cEc14 AROCbaIuwTuwo+lOXO6nBsPIk/lrgTG9cuVKd03pjBkz3DWn3GsNbnFPNvQh8Iy0NjfIkz6kr6Kx x/ImTmnZAVm3cZP2bZ3k5xXqqwacatLXDXe4fve733X3qgLY3KcKaDCg582b5wh+7LHHyk033eSu BiwuLnaV595XBvETTzzhLgHn3leuB1ywYIFLe9JJJ7kbq7hoO3glIBVds2aNPP300wJDYMBTxujR o+WVV15xExbw+uxnPxsB8WAjAVvuouX6QAYek474DMDHHnvMtQOPb0899ZSb7NRz2bJlcsEFF7hL wAEh7o3lUnPq9eqrr7rsYThcPG4XsFAnJhyBTifv5557zqWhrePGjXODi8EKw7v66qtjXn1Ie4lD fbjukAnw2muvye9//3s59dRTHe24NJ28XnzxRUc/rjTkEnPKoUyAjTZx9SEDiEnBB3pfdNFFjmm8 /PLL7r5c8vnUpz7laAcoM7jPOOMM1w76GloBRrynzf/4xz8cEDNooQvMgzrxnklw/PHHOzoyoRjA zz//vLu3gMlBG8jj7bffljvuuMPVgQkGbZmU0J40ixYtktNPP92NKwASAGLAA06MoVNOOcXRhLHF 2Lj00kud4EA6mB13BxOYBC+99JJ7zgXx1Jdx8+677zpGDUDQh2+99Zb8+te/dvSFTtSNMfDCCy+4 39CXfj777LPlF7/4hRurgMqdd97pQJkwe/ZsR3MmHP0CHcmDMc31lHz/1a9+Jcccc4xjcNSH8cvY N9rdfvvtMmvWLEcLngHK9CHtp40W5s6d69oNnQcPHiw333zzQcyYuIwl8oNO3KnM7zfffNPdxYxw BpjxlzH617/+1QGVMVrKoy+4J5n5bGDz4IMPCuUzdmgLgMVYJ2/qzBjkO3Q77bTTHC1oP30JLRg7 ACxl0vfcuczcgY60lTEYnEvUh/Yzz5k3jFXG0F133eXGMmOd/iZPrh7lN/SbOHGifOMb35CHHnrI CaZWX8YoNGD8MB7uvvtuN6b+8Ic/uDjUibFGW5iHdqc09CTNM8884wCXy5WYc4wt5gL9z5xmfEUL jtZv9BdzBTozTxBuwFBoA9ZAG+Y784I5x53W0J9xx53axnCZk9CUNNxfTTxoQD/BcA9iMskq/KSk Sp32ZyjEIdETDbB98skn3cBGKmdAMmjgVgAoA4TBxWQnLh3FwGaiwqWYlDSEyc9EJh0ASmXpCAZB MDAxHn/8cZc375AOuWP24YcfduUy6KmHDe4gofnOpGRwkNakVDqLgYdEwyChvhAKjklnfPzjH3cd ShwkAOrNoOYZgwAApa6AjkmSlM/ApC7EoUPpPL6b1AYtyMckNJMKgnUmXwCLFQjPiUs7AX/aAdNi cCKpIAVQPpIOHU883hMY4PQNoMaE5i9MiIFC/ckX6YB+oY70EYPMAvR+5513XL9AOy52Jy2gQd8y +RjY0BcmbHfzMoFgbIAM4AWAUxeeAXi0n8EJkAKugBXlMLH4zcShnjAJgIPfdpMZbSbYpGTcWN/z 7o033nDjDwZEoI60HToyzphIxAFM6FsADDpQHvQFJOhv6Gr0pWxoRN0ZF4wPaAPtaDfgB+2YvJQN U+A99IIZQDMAjPyYsLyzFRnfaTdjECZBX9JntNnoGRyz5A99KZv5g0AVDNEgwzihrTbOoBVjnTxp MwyVcQqI0s+MnR/84Aeuj6EL9aJ/oRN1pf6MNZgltCIvhD2wAFAyiZ55AuhYfxGPdgGkCBI8R3L9 /ve/72hLX5Mvz62uzCXGO3OMsfvFL37RzXuEN+iN0Eh9aZ+t8ug3k6yhD30WrC/1ZHVrGgRoD5OB bmAafUce9Bm0JiCIMD94Bt15Tt9QDuOJMUj7bEUdPaedVK30uO+++1w9GRfUiTYwD6EvAfyhPbwD /Ok74kNn6s14pXziUF9+MzYR1qAbcyoW0IveDJ6SpFK/An6y09OjvgmFJlU3cEprLNIuFYFQSO0Q AOmHStF5FAxAIgExiBi8TAwmNgRmoPGMiUhjbVlEp9I4G7RIB0xSOh5iM/ioA3kQB3CAyBAQ4gdV GBASZgIw0On8pm5wZwYCTMIAD8kTsETKNzWU3Y9rfp5tAJDn0KFDHWNg0sC4qD9cGzCAJnQI+dAW BgQcnIkGOPKXNjHYjcFYe0nDwLJOo+5MMuhF/Wk77xngxIHxUR/Kp8NPPvlkNwCYWNCKcgAH/jLo iEd/0F/U2wYmdQyqCAAeBiNtJF/Kov2UZYyMNIAqYwGgow0wKOLTH0g9pKOu0BrAA/hpD3SmbOpF XACA9IwRBi+SDDRkfDCxYAbQgEAZjAvaydiBxpQDbVlZ0m/QiXZTf8qhXMYMY5R6kx8TnvFJH9oS mnS0k4vfLR0Mm7wYQ0x86k4bkMigMfEJ0MwYKXSBTuRLfSmXMcfKislMvSgDmtAfjFvSUzeA4+KL L3btoB+pH0BEHaClqS5NjcPcYIxGq0hoi6mZyIPVFIH2QAuYHtIh45G+5zljwlRj/LZxyLyBvtSN utNf9AffGfe0FZUG9YWpQyfmMgGABuyIz8qX+gPgBBgsY4e5a3OJOiAl33DDDa5OjFkbmwgd9Bv9 zJgyFQt5UEeYEnSinoxfxhZ1BMSpD0AOvSmDONSZPqNviEs59Bll8oGBsWqibygXZsd4Ix7lgCXQ D+ZN+YxL63tTJdFOxh9zHcGA8Qz2UQfoRdkAO2OAv7QBhgQmMf6pF1hBfFO50q8Iqsw1xpSpN6MZ f052lgwa0F+KSw5oOSFBqUWgt0owCakIHJoGs4yjAlSExtJoJHEAjw5HAmACMyloFIMSIsMIaBQD wbjxn/70J/n0pz/tuDmBzkfyYLIw6ABj8iF/W2pRLumRHElrA54OoS50GOXRUba3wFLRJAGWayzz iA9QM+iQ7Ogcnpk+DIZmE4GVCSAFsVEtMbiZNHQuZcEU6ViTahigAJd1FBwZCZ9BZ1Ip7Y3WlSM9 Uz/aizQJ2DMQAXTSMgigEQAAPag7kwcGyERg8DBxjbkACgxQ6GCMzkDKJji/Te9KXAYl/ciyne/Q OigVQSebiEgjlI80Th7kiboIUP73f//3RjpG2kabYFZMNvInbyYtExBaAIYwEoACdQD1QOUB2DLu UL3ARGk344glPWOMSU0for6hXwhMMMYe45i8UN1AT8qAvowtlv/QBgYAUDB2qDttoD3/+Z//6cYD n3POOcetGpAyLSCdEh+pmPoDEDBr6s9YABTJlzowVxgj0JSJS98wjkzFZkLMAw884MYAY4086XfS w6wATKRKxhbzJCjVQ3vT30KfG2+80akbmHPQ4tvf/rajLWBC/agHzNlWoNZ/tI3xw/g3/ThqQ+jG X9oBLQjMW2hDv5AXgf6gXvQrgffUjXrTJlO3MWeCc4m41Bu8gUmRH+lgYKwkGPfQ2lSrMAbawW/G D7RlfDFfWGHSl4xb2sl7/oJj0M5oynznN6tb3oMTYA/fYcKsUinfmBzMz2hMnzBOjLHbmCAd5ZKO /qU9pKEcxiC0pX2kZxzSJuY39UboQaMBHYhnq1TmDOMJGlAm49n2pwJYHtnbCs7tZoHe1AgsoWz5 ALDQCJNAAW6TAOhUGmWDnd/o4BkU1tlUFiAKbnoAiLacIh4TjkryjL8ALdIIgE5nMVAhGhJTcJOD cpkcABUEgHBWDvpv069ao2EedJAt/ZBYmHi0DTBlAJPGJiyAbaDMd/K2/JmodJL9Ns7ORLR0TBoA Krh6oS4MBiRFwBPaQp9vfvObbmLSfmgOKNhmEx1PPN7fcsstjskAbLasvfbaayM0px5INtZOazvP mQg2wfkN3YxhEh/QvPXWWxsNcuIxmQgGMNQfEKYvjD7ECdLb6IF0x8rI0iMJsRIM5sd30jI5bOVG G4zRMAagC2PNAvEZR0xG2+i1+sEc+ATjNkdf1BrkByMKrngsP+gC7e03IErbg5u/9A+MD8Az8Pzk Jz8ZWY1QT/qTMY0AERz/119/vQMoWzVQDjS2/PjNeEYyDII87aO+SMasDigXmqCaYQwDsDwDKH77 29+6tAAMK27mAHWC8Ro48x5QIw8b2/bM6BIUUuhHk96ZO4z36H5lbtu4IC0gR/k2l6w9jEXe8Rta 0F4bNwgWxCcd44P3AD1jF1oyD6gvGAHdYMD0gz0DwMGJaJBk3w96WF+AVYyb6DEAHQFg6kbfwxgM H4PzCzoyJqCfrbIQKi0YswuCNHWkD+g/aMnctnranggrS9vkD6aN53uTqpsgkEJIm2zWgaZftw63 wRksNKhaAUCCgXQm3QaBw/KnQSzlghY2SAH2PtZVWkHpxPIMDi4rPziReMZve2b6Up7HqrM9s/yp J5/gxINeDEarK3Uwelo8/jJI2HRiQPEbKdUCeVoe9szeG82j6UO8aIucaJrzG8nC9gWCaYL9AKhG p40GFwArmnkFgcvSQw+zIIjul+hBGrzwhgHOx9LYpAkyVUsfnLy2mRVd3+boS9wgvaPT8jsIcpQL uEQH4jEOgxZM9FN0XGPexDcgs7EYLDtIL77Tzuixz3OYI6BubScv21i1cRjrMiHSMtaQms3KzeKb hYz9jm4/aaP7KJpupKVO0eOCeNFzycoxqdnGl9HY9qQsns1b8uITrK+lCQod0QKf5QNNoy1pbE4G +zeIeabesTyC8YKYZfQI9ku02o045Me8jBV4z/yJnkMx40Yexumm2MAkVmbBisbaZIzVkJgtCD8M xo81yJtKG50uVr2CYBM9CKPrGSwn2EHBPKLza2pgx0pjg94GB+UzUSw0lZdJJMRjlRQLzG1DiTyj N2qQVnhvEzXWQIxVtyA9mqKVmcQFB3xT/RksI1beABU0QAqD4Vo7mio71nPaaUvv6LEZPaaDv20i Wprmxkasd9Hpg30ZT16x+j7WeGwqHkAVZIqxAKiptMFx2Nz8i5W+pXo3N7abStvWPONNF40n0eni qVdzZbVEp5beNwX2zWFoS++aPTCFPogBxFKR5RgcGBMrloBILCyNeI9O3syNaAS6ULOjZuJhohRL p4RuD12VmXuhdzPJ2ixSmrIbRY0DhwXEADA+lGu2tCx90GWbTTN/LW/M/1ihIPGgs0TvSpvQ26J6 QPJj8PNBpQMAoRYgD6RJdMLQhLSxBg2mZqiHCNCJpRqWQ0hULP9MhYXuHmnOyiBeNECg5/3b3/7m 9LOYQWLaBdijjwTQAG30mYAjS1ukIPKhnujAyRszM36zekAdZBYPtIk+hW6oyFgaolNGckKnCl2Q gtDPIkXSz9SPzSJozxIVixrqQf+z4kL1RTr0w6gioCHlkz/lUndUa7yn7mx4sbKjfWxWkhfxqBvP 2Bsx80vKtM0taIuOnT4kPnWD1tCesYNpIeUyfiiPAFMif8Yk7YImtIX+DC7pyY/xRZ2hJW1Hd0pd 2BCGPldccYUrl41CyiA99WMTl/e0zSRNxjh6WdqEWgKamxUOY4oxEGt+tDR5YzGC1qRJZPq2luvT tQ8FmrSjZ/PunnvucYMYPTJ6LGzTDTSYKCw1WE6wycFEN6mGCcIEQmf49a9/vclBDDAw8Jk8v/vd 7yIbHWy0Uj56ftt8NQmFSYIaBKAAbG1TC3A2oGayM3mY/OyUm9oJfS9tQY9Iu7AVv+2229xGMfbF ADATFdti9gEAIdphVgNsKKLfBsRZigOupLUJDS34DtNgIqPTZUMLJgT4IaHyF/09oABYk5580U3G YhrEAZwBfNoK3QENQBFGTN0ASvoAcIKZUXf2Dth0pj62KQu9qI+ZYMJ4ACtoDzhSDzYF/+3f/i2y GWz7KNYGgB0VB6BK3diQpGzslOlPgPzHP/6xoz3tZ+MIWlN/mBB1BfjQR9J2GAMASB+xGQXooqcE QK0/oAv1JC1CA3mhT6dvOWtAX8MMjNmhO6WtMHv0nTynH9HtYyzAeAPs7YwDcRFMaAdp6Isf/ehH jjEzhhkPpKFt0JixyVyAlnaWAVt5NkAZX4xRgJ75wFiAUbOZCj3Q11Nf2s9YIh6WHtGqvfaZ/r6U o4UCTUr0gItJwACDSaGAGZIQgGNLa9O1MemxOmBzkQkDyAd1+9HLSbO2QdpFQqKMZ5991kllHJRA yiEfAIBJg0SGdMWk4B1WAEwaniGpEQB8ykSaJ387LMQGS3AXn8kNGLPcJQ8sCZh0SO/8haFhUQLo mKoDafeXv/ylA0UshmBCZm8MoKLjZGMKRoCO204MUjc2fPkLOAJYABx1gJaYVtEGQlCXR33ZFOKQ BzQgDvmSnr6BDrQXcDRzQttQNJ0obSRPwAvANZNLU/+wwUufUlcAlzLoV5N4AXh+QyN0oLQTfTDA R1rAHTAz/S/PWAF89atfdcwIRk4fIrlCF8COvGkD9SZ/fgO0lA09YGBIyNCM9tphI8YVeSBlE58V JSsw2mKMnj4C0CnPNksRHAzAqT90pZ7EYeyyWoUBwwzYNLSTitCSttBvADX9y3fqCy0ZG6x8YGC2 f2A21/QHKzCYOhvW0It6UxZtpu3kyWoDZkSdoGMs3fDRAka+nYePAk0CPSoGpBcDR4ASiZlBDYAi EfHOANdOVtqGBwOf02VIV3znJCcAQTzTjSKFEQepEcmU/JCUg3powCy4MWykIA+kO8DWDnjYBiJL ZyRzJhHSI2Bku+MAAZMaacpOmFE+oAGTwYrFTDE5Ig5AEJjg1BU1Cc9YUQDqTPboAO3IHykUqwEk SiY90h75QFeAykAG0AdEScOkN6sDwIS20y7qiPRoh5lYnQCuAJGtcgBKpH3yoN2UZecRABXogDT6 s5/9zFlyQEOkf9oBMEEzax90hcHT32auRX1gbPQRoAUgkj+SrDEWswXGJpk6mzWR2ffDNM3SAzpT T/ID+ABas8+2cQLdYDQwAPqZVQcMhJUCJqs8p36on+hXQJVAGeQFw4ap0E+MWWOKjEniQE+kdvoK xmJ7JtQdujJeYC6khQkwRug7+hTVG1I94wEJnzi8Q7onLeXDTJDeaTfvEaBY/dJ3jEnoQ/voH1YU WGcEN0UP39T3OXdFCiQl2SGpOH3dICUxCO0QC8tkQAeTS4CYCcR7wIXlPgMfUDOpnUkB4AAY6FWR GqNNx5gESGl2upG0TCwmW3ODHQkVCY46miQJ8JrZHXkAqsRDvWSgYXWjHgACDMt04uQFY7BVCtIg 6gdbrZg5mu2MM6GjN1Uoj3gAEZIrgG8HY5DMeU8dyZPv0I/JTRzABHrB/My3jgEYpniANEAMMBIX JoX7BiRKyiKQL4CGZA74YAcMyJnqBDpDG6RZymHlA9hBa9pP3ehXyuJgBuCEdG2WSIA+J0ABOOoG kLGqgp5I/LSJuiC18p5VFbRHl28HT1jFEIexxF/GFf3Nd2iEuRzAD2gjHNBeyoFWqKBQG3FKlPrT HpiFHbpBxWIbzgA6dae9Zs5G/Vi50Xe0l7To3RlDNgbpU+jLWICxUl8AGZ0/9OUDTUkLYyJv8iUe QE7+MFvAnDEEHRjj0JlnMCsCY89MCfkNnWhntPVHVwQj36b2p0BMiZ7BzkA2209AxZz5UEUAAHMs A8WgWVAQ/AAcA1d0xvbdmmlqneidftvIbG73G0k2mB8Srv1mMlJn0gdB3so1fXh0uWa+Zc/Npw2/ aXOwnbEmJPEAVVYHRhvLC0YX9KdhTA0gskAZJs3zDAAhjZkTEjfYD8QB3GJtWEebXpqNNKAefQbB DsCQn51lsDztwIe1A8AFkPkN6GJvb5vzFof+s5UOzwBfmF6swD5MMJipIUBIPVm1URdzPmVmi4wd PuQPaLOqCI4Hsz22vG0VaepCixs0ObT68zd6JWljIWiyGG2CSp7Uj9WS5U8fBgWZoGqGtlk86GM0 amrcxySgf+gpEAcFmlTd2MSwgWhWATYIo23Ho8uKHqyxBm9zQB5H3Q+SqIMTNdq0LphfvOVGM4J4 6mTWOvG0P1Z+0aZ40Tbj0f1ggJwIcLA+J0/LL5qJRNOE+tqBoSCotkTv5swRLW3wFHEs23mLF6uv oxlta+oWZBjx9HlLcWL1TVOmn4nox5bq498ffRRo9uKR5oDuSA/IloD0SNbvUMpubbsOpaxY4NdS +S0x9HinUJApN5WmNW1rjSARbx0Pd7zW0vpw18fn33Up4G+Y6rp961vmKeApcLRRoMFhZaOWe6A/ 2gaCb6+ngKfAUUcBD/RHXZf7BnsKeAocbRTwQH+09bhvr6eAp8BRR4FDvhz8qKOYb7CngKeAp8AR pkBrDBWoapNAj91yLAf2R7h9vnhPAU8BT4GjmgKYPDfl7FFvEwzfFBuHm2JO+NktUK2lqF5XyEmf 4HWFrc3Cxw+TMBYh9CyP1PHPIQSz4bbr6YJnJg4hW5/UU8BT4DBTwNzO2KHSeItrUqLnwEnwcop4 MyyvrJbyqhrlKo05SrzpfbwGPmk+5o0m0DQrM02y9cO7tgK0Afyhusb1feUp4CnQvhRg7tp9yq0p Oa4DU+Y5kuVCEHyifyNprt3GVWjqRyTVlhchwK+rCzlBixWSkuyGpoMl1dC72Ola09DOEzdJaqpr ZMPGLQrqGZEr/pJ0qbS/uFQqauvktGNGSZU64TK/Lna9GH0DeJvDOfrH+g7am14Pv0B8N9cWds0c NAqCf3L4NnkWELVRfZem/UuooUxXjt49i6+fmrpI3KAnzs5Df19TT4GOS4HW6uatJc0CPRMVZ2X4 acHHCc7MABe7DxM9PsffzRthhYJPTlaGTBgacrJVvHePpCggwIFyc7tJalp66ykIyCvYH02hUh1f 5STVyJChA8PNDnmi27+/RF6bHQLptLRUt+KiD+wSC/y74OwL1wH0Cf3FO7uYhb4yx2v4p4l2txCk Me/KyqukSpkOQF6UT1m1kq7lwtC37ioWVm/9e+bLpt37pKKqWnbtK5Nx2veFeSEX1jwjPqHCrfJ8 8BTwFDgSFGgW6JmseBPE7SrggptiLk7A8RXPubCCizvwHlhQUBjxOFldo9J7bY3Mmv2ec8+LQyjz u42bWZxQkQYHXkifeEzEC6B5YTQ/JXgWxIuhXSJ9JAjU3mU6IFb61dbVq0vd/W7TxTw0QhdWOBaQ 0vngwRLXxzjiwsMlzsagJxeP8J0PDsCgo6ltoq8bjG5nipb10ZqtsmrjTinIy5apo/rr3yz516K1 snlHscxdtl6yM9LlmrOmykMvzRMk/D5F3WTJ2m0ybcxAWblxh+wv1VVHeqoM7dddTpg41En/PngK eAq0BwXidFNMVQB3/IwDzo888oi7DAIXtYA2gMKFIbiSxeEUF4d88Utf0lR676f+yyoA73z4+YYx 4OoWn+eoDQAbpFGAngs1uOADf+JIoFwnSFwuH6Fcu46urUuW9iBpossA7MHEd96ZJQvmz5MBAwfJ LmWsH7s2dDVfMEAXLkvBZS7vcK3MRSbmXx6JH+kdhotL6eBF1E3VG5XNrn2l8sDz7zupnc+yddvk E+fPkEWrtjjJvLuq5wDvbjlZ+smU9Vv3yqiBvWSzSvqVKsnnZqZLeUW1A/d9peVOteODp4CnwJGh QIs6evyIA8D4HMevNlex4aIYCZHn3MKDW1508BaY1KgMACBu1sGCB6kUlQKufvFhjn6YgOTJpSa4 CMalMCDPJQzkizR7tF7CAIPs33+4fKBX6r3zzttyzcdukgPl1QeNEsAdUMf/OmlwT4yPe1RtMFtU OIA76jYuImlOXRPMvErVNCMH9JSxqoqZv2KTTB09wEntlaqCKSuvlN379W5X/b5p+17ZV1IuIwb0 kLlLN8iVZ0yR06aNlH8tWKsrgm1uFTB5BDcoHZql0JGZHr5UT4GuQYEWgR4A4SYh9OxIhwA/37lc AxMfpHOkSS6bMBBJVvXCZgV37v1E4kSKR1UDyCNx4nebtLyDAaBGQC1kt0BxYQU+z7lC7mgN0DUl NV0uuuQaBegyZXj5Sv+ag8gBQ8WnOjd0QVOuKuQvftfRzbNygknbRSfxrIwA5f698mX0kN7SuyhP 8hWse+Tnyh4F98yMVBnYp0B6F+bJvGWbJCMtxTGAcpXi+2mafSUHZM3m3fL0O4t0nOjKTdU7G5QZ 9NJ8fPAU8BQ4MhRo0QUCOnJuKuJaPQMLpHQA5hvf+IYDFSR39MNIlM6YX5f+3ADFJzoEL+8wxnCl qn0AI8AtJydb0tIzXLIzTj/N/Y1XCj0yJEx8qRnpaW4TMylJr8nT77m6pwFzzcxMjVxoAk2Q1lkF oSJjnwP6cXUjNIZxcikJ8VgVwaRZLdE/LennaRH7BBOG95UsLf/KXpNlQM8CKauokuGXzVS9u5p3 allTRg1QoKdOSW6zNV9VOKhp3vhgpVPrYApaUlap6hs1CdNPWopaUCWeXD5HTwFPgRYo0CLQczMR OngAwkz0UNnccsstTj3AZqpZcpQr+O8t3i/zFpepeSWbhg2KWTfB3UEfnjWe7m6TUT88rtu5z5WD qV6qlrtt2eqjzlqjSkFz8ZJVzlSx4TxCfch6qbBAaaXAeqBCV0mljrlCP/Y76AekeNReMABu3Qrp +0N3mXLdHR8YtZlmNjc+BvUudCoXVHGAvDsLp/+hsyfkqoWVWyHoixzVyVcpc8jJSpdzjx/rGESK AjtMoFZBvkLTeJD3eOQpkHgKNKzSmZ0IU2Cv/g2YRLcI9AAJn1gBKdyCu1lJf3zw7htSUV2nuuJu OtHJvt6pHJAoAagQ9CepiZ6aTerMT9VlPxUFDCKIHuYHaalpDqAMTBJPog6YI7gZBufgmQWeVSkN 9+zaILUnjNdVVJm76NsOTUXfWBRrFWQDAnUZ6p6WXFwg1QcD3RJU/URs60Nc3EUF97HYqUTNdPCW QgckuK+Sp0DnpkBWVqasW79VcUNNn1UwY16Dp3mqHbErT1u8SrApnW70c4AFUEYXiyoGKxr08TxH hTNy1OgGagZs4w+Ulkg6m4YxbOw3b9roTC5TFPB9CFHg4YcelGq1omE/g09b1Fp2kMkYCX2ZyFOy 8ewD+P70FPAUaBsFgvOL79k5+TJwkGJoCtd6pqqgFVLPpqTUyabNe10hMYHewAMrjXiDkzgVgBxH UamuoLBIZr83xwF1Xrd8xwRee+01B0xUjs1DVgqYbWKNg2VI//79xS5cnj9/vrMU6duvf7xV6PLx 3IlXpS37I7EuJ+/yBPAN9BQ4yimAtM6KPBhYRWeq6hSjiPR09khDQF9bWxVZgccEeiKZBUy8dDWg N90vm7Pjxo1zh3UAe8Cdjdt9+/a5D6Z/WOIAWqiAYAJXX3210yE//vjjTs/MZm9Ll5DHW7/OHg/6 0snQDXt49ke85NzZe9XX31Og9RSIZUwBFvBxe2pOjRr6baFJ1U1TbjCbqxZSJpUoLi6W999/35lX YnqJtH7CCSc4yR2b+rPOOstJ9gAWh7DYHMTkElNAbMKxscdShBUCz3xooIBZ27SlfzwdPQU8BTo/ Bdoi4DWro28NSUwlQxqsdADxs88+22VhzrWQRgH8oDSK5I+rA/T5qHI4lEUA/D2Yxe4B6+i2dHhr +tTH9RTwFOgaFGjR6qa1zTS3CZj7BYOpbngWBKhoe3uzIjn99NNdPPvdUj0szyDDaSmNf+8p4Cng KXA0UCChVwmGnG6pCaV+duzYIR999JGT0NHbB61DmrMU4R3qHU7gsukAgKPLJy9nX69lcHKW56wE UBfhtRFVD+8plw3dtlijdJYONx1dV25jZ+kLX09PgSNBgdau5psEeixeWpOZbcaa3fvGjRudh0vs 5wFqfLDgpAwnZuSNnp5j+pyqtYDKB8CeNWuWTJw4UUaOHBlx1IW5pq0GAHKcrQH+lAHgf/Ob33SW PXhyvPzyy52HzNbU/0h0VlvKxPKGA2t+5dIW6vk0ngKdnwLm0bY1LYkJ9IAJknG0GU9zGRvQs4EK wALaSN78vffee+XGG290OnisavB8yTuAGSdpSKhI4wA4njFJ/9JLLzkXxaeddpqT2ocNG+acnXG8 n/dYBeGl8cc//rHb0CWQD7p9TDbZC0B91JXA3k4gs9ltN0y1prN9XE8BT4HOTQHnA0u9FJgZeryt aVKiB1xbc5UgIGSX1vIdKxpc4+LL/uKLL3ZH8nlPnnwHlPFTf9lll0XqaqoI3p1xxhmyevVqt0k7 fPhwZ42DlI/unsBKAS+YqIWw8IFBwFRgABMmTHBpsfbhfVcCe2jDaoZPV2pXvAPWx/MUOJopcNiu EmwtmJhPHJxsceBq6tSp7iCUbcYCwkjzSOhmKhjdcejcsdqxi0mQXpHU8ZBp6ht82KP6+eIXv+gk fYB9/Pjx7hnpsOHvqlIvtGS1Fbzc29pq1zvaXzN5ZfVkp5eDp2AjLiaO5tnj2+4p0Eko0Fo8tmYl zOrGTCHRvwMoqFiCjrPMbh4AtxCstEnzPDOpnXiW7wUXXNBI8r/ooovc4SECF5sAdEi7OPKyEI+X xk7Sv42qCa1mz57tNqFpN6skTFYBcNxKs6rhwBnLO/YwbFXEfgirqE2bNkUOotEftundGWnh6+wp 4CnQMgUSAvQAD6db77vvPuce97rrrnNX26HnB6g5/WouD9hIBJBgAmy8GsDj854DVYA34BS6ZzbX xeE7z+xaQsAJhvLWW2854OKkLdY9rBxsk7KtnK9lkh3ZGLQPGrI5DdgD0tDyyiuvdKseDqnxngtd Ro8eLX/4wx/cFYL0BTRhD4WTx6h+rF/Yz/DBU8BToOtSICFAj+TMCVj06OY6AfBB4gSQuUCEW6QA Iq4fRKLklqpTTz3VUZa0SKDo2QGyOXPmOEsddPKoYwB49PHEw6XCqFGjXDrUNc8884yzzsGdMqGr AnxwCMIM2dg2qd3cStB2GCMMAJUZ6ivMVNn8tlPJ7Fvgl5609JuX5rvu5PYt8xQwCiQE6AEYdONY 1AD2AAgbqIS///3v7oQs5o7o5QFlDklxgxSrAMwh//Wvf8nXvva1RlY+pocG0JDoASrSwjzIH0bA O4CfsrHQQbrvquoa6zCzbmJDG0kc5om6BoDnL0wA+rKS4h3qG2jCCgtpnvcAPeCPyoePN9X0gOAp 0LUpkBCgZ1MQEEbSRh8MyAD6OCrDxv3Tn/60o+LcuXPd89tuu839RqoEqFEhAOYEwNuuLOSCcIAd a5p//OMfblXAhizpkFaJZ+lhLF0d5G3FAmCzB8KmNium559/3q1koN0555zj6M+GNMwRv0GAO0yQ awZhAqjO8GWPNRRxjoZVUNeexr51ngLNUyAhQE8RgO4V6oceSZPvSPZ8R3dsAIVahzj2G5Dmg124 bbqijkG/jMSOHhpJH/39d7/7XcdEyJeNWOIDWsSFmeAZ82iQTG31xAE0s6KByQLyMD9WTpissr8B 40P1BbCjorENclZWqM64fMTy8BPFU8BToOtSIGFAj1TPJimAi8QJ+PAxUOcvm6XBEPRrY9cUjhgx IqLCMXNKpFFC0H8Oae+6665IdkG/OF1dQoVWMFNrJysePsZwYbChW2ZqHeBbH9jF7vyGSdJPPngK eAp0fQokDOghFeoXPiad4/IAcEH6tGCAjiSJxIkqh41bOwDEMyR4AunQIZtKBskfdQ4A9vGPf7xR nuRH3uil0UEfTX5goq8EDF5BGHwXfO5BvutPbt9CTwGjQMKAHrAG4JEs2RREH4z5I1I+6gMsbDjB apI3VjKoGbCmQQLFjQHgjM6Z26XQ2+MeAZUN5oJbt24VDmHxnYtM+I11Dt8BMzYmkXLZ3EV10ZVP jkJjs5aBnrSbYO6gbb+DZ+Zewjocfb2tpPhrcaMPWtkKwZiDHb22tHbQKngxDO/sdDTvURmR3vKI rgu/+Vgd7HCX1ZV22eEuY9xWruXNX0sfzN8Ok9n74CrP6tzUyo+yrDzS22lES2dChdUzqDKEbuRr N4ChUjOaBGlnDvrIw5gxaYOH/IjfVF0trqWNFc8OJEYfimup/dQpeK4lCJfBtgb7y2gUFLCMvtHl GX3tfVP9QDrKsEOYNpai6U/9jN4mSFo6mxd2vsfKCuYBLW0FbHPGcCrYxzbmgjS3fgwKVNHjPJrd WHkmwNr8tfYeDiEsIUBPI9944w0nneN58vzzz3dSNb7mkcoBe4AXNQK6dyRzO+xEWgAc3TuHnbAe ufDCC52/mkGDBrk06OZff/11WbdunVPfsOFIPPJmYxZ3C9ah2IuTFrt6Noe7ohoHJsfKhQkMXdlQ hdHyDAaJigyAoe38ZlUEnfnAHGGsDHT6wHT9mGiSjk1a+ov+YO8Dc0wGIvHIHwbDhCMOA5bTz0EH cjBiDmbRP/Q1/WcrOupCevJjUNv5C+JQN8pkQtoEoAzKNHAhHfkSn9UiFkVLlixx9YYOjD1owYSk bQAEzvUYhwayvKOMaFCNBm1TjUEP6Mf+EuksmGuNIOMkDXWgDFallMEYxLoMulBH+gV62GFC0lge jGVWwEYPyoJm0JcQZOjMBeLaihdwsL0YvhvTxxqNfTBbafO8ufZb+6wPDDhNiDNgox201a4bZUxh /WYgTttDV4vWuTaTn630jZkZU4y1t2ZCH1jBeCd/PhhnkKcJItQX+tHPjC1wh/zNoSL0W7p0qTtU acKogTx/qRPm3tDRxinpeUd+tIHvlActGQfGeOgP61N7Rjutr6MB3jCKsWGXLJEv/UMgHXuUU6ZM aaSajZVPa58dMtBDBAjz3nvvOWCgI5joEAB9PcBsJpIQCWaAHxuT1CAMoMwqgEYyMfgL8DCQIC7E YEWA/p7JDfGZDGZKyIYsgXpQBr+XL1/uNhuDp3NbS5yOFh9aM7F+97vfuXYBYNANNxCsnhYtWuSY KIyWFRPAiU09qx0btMRhtWWH0XAMByPlGf2EJQ+rpHvuucf1E0DHHgmT7LnnnnNAy+SB2QLErNKo F6DDiWbOTDzwwANy++23y1//+le59NJL3YoOsMPqCrNaLIHon9///vdu0vzsZz9zQPyXv/zFPScu 4P2FL3xB/vSnP7kxhXkoE/zb3/62W/G9/fbbLl9Ai3rzYaLwod1sTGPaywE+4mEEwLhhXFEPaEd9 g76QTBqlDbSZcYcZKnUGQBjj0Ic8GY/UHZpQN8D4vPPOkz//+c9u3APaAMdnP/tZefDBB119oRdj +u6773Zj83/+539cO5kjnCFBLcm8IR514Rl1xeMr/UnZPIe5kT9xsUSjXVhewZQpk8125g3toL9J h1EEdIX50mcIUQhWBrZBgGdM4VYEmnKWBbclCFCslgFQgIm0eJklLvOOPR/oicBHH1A/aE6dEC6g J3t2gCPnYkhHHPqWU+/gAXWxPgAXoMejjz7qaMu4ZxwzJgFKO4PDmADkcZxojhIZ0/jY4rAg+3zQ k7T0A+lhkoA76l+whj5mfhCHejCXGO+MaTCHumL1R1+AT3jHZdxgVUjf8ffOO+90cwMDEupKXYwx B2kL00IQBejNShEa0G76irHL3ISeiRRSDxnoqQwdhMSAGgbpmoojWUFEJhSTxCQBJg3vTcKiwbzH IoQ8mEwQHqDgLx86yzg7IMZgZXCZbX1QGmOgMzipR1An3dFA+1Dqw2RjQDA4mWxY0DBpGJwMMg6W AQCAIKAEHaA79IJ2vAdooCl5mcqFgWxeP2GigC6nawENwJIJxySz1Rh9A6DCGEySoywmAeBH3vwm Pi6lyQ+mTlyAA4DiYNf999/v7gsGWJDgERiQDgEm6gqgITww8ZhMPMOcljJuueUWlw8H8Wx/hkkG bSgXwIAu5okVUGCMAUC8MxWYeV01psVYZNISh4lH/QFcQIKJz5gF6Gkj9QPI8LhKPXkOvWgvjAX6 Mi6ZvICggZOtVkjDpCd/gJ/2I4GaMER9+Y56kz6DuQAwgBXjALoBioAfcxHa0Qe0jfpTtqn7WAnB 1AEwa79t7jMmbT4z56Af8xPAog4weKM79YShUR/6hPKIR/8iHMDY7OQ7Y5I6n3vuua6djCcTxqxe ACDnaUwFhFTLO/oJAKQPYCT0D33FO5gmfUt+lMVYoz7QnEBdqT99xIc4vENQAIPI59lnn3UYxXME HvKjH0kL3Rhz0IH22ViivxlHjAnKs9P+1A0fXJQJUwueUYE2toKAlowXc+HOOIf5Ma4p829/+5uj FZgYzSzaihuHDPQUzICCWBCJwWD6MTOtJA6NNOsZqyyDCunOAukAaBpIYDAwIHlORyNZ8B3AYTLZ CVnjfNQDP/dBDtpWwnTkdKxqAAIGOvsRxliR1OgHaADII9XcdNNN7hn0N4ACzAEHBimgAHgDXAxO aMjAY2XERAZMoT1uFJACAToGI+kA66efftoxGsCeiUN6QOCxxx5zTINJATNgUgB09CETEnBDYmVM AD78pnwmExPOpDMmGOXbHgIgSP7kxQSEFkx0GAbpeE4dAGokOQM5/jI+oRl1JT4TkXpBG8o23Trv KQfQoj6AFmMZsDD1CIwSepMn4xDhAkmNSc+qlWDCDXUkD5gyeVMu4AeYAnC4DKGdgAv5AZRI1AA7 dIaGCDi2pwETob9gREifjAUYOPEBS9oBjSkLcIMe/KUe0Ii+BUihHwADaFK2CV/kAX2IBx2pK+OF PBgHzD/qydwlP4QKxoapPMjT+pgxBM3IHxrQTmjL/hvjFpoy3vhOPjaX+Q3AgwcAI2OXcUx5tJUP 0v61117r6M3KEVqwiqB+MAUYKWOccUB/4aKF8cFqlH6CLmAM7TJPu5/85Ccd8yQfBFXDM4QkxhB9 QN3oQ4Qnu+uaPGAgBuD0IfGpJ2PXzvnAnGkL6iRoSCAv6ATzgN7UFdwL7rUdKh4lBOiZKEw2Kk+j 4EJ0oOnSGKimZ6QjbaMMosFJ6XjiszwlLyRFJEm+m1SDxEpcAIxOoiNj+cun/OiNlEMlUkdJD70A RWjJAOI7dCIw0JjYLNsZTNCGJTaThInLAOc3PocABCYX+x5mKcUk4zvxGNSAEPEpEzBiktGvgAvM hfIYvAxu1Ab0FUtaJjiDFhULS30AnHcMXPrPdMcAF+4rnnjiCXdXAfkxTpBkYCAwGAAIAAVoaC/5 wGhoM1IXAGf7EAAHDIHJjRRIO5jkMD3qbupE2sRvJhfgxSrGzmTYJhlgZLpeVkTkhbrEzFNpH5OU iQ64A5qoulBBABwAKG2HIQGWjGHUOox7QIkxDGACWtQD1QaqkM9//vNuZUbfwWSYFwQY6csvv+z6 BGCB7vQDf+k32nHDDTc4YAFw6Sf6gT6mTgA8c4Z68Z46QSvqgWqPttgKh/Lof/bN6Hu+n6Z3QjC2 YJKAICsPmDi0YcwYQ+A9YwGaw6jJA3pDX8YlJ+QBThgj9bEVOf0LTc3HOv1MvibdX3/99ZHVPoIC 4xHJmTFkJ+5hCvQfvykD2jKmoD39Dd0ZN4A0AA4jo148Iy3to0+oC+PR2gQtrd9YMUEn6Mr4IH9W R9CU9AA4AgFMGp9TqInoW8a1CSDEYdwwF2g/edAP/LY9KPqdNIkMCQF6JDk4IZMUCYlK00AGMRMJ aQlwgOMSmJwMFDobPS4DBuCGk9Hh5gyNQQKQMKCZyHQaE524wc2YIEESqddKJKETkRcDjkHLsh2a Aw42KaAdwMcgYSIwiJFcmHxMGia53QPAO9O/MrCREE03bBu1SGv0H4FBzXNAzFQQ1AXg+8pXvuIA 1dQTMBLKZeCTL/WjLKQqQMckc54DfrYBz+RkTCARUV8DyU996lNuxcFYYRKTL5OVyU+dyJtnn/jE J9xvJg3jhDqbLpW2k6epldDhkhdtAHxMXWGSMBPXNuyoN+WRL/SA4UArQBBp+9Zbb3UTFHADBOys B+8ojzLoF4CDegAyxuxoP/kRzEoMsONAoLWF/qbuABzpKYsVEoBPHeg/Wy1THmmhJcFuWrP9Gd7T bk5EUx6/AUvqE7SMgaHAmHlvOnzGA3EYX5RhUjp9bIIV+dBWQI249CX1g1mbwEYbGCMwD/oUhmOM KXoew+DAEmhCXWAyjD9O2tNG+gXaMC4ZA3Z+xFYmjDfioBKhH0hHfYjH+KBc6mpCJXkSj/LIl+dW N2gJHaGbbdTT5zAQwyLGr+05Ul/GC+PLrK6Ys4A8ggHjA4YJtpEncY1OZm2WSCxLCNBTIYDG9Is0 Au6I3pBKo4qBACaJ0nlITXA3pEukLX4D8CZ1QiiWusQlHZ0GB0SnZpJmIgmRCCA+3HnQXsAVMGGw 2gSDxiaB0A8ADgDIoKYvjLmaeZrpC02PTT5mWWP7GkwQMxkjD94zYMk7aP5lS1nKMGsc8gP8ASkC 8e3ksi1HydssOXhPPuaVFOBiXFg96XcDIpt4BhDkb5IqeQIElE85dnEOtLCABEXbTPcJQBBiLZMp E3qTr+VFeluVks7UlACx0Zzn0MnaTh4wCvoDEDFJFYCgbUY7A1azTLK9L+hhrirMiiXYJtITh3oB nhbMGsqAn+em5rP2210RwfbbOLNxYytwnjPOKCtoLWTzkP4zFR5paTdtsj6x8RQcf8G6BeePMVpj srwjH9MSQBtrg0nCZiHEeAB/jNHCjHhHWfQpY9HaS9poPbhtCJtFEWUbIw7W18ZsUEtBObaxTBmm rrbymEukIx6gb+PZLJbIi/eJ0s0bTRMC9GRGxZiwJjkxoFnimP6eODSaJTBLGojJIDOdrB2AIj3L V9RAcF2kDwIThR19G2xHG8hbhzF4meTRd/oaQBuIBOMHJ5B9j6XeCm5ex/pOmmgbX5u8lm8QMGyw 0texNsZNgo5Oa+qYWHnGapcxquh2RteN9zwLPm9KD2rjy+ptv6PHneUVDbxBOgXbHpzAseoX7Jdg mbHoF2xvrPkQT/tjAUp0vxjg8zeaIQTrYIJEdB811fctzeHoelj8ptoVHNvB/ogesy3pvuOlZVP1 C/ZhdFlBGrU032LN27Y+SxjQWwUAbrgt0hrmcUjlDCaewWmPP/44lUYbTsqiZ546dUqk/hCGpfqU KZNVIhwYeR4y3cx3Sz6Ccd22NrwzpgseAumM9fd19hTwFDgyFEgo0AO+xcX7nc4dME9Pz3BgvVp3 oFUU1yVNmpPgd+7aIzUK/jU11dJHl4JSL7oBu1zq6utEzyTq5sZgfaQ+7lWfWVOjhxf0v9TUFM2z QC0S1jmporqagwzJGq9O6us0dmQTtk6Sk1KUmvpG80t2cfSXSnKUbVLd4fiexCEg/a+uTusc+J6s dNEHoef6nXo3+l4faiN1rdPvGjm8vAt9Jy/qD73QUx6NTO7ITA9fqqdA16BAQoEe8NymG4EfJqlJ XA6HB/B5niM9e/WWHP1bWlri1Dn7S4qle1EP9/zAgVIH5lWqjujXb4BuThXLlq2bpbqK05NJulmj J+JUN7d9q1oohA9OINn27ddf0pRx1CkDAdRDOko6he8KjDGfB+M0fNcEjtm4fwLfAV/+D+UFQMfz nXzrGuIrEyKhSxv83qo8Q4PtgOpfN2zYGGFYXWMI+lZ4CngKHG4KJBToXWWdSWS6Wtu8JzW12OCW qxS+WnfxR8my5Utk86aNavq0SVU4J8nV11wnc99/T1U1G6VMN2Q/fv1NUq4bJs89+5TG26Abid1l zNjxaqo1TQ9cPC29+/SVhQs+kOOOP1HGjpugUnG9w2fF0BDIh3A5DPhhzHYAfgS+H8w3muIncT2H 6YWYDX998BTwFPAUiJ8CCQV6B0X6D5L9JAXnkpL9Tt0wdNhw2a9WGKtWLJPcvG4yeNAQKdQdeaxt Fn+0wKkmJkyYLB/Me09GjhrrrC82blwnmWp2lKfxd+3aoRY6u6S0rFS69+jp8oeZVFaGzMjCWO6+ RL4HAN/FCbzorN9ZWXigj39w+5ieAp4CIQokFOhDgFovmbrpuq94n5PUBymo79u7RwoKi2TKtBmy ccM6WamAP1W/s0k7eOgw2blju7POSUnB0RVHl0cpiFepqVY/NUdTcy5VraO+6d1LHUtVlDfScQdB u/071dYTh7lkJ8R7af4wU9ln7ynQZSmQcKCHUlu3qQvh92bJaaefrWDdV+bNnaOn4cbqAZpJDtxz c/Ok2l0dmCSTJ6l7YpXQNygDmDBukpPe83Qj98yzzld9/2anrx80cLAeuhqjKp/NTprfq4yDE5BZ WdkRfXhIlje1RvT3EFA2yPvt8d3WGk3VKfq5LTli180dPKqq7LL+e7rsDPMN8xToABRIKNCzMZqn J90GD+4r48fdGHEsdf311zork8KCQhk3Ru92Vcm9StUutbV1MmiAep5UkX3qFO6ArdJNWsBb/Zio hF8+ZphjCKlqUTNz5gwpVVUQZWC6mZmZ5UA+OUlvVlL9dZ1zLYp/85DNdsN3teRxRi9q0aLl2fd6 /e50+uHDC8CrHWRwbCH8HP7BSsPZ7up36h46mMF3dbeg7XKHHNx3nofq5/YPqF+yWgDh9uEQv6ck p0pWZpLuW4Qcwrk6hvX1Ldkjd4Bx5qvgKeApcAQpkDCgNxvv/noa8vzzzo74ali6dIlMmTROtqt6 Bt8q5513vrO+GTFiqgPBWbP+FfJrXlau4J0hJxw/3VnqAJKAdSgcrCIxq5ojSLt2LdpcHZSW7I1Y 3dhJSipi3zE9JS5Mq6WDIe3aAF+Yp4CnwBGjQEKAHlDBMRC+Gzj6zgcfzRzHfuihh5yzMpwILV++ wtnIEw8fG7g9+Oc/n3T+PzjejGuDSZMmh6VVA3knux5EoJA0e3RZoKSkpDo/Njgtw18GbqFZXXDC mOPuOALjiDr+U3jOSeSWTlQesZHnC/YU8BRoNwokBOipLZYyBKRI/JAgpeO7BncHeIPD217Q3zbg jnMj8+kNgOEQqStfAXgovWpqGgN6mCtO4nD9yqUHeDuE2ZpvcLwdXnPNNY2cVR1K+T6tp4CnQOel QMKAHundLm8AvLGiwZUBzp5wXoaUyXc8vLGRiuc31D0AExIqTrqQPnEkZA6kOi9ZD0/NoQ8uXvEk CJBDU1ZG5m2RjW76wa5Mw/UzTqHsFPDhqZXP1VPAU6CjUyBhQA+44zkRh2SobnAqZH7L8YeOJzs8 tNllyYAScQGmb33rW45OuF41D3QdnXBHon6me2d/As+QeOHDzSqMEzUNzx5//HGn1kHCh5Fy8xK+ wFktJdoj3pGggS/TU8BToPUUSAjQA852Qw1eJ5Ei8U1vwfw9I30GAyD1X//1X3HV2luWhKxsOGSG JM++B5eK4O8fYEfaxx00f/FrjedPk+7tury4CO0jeQp4CnQ5CiQE6KEKkjo+s9kMxGczUj0bhKhz kOYJODtDqkSVA2MgHs8uvPBC56wLhgBQcckIKh0kVdLiTzr6EuMu1xNxNAiGarcbQUe7zBg6mrUN KjG7LBuacWGCt8CJg7g+iqdAF6ZAwoAeGgEs6IfRDXMtmqkXAHXA3O6z5J5R1Dqoetig5S9XctnF JFzPhlti3BrjnN9usenC/RB30+wyBRJEX9rAqid4WYK5TPCrobjJ6yN6CnRJCiQU6M3hvt0GBBBh AohUztWCmP8hqduluKgXeM9tPFjocE0gZphcqoGEj+qBi5O9NN/2sedBvu208yk9BboKBRIK9BAF YMFEEpt4gBzgxioEnfL7778fuSyazVsAHX0yl4nYnafkwaat3aIO2NvFJR60usqw8+3wFPAUaE8K JBzoqTxqF6w8kOS5PBe7erucGh2zgT++6e0WdFsFIOEjwf/Hf/yH0zWzYestcdpzSPiyPAU8Bboa BRIO9HZSEzCPDl/96lcbPUJSv+SSSxo9w04cS5xod7xemu9qQ8+3x1PAU6C9KJBwoAegsd/GzNIu 5UWaR0rHHBAJnQvCsbA5+eSTZdWqVU5yJx2bsVwqzqlZ1D/o+Nl8JI03EWyvIeHL8RTwFOhqFEg4 0EMgTP04qj9v3jxnDoiUzm8A/rnnnnN6ek6/on//7ne/qy6KNzjVzvTp093m609/+lPnvwXGwMrg xz/+cVeju2+Pp4CnwFFIgdZeHER85zn3EEPCgR4VC5uwSOdswgLqgP2+fftk/vz5bvOVTVjUNjAE 4mJtg1kmOn3z5UJ8/OdgoYM074OngKeAp0BnpwCY15oT6gA9+NdaBhFNp4QDPQXQEKxm2JTl1CYb roD45MmTnSTPcw5DodoZO3asU/Wgshk5cqQDfNQ8POfQFYwDjub9tXT2Ie7r7ylwdFMALAP3AO0U dUqYlpbi/nLHBndzpOpdF9y9we+q6hr9K87svE+fPs7bwKHsUyYc6EM3QO11+nVMKLds2RLxiw6I Y4Hzgx/8wDECpH3MKnHStW3bNuf7Bp8tnO7Ejp745vYYk0sfPAU8BTwFOjMFwEe0GNywsWNPqWzc vld6FuZKblaGLFm/Q3btK5O01BQZPaiXjB3aV7BMtFPvHQrokb6R4G+++eZG/YGUj708lQbA0cHz ncNSFgB+likAP5wPyR7u571Zduah7evuKeApEKQAgF1VXSt/fvpdKS4tl6qaWjl1yggpLa+U+/VZ t2458qM7Lw5fk9pwk9yhUDHhEj2VQZoH8OFGqGUAdICdTVfAGxcJgDeHqpDssbqB06GPR8WD1Q3f jZvBGLzq5lC62af1FPAU6CgU4LqkA5VVsq9E9yrVqjArI02OnzhE/vnmQimrrJHBCvQ5KuGHbwxN SLUTDvS2S/zmm2/Kn//8ZwfsAPZnPvMZZ3UDN2NDFoA/55xz5Cc/+YmsXbvWSfnTpk1zVjf/7//9 P6fCCVrdkO+hLF0SQi2fiaeAp4CnQAIokKzXpGZnpsmStXukW06Gu+s6Mz1Vzj1xnAzv18NJ94m8 QO+wAD1WNbjSRZpHEsd6hs1WrGvwXImNPRsMmFSie8eWHobA92irG64Y9FY3CRhZPgtPAU+BI04B txGruJibnSRnHzdWrj/vWNm5r1Q279wvV5wxTfJzMmV3cZliY5pu1KZEbog71IonHOiRugFtLGpO PfVUdxMSG7CYW6Ki4S/SO9cIoqbBxp7GA/xmdQNz4EAVJpaogLzVzaF2s0/vKeApcKQpAM5hqILh CdY1A/PSpbZqrwzITZaaumrZtnGNbNVdWqT7OjW52aDfi4v3OSw81JBwoDcVC9cIYjnD7UYcjAK8 AXp2nK+99lqZNWuW24hFT8/mKyaXGzdudLp8rG7MR463ujnULvbpPQU8BToKBcA7hOB47OIRmocM Gew0H4d6aKpZoI+nMkZA4pp+Hgn+rrvucmCNKwPcGLD5io963qHS4dJwGjJmzJjIRiugTqMM+M3t AWm8fr5hqBqtO8rg9fXwFPAUiI8C4Buf1oRo7GsLFsYEegNsJPF4A2ngVIA69vOYU3ISFg7GXbAE LgEH5JHcsarBDJOLMlDRwBCQ+lHrsFHLe5Y43Frl/dE39AKcHZqZt894+8fH8xTwFOj8FGD+t2XP MibQAyJYvZBpvFK9AT2AjT38M888I2+//baTzgF682uDWobNVzZeTz/9dJk9e7a70BqVDhL9nXfe KW+88YY7SMUmLiqd22+/3TGItnCyzt+1DS2g/UgDuJTwq5yu1LO+LYeVAiqEJsJWMbSSFqc/50Rr bZw+aEydHW052FZLwraYmjepukEq59OaYFY22M1jdQNIY1L58MMPu7tLecZBKHT1BKR/pFPAi3dc OchRX/LBJJPPiBEj4mY2ralrZ41r3kFb2zedtb2+3p4CCaEARumg9CGGaj3clKb4VKbmj9i6xxMq 1Z1BRtrBUGtXfcaTRzBOWwTeJoG+tZkZd7IbpnAtzK1SSOlI64A/JpaAOVI/6hjUM3yfMGGCuxAc KR9uRV6YVcIEWAEAaq2tT2uJ15niGy08TTpTr/m6tjsFkMC10B2/+Y3kn3++ZCj2lJRVyIbte5yA 369nvhTp4aS9JWWyafs+Z+0yqHeR5KmJ47J125zETvrhA3o6XPr3/31Sxgzto/EPSO+ibnKWmke+ 8K+P3MEn/NYM7d9Dzj1+nGzYtkfWbt4lA/sUyuC+PWTFhu1Sr6uAp99aKKMH95arzjpGDlRUyRvz lsvMScNl25790kfzgxnUarzVm3bIELWl76b1wPRyudaF+OeeML7NOHhYrG44Gcvm68yZM50jM1QN 3ByFpL5y5Uqntwf4uRAc/zZI+Tg/4y8mlzjywfwS00sOXp199tmOIXhga/ep4gv0FOicFAhL79v0 8OWWr39d8tT4w2kRFLw379jn/hbkqsdcBfpqdUewacdeSdY0vQu7qWBZJR+u2CjD+/eUvfvLFLC7 K9CWy7xl66Va01VVVUuqAv9+dV/w8pylsmDFJhnQu1Cmjh7ogP6ef77tGMdI9Vdz4uQRkqeS/1Nv L1S/Nns0bzWlVE3Glp375DllEu8vWe8AfsyQ3lKQl+MYxFsfrpSrlRmcP3O81nWvfP03T8jIgb2k T/d8mTyyv/OT09qQcKBHr4+kzqnXYMAb5X/+539G3BYD2mzKwgzQ3yPNwyDYoP3Wt77l9gjgomw8 eP18a7vVx/cUOLopgCS++957ZcPddzub9SS0AvpsswLsOQrGFsCrbbv3K6hOiDzbU1wqpSr5TxrR XzL14BLhgKpqxg/vL0+8NFfyu2XLtDGDJCczXYaq5L1GwblQQXqQMoSde0ulR0GeZKrGoqy8SplF D8UwVUWXlas030dKD1TItl37pV+vAhnSt7tLC6hXqvHK8ROGysoNO2SgMo2Tp45QhlAnK9TR2SfP P05dJAyT1+cuU8DvKdnOPULr4D7hQO+4pnIsdPN9+/Z1JpaoYthY/eijjxwTwJcN6hwOSFngRCzx CWw0EmgM6h77fnQPXd96TwFPgXgpAAxmqauVbNUKVKxYETL91meLVm5W0K5y+nVUND3yc2T+8o1O fc8Ga6FK+AW5WbJ07Tb5+QMvywUnTVS1S51MGztYATxXpo4fok7IapyLApyRnTAx5JRxcN8i6Z6f K1nq1mD8sL6ybstuKdS8s5QZrNm8U9U3OyRdNRp52ZkK6jVuVYE74t7du8nLs5fIdM0XpjJ6cC8p UWaQmZ7mVhjHa/6vzlkmD74wR05S8E9Vz5atBXnql3CgRwrnoNTTTz/tpHdMJ9lsvfTSS2XhwoXO EgfwRn+PemfZsmXO2dmzzz4rV111lXzsYx9r1JdtaVS8g8HH8xTwFOiiFFAQzT7mGBnx1FOyVg9o 1qkBCKYluB2Yr6qWvftVz64gi/R8tkr4H63erNY07NcmS98e+fKVG852YL11V7EMU6l8u+rRUa9c csokqayqkR17S4SN2ZGDesvpM8aqJL5ddes7HZCfOm2Uuh3eIBWq4gHQefZfd16qbolLHICn6epi v4L5BSdOcNL/gYpK1cdnuY5gVYDEjqviEAPpLqdNH62ujPNURz9O0lXN0xZMPCxAjyqGymAHz0lX uz0K9QxqGNQxuEJg2YTED2MA5DlE5YOngKeAp0AiKAAGZar7gGH/+IekqjXfmi275IOlG5y3SML6 bbtl+fptupGqmASwqlS/YsM2WbRqkwNUwBZJf/n67c7KBml6vW60ImkD4vM0Ly4LWairBLxQoi56 9OW5bmWAdE7a9dsq3MZvim70op8vLa+Quarr56IR4qzauDNy0BTGwWUj5LlGmYaFDGUO6brZ+8Qb 82Wc+qifOKJfq61FEw70bLJy2tVOxX744YduoxXAx+8NdvW8Q5rng5MzAB8rHH57vzaJGOI+D08B TwEogAonI3znRb/saul2DL61WkkbZ5mpiZw5vv6w3y7/wG/eg9Rx5R+27Q/GDebrzEEb15NH2aoK aqV63mXSrHmlOyDQCpoQFxMlrGcgiB2IQoXDSVkOQdl9sfjA4SQtunvcFmNb/8ILL8jFF1/sVD1t WZ60oqqdOiq0sU+nboivvKfA4aYAcyVcRoZuitrm6uEu9nDlb/M+3oOsVo8mgR71S0Vltdt4iIdF 2cnYMtU9YTnDbVKE36gNK1I+5pGXXXaZs6ThNxI8fzlIZQGGYH4g4mmIMQOLG2QOsZ5FEz+eOIer w9qSL/WFYXK4zAN9Wyjo03gKHBoF4sGlYAnmTqYp7Im3NpYP8x7VN3jamtAk0FfphsOKzXulm+5A E6JWGI3KcO/wdaOMoVo3NJYsWax+bTY7+3n821DJK664wlnbYJGDVQ3PUOcg/WM3D8DjzRIg40Qt +n2YAXb1WOOwEuDglDk6Ix6NjUV4A0S7irCp1QHMjHI70ylT2gIN+XT2VY+ZzdIWO/Fr7ersbWvN JPRxOz4FGJ+MTbQQTY1Nw8ig4aP57woKpain0WA0N8bRjDgtUVhPE8ynLXOjSaDnQAG7vxOH92tV L+xcv1QvBN/qHJoB3Gy0MqG5dOT11193B6cA9k984hPOB/1TuisOkKPL555ZwPeb3/ymk/ZpHO/w dcP1gxAHvzn8hWmweUs55uRr3Lhxjom888478uqrr7ryjzvuOLdnECtQH6x/3GW9bVF8tYoyiYsc 8rnRGqVa4spOVE6MCZg1H5gtfc2KDhcYBM5U+OAp0FEowHwDm8xlCxurIbcG9c7eHf83/AagMbvE MgecQpBFNW1uhsmHPHDv4jwEaD5mMom5pRN42LRVzYhTnOv/zBEwEw8CbZ33LbgpDpEZkMZJGaCN WmbSpIkyaNBgefHFF9UWfoQsXrxYJk6YKL0VuGe/956ceOKJzo5+0KBB8txzz7mTrdjQE48JTR5M ZJvsgDYAzYRHcmfD9rXXXnMSPb7rKZe8YBIwAPOOSaMx3+QZKwBO4fIM+3zKQ/8/b948R1D831M2 BB8wYICcfPLJTgXyD92R5zsHujoT2HeUCdCWetAPrNru1sMs9O9FF13kXGV89rOfdUyZfmR/x1Zv bSnDp/EUOBwUwDVLt255erK1WOZ8tFkvDKmTEWp+WamnazHbLNaDVhySOue40VKruAQ+xQrkU1hY oKdqNztTzdysdIdrpQcqZYuadO7XfK4+c6qaVeYqJlY6o5VDCXFZ3XCJyPvvv+/Ad8aMGQ4sK/Vy W34DqG+99ZabpCxZuCbw4x//uONimFNeeOGF7js+bnB5ADdDpQNHI9BgwB3JnfiAPq6J+SDlUxZc cfr06Q4ESEt5LKMI5I1Uf9JJJ0X0VqYK4h31xm7/zDPPdEwAMLd9AP5yApc4lM0Kw4P9oQyn+NLS DzB6JBWkeJbD//Vf/yWsyBgXjCk25c35XXy5+lieAoefAuARGIEvnH+8Pl+6F+Qo4K+T808YKw+/ /IGsXrddbrzkeLnkpPGyP+y8MVatnISv+ezWU7i/fvRNtecvkDHqB6e8olqeUdcI3fVwFvb1d1xx sgr1Iaw7lBAX0AOIWMmYf3jAEVUKUhmTFhUKtvIwgccee8xNXoAYSRrVydSpUx24YjvPpGaCI62j v0dPf4webHjllVec9E1a3l155ZVyySWXuDgANaaXSN0csIJZANwQHEkQ3zk4USMg3QPcuFbAT47V jfpFB54BLlx52Jzu7VAI7NMeTAHGBkyby+AZC0gyrAC/9rWvyZw5c9wKjr6BGbR1qerp7ilwOCiA wpTPanVdgHpm9cZdcseVJ7lTs0XdsqT3lGFy7ITBcReN47LueoIW1Q/2/djgc8p2w7a9zsUCJ23L y9sJ6JmY6LJxX4AOlUnIdwCa76h2kLrtoBR3HH5dHQkB2Exi85+M1E98ngHWTGLUKAQkOCRxJPZg ALiDvm6QvPGjY07OYECE4KbFLbfc4p6ximhu+Q/Am3Tv1QRxj82ERISxIjDA6G2l9/Of/zzi9sJU f7ZyS0ihPhNPgUOlgNsbU+dnRXnOkdnazbtV8lZLOFWvnKC+arrlZLjDUGWq8UBf31Qwu3z08flq 8FKk/nPQ9WMnf6aehF21aZf00RO6HMzigNahhriuEhwwoL8MVEA+5ZSTZdnSZU5fhM48P7+bLP5o scw84Xh3s3leXq6cqJI0AUkboEcPjjSOXp6/tntt/mzWrl3rVCZIcYA3UtzcuXMdA0CaR/Jjs9TA PNr3TbSqJWgy2RJ4s8IIMolDJaZPHz8FUMtcc801jumjAvzBD37gVDa2h8N4YKXmg6dAR6EAWIPg WVldJZP1dOpQlbyRwrera4NeqsK55eLjnLhfrG6LUctUq0+bWIKKWc6h/h6sKpu7rj5ZVweYstc6 6T4vO0PdJZSqK4ZuesuJ5qNlHqrA0yzQ431tr1Y6t6CnA+hqVcIPHzNBRoQ5zMBho2T6Cae4TQcm KFJ6flF3Wa7qlX8++aQDbSQz1CioYb7xjW84FRD6eJbt6NC/+tWvyrnnnut080h46Nr/9a9/uZun cFMMIKCmsRCPDt3itBS3pfcdZYB11XrY5jj9y6oN19QEMx9lUvngKdARKGACJMInwgmSeKZ+6srV MVm2Wsns2SElu0OHsxDkd+8IMYVY98OS15YtW5wqHFVNamqy+uFJEgzZSxTgizUf8l+3LnTw1M4d HYpQGhPoyTxNC89KS1KfC9tCZj7hYKsIs0Y0AvAXUN63v9RJ5jQC3/NsttqBKaR7vFQixSPtY/6I 2gfLHNQsSPxI73aBrl1QEq2+6QgdfyTr0FVOxpqUwsYUuvqGMRbaNPfBU6CjUICxilYCi77WjE1w LiiNkxZNQmvzMfV1Ww9KNinRA7ITh2WHjw+3POkAevSuW1fnyAb1M28bnUjnmMqRH+oeNk3R72MT yndMIDFBAvzZ4GXzFoaAHh6uZ6qeznSo6XANTjrZDk74i1gOF5V9vp4CB1OAudeW8ysGzNFGBa01 MghqKQD91oaYKahELCuVljJXGHI+ljnUtHz5crfEQVpjgxULHezjAXY2bpHaAfd/+7d/c3+xzFmz Zo2MHz/eWcuwEgD4YQje900D5elkVj5t6Z+W+s+/9xTwFOgcFGjNqoIWHZY7Y7HM4SAMAUsbgB19 /R133OGkfkAKCx2W6yxh2LglDaCOxHrDDTc4MLO45BPkgMZd4+mS1hIknjyPZBw7C0Adgseqg79j 1S9agjAaBukTK04s2gefRaePtTne1frgSPa/L9tToC0UaP0aII5SbBMN/RTSOrotJHkC0jnvzeqG Z0juBDv+TnysLswNgum5iMfqgN9s/MJADPgwu7STsujAeI/VDQevulKAEQY3eILgbLSIZ1kY3Fsx JmHgD+3MQqop2gXjBBlv0OopWIYH+640Cn1bOhsFEg70qGvYhMWHDZuzuD3A6gY7ee6CxeoGc0pU NRywevDBB91mBc7LCFjkcJfsQw895DYtbrvtNmeV88gjjzh1EDb6mOXhy4ZbqTDFJC8ORhH/gQce cL8ff/xxZ+XDwauuAjLQllPAMEJOCrPXwWrInMVBWxgbzzh8xl4H7if4e6/en0k6vmO2iNsB4gDG 6PvpC/qNG8DoM/rjxhtvdDT9wx/+4PpmxIgRjp4EbN9ZpaFqo8/oQ04ys6keZLqo4bCm4VlX6YfO Nsl9fT0FEg70JrWzkbpC72oEMFDRoK7hwhHMk1atWuUmPQwAM0tAAhADcPBnw8lWQAlVDs+wzMGv DtI8Uj3pbWOEPMmLMriSECaBNAroIdF3pYA0D/3eU39C0IEDX7/61a/c/gf0hcFdf/317pQxoA3o 33fffc5kFV9FbH6z8Y1FFKDNygia2oE2VlDQFnXan/70JwfQMAWAn3io0gB6mCgMlj7G/h2GzjMY B+6pAX4YEWW99NJLzj7+rLPOchvtFjzod6WR6dvS0SmQcKAHgAEj1Au4LMCZGIABYAMafNhoRRJE WmTCs2GLFAo4ANz85hIS/OZcffXV7oAWjq7wg8JBKvN4CJMgPQCH2oc8kBz5Dih1RQ+IMC8AGaCH iXJ7F8CN6wjogUoF+sAkkdofffRR95uTzfQBeyOcX8C/EEBNGtvYhaGyIc7ZB/qJk8qsoCgT0MZq ivzpI/oK81hUcmwQw2QJ9A/9QKA87gqmf6yv6UuT+Dv65PD18xToKhRIONAjnQMkqFmQFPnNaVaA CXAAGJjsgABSJ5Imh6aI+9vf/lauu+469w6QgWkYAyAfmAdMBPDBHh8rHgAJBgBwIbHiORPdPYev yIN0JrF2hU4DtLFqglECwPwGfKEH7USdA31ZEbE6IvCduOyXAMruYJsyW9Rh0IibvwB86AkjgNGy RwIgo+pBLQYDAKxZpZ1wwgkR5sIKCrrD1PmQN0wWulM+K7UnnnjCHXqjrkj+XEBD/b1U3xVGpG9D Z6BAwoGeyYtEzUUjgMrnPvc5B0JMcvTtdmEIwAyo4KoW0CHcdNNNLi06fCRVQAKw5y86ZAIgRwBs ADAC+RMPIMLlMJKpgVs8G5OdoaOoI+AJmEILGBm0hh5I79CQ9ptDONrPagrGx8Y3Pv2RyGGcixYt cs7cvvvd7zqmSF+Ybh8miqSOqox0MFZ8GnGugbjo4OlXVgGAOr5qKJOTz6wqSGNeJ1lFEGD0MG9W IKiRvJfQzjLifD27CgUSDvQQBgBiCY9KgSU/OlsLpiYAiPgQB5BCzRJ9RRarAIAJiRN1AqsBnrFi MJ/25BfMn3JgEha6ktSIpI1uHUnbArQIBtpr/oDQi1swZspfwJbAKWTzI8RvGAUMhGCbrsG8gz6H APwgjWGoxnjpE+rB6oIAI7LAvoKNkUYV9z88BTwFDhsFDgvQU1s2BF9++WUH+AAItvEs87GUYWmP GgfdPVYZSOSoBviN5MimHtIr0iL6YFQ2SJ9Im/jA4R5apE4sc2AOqAJYCXQlUG+qx1kRRR+pjo7b HnSILiNWme1Rj8M2M3zGngJdiAKHBeiR7pCqzYMlenTzE887JErM+JBOAX30weh5ATEsPFgFoBsG /D/96U87fT/qAcz3kO6xMoEJAHjofGEQZoPfhfrGN8VTwFPAUyAhFDgsQE/NWL5zSQiqFuznAXTA G9UAm352+TcAjVSO1A6IY6Fh6h1s4t99910H4gA971FboDMmvtl/Y0rppceEjAefiaeAp0AXpEDC gR7LD9Qt2FmzaYikDlhjHgnIA85vvPFG5Co5LETsRCvgz0aeAT0XiLNRSJ5sQrKJB+MA5JHy0UHj y5x7X8877zxnP+8BvwuOUt8kTwFPgUOiQMKBng1DLC+wn7ZgfuWx+gDU0dVjDcJ3zCmx4uA7VjjR /pthDKho7rzzzsjFJMRB8icNPnVgBt7x2SGNA5/YU8BToAtTIOFAD60AXSRvNmGRsjmYY9YcvOeU JTb0MACO7xMHtY6Z7mGBY1I9EjoSvVl82K1Q5MM71D4t3STVhfvPN81TwFPAU6BFChwWoEeqB8jx RY+0jYSPjTynJ9evX+9sv5HqsZz54Q9/6MwB2Wj9whe+IOeff747RAWjuOCCC9yBKAC9KZWMV9W0 2Mc+gqeAp8BRToHDAvRY2GBJgxWNeVsE+Ddv3uzULQ8//LB8/vOfdxu0SPMLFy50Urkd3mHj9emn n3YSv7839Cgfob75ngKeAodMgcMC9IA2jrHmzJnjNmPNQZk5teLqQDZROXZPXDZZ0cPjEAuVDQdt ML20k5WH3EqfgaeAp4CnwFFMgYQDPRI7kjmmlYA4+nls3pHwTb+OSsb8mXNqEvUOah1UPKh20Ofj XhcbeXykkL6lCy6O4j70TfcU8BTwFGiWAgkHegAZCR4f8vg/IQDkqGMsEMdMIa+66ionxbMBiy8U Pqh7UNtw4Ip4hJZumGpOVx+d1o8JTwFPAU+Bo4kCCQd6iAeoYw+PPT2gjWqGgJ28fTfwBtjR6aPP 51IN3BxgUsmzWKddkfzxwojzsqBXyljOy+zmI/yhs/HLiiJ4Fd/R1NG+rZ4CngJHLwUSDvSAL5I4 N0fh+RDPkxdeeKFzU4DXRNziYnWDh0lUNBym4iINAmCPiSWbtFx8gcdF8oMB4JseBgLQ4xmTZwA4 TIFDV9w6hbUPLhQwxWSVwIlZrHe4XQlvjcTlpitURN5a5+gd9L7lngJHGwUSDvQAqIE79vTYyeOb BsC2a+3Q13PzEJ4MUesgbXM14Je//GWn9gH4kb5hBrwz6xvi4gqXDV6usuO0LVY5OErDJz3SOg7S +OBrB8YBM/jmN7/pmMCTTz7pJfqjbYT79noKeArIYQF6QBqXwlxLBzCzoWoSO8CPDf3HPvYxJ1lj Q//Xv/7VWekgccMoiMPFFFjmYHnDhi26elYEeL0kcJqWg1eod/ClTjpWCDAFQB+rHXOgxkoANwnB m45833sKeAp4ChwtFEg40EM4pHc8T6KWQWWDKgWdO1I7KpXTTz/dgTwSO5I5G7cANJY4dqcpzAIz S+zvUbtgVw9go5u3wM1F6PxR48AYkODZ1MW9AqsK2wfAt47douRVNkfL0Pbt9BTwFDAKHBagR02C ygUduQWAF8k+aH3DhSGXX355xKIGqR11z2c+85mItQ36d/Jjkxap3zZTAXyYB4wD+3yYCWm5eYpg gE58vGWa9Y6Bf/QQsI3baDNOixfNIKI3f5t6H+t5sG5WV79J7Celp4CnwOGiwGEBeoAMCxs2Y7l4 BFt6JG6cltk1c6Z6sYZhSYP0zv2kQS+UWOWQ35gxYyJpWTHYLUvmmz4a3A2IKc/y4xkHs9jQJU+Y DgwIFRDfeWcrgaYAOpgvcUmDn57gTU2kpVzaGLQM4jnMibL4Tlo+xGMDmnMHPngKeAp4CiSaAgkH eoAQMPve977nNlZRpwBsX/va1+TnP/+5OxAFuCGhYz0DuAOGqHWQ8O36u6DEzPfXX3/dATTuiNHr kw69O1Y2M2fOlOuvv95t4N5zzz0OdHnGX/KFKXB/KqsHDl9xwTWMhYNd6P1//OMfO5UPKiBWHawS yItbsgBxysXeH++bHASjnpz6tZO9qKjY/IWp0T42i7k5CzfNlG2rBVRTqKC4RQsGBgNkv4J9B+5o 5dyBVy0leoj7/DwFPAUOC9ADjujOn3/+eQd+3GvKRivP8XcDIwAs2bAFPAE8JGDAFBDmKkGkXOKh /kEdg8UNZpsmIQPGSNR8uAeVv4AkgI2Uv2DBAgfEpGNjltWEXXACs4BR/PrXv3Y3WMEQ0PdzLy3m n+wX4FyNcgF5mIzdh0p+MC0YAiBOfS666CKXPyag1B2gZ0WDlQ+ngFkxEKgbVkCsbgB6VFIwE9rI Ox88BTwFPAUOBwUSDvSAFyCO2SMWN1wQAvAB3AA+AA048h3gBfDef/99J4Hzm01TLGlMZ23+6FFt AMg4QIMBYIkDkwCwAXr08zASykWSRnLH+gYJGnNOYwBY5pA3kjl2+oAugQ1hwJwLTmAMBDaD8apJ m2gLwI4aiFUKEj3MgE1l8qZelH/11Ve7tORFWwF7LIxYPbzzzjuOIbBRjaUQbYcuMBfS+uAp4Cng KXA4KJBwoAdEAVgCl3ajAgHckIwBNwAeyxosbgBsPFkC7jADJHLiB33Okw/qFd6TBwex7r77brcC oJyPf/zjLl8YAVI08fCRw2Yw+n6keuoE+Jse3vT6BvKUAZOhToA6ZqHY6HO5OZI739966y13hSGu l3/2s585lQv1ZZWBxM8KhvJssxkARyXDMxibWQRBE+JAA5jON77xDfn9738fYTiHo5N9np4CngJH NwUSDvSQE9DFKubmm2921MUVAioPVCZIwAQkfSR3TCc5KdtcAERR8wCM6MKR5Ak8M5UKvzlVC4ja peNI33fddVdER25loONHpRTUh1OXW2+91UnnADP7CJhpmptkykQ9dMstt7hsbDMYAKddwYtSeE9a GJbdmIU6iJVOsL5WPgfH2LPw+vmjezL61nsKHC4KJBzoAStUHkjIqD3McyVAhgSOPh7ABPRQywRB Hskbc0rcFgCc/IYxAOgE03Xb5qaBJidpiY/kTTBmYkSzjV0DUqRtVgQGwvacdMG0lGvvgn53goAM YzErmmAnoZYhBONafaMBHWYXHfdwdbjP11PgqKOA4kh4gh1S04M40hpzaIsbnaY1eRxSxTVxwoGe yiPRf+tb33L6bNQzAOvXv/51+eUvfxmxukH6/upXv+qAHXcIWKQgGQOabFiie0d3jV7+3/7t39wz pGjio4bBigZVDhL1Cy+8IFdeeaWTwtGVUy758SwoQVtHoTYxqxnKMb/3zUnUTb1rzfPWxD3UjvXp PQU8BZQCikfAfPTZFaONCY1BWsV6Zu9rajCHTpEDFXppUubB5tAHpVXBt6q6RtLTQlDbAPqhOsVy xthU3Q5lxX9YgJ6NRaRhdNxI9OjCzfkY5oeAP+8BXKRxfiPxcyEJ1wnCBNBbswF64403Oh0/5pAA u6lMyBPbekwbUbmg/nj00UedVI/On+sI2YR9++23nR4dgqKS4XIT6oL5I0wlej/ATw5PAU+BLkKB MMjvVJPrbrrXlqHWbaUHKmTzzmIHsn26d5OC3CwpLi2XrbtCGNG/V4HkZmXIyg07pFb365KTk2Rw n+6Son+/d8+zMnpwL9lbUi69C/PkjBlj5KX3lrj0aQr+Q/p1lzP12ead+2Tt5l0yoHehDOhVKMvX b3d5P/vOQhk1uI9cftoUqaislrfnq5A5UR0v7tFzOJpfZnqq7hHWy9otu2Sgps3NzpBdxaWyeuNO V+8zjx3bZvVuwoHerG7YFEU3D5ij30aqB4TNLBJdO6ocJHJ08FiwoMcH1HmG+gdnZEjn5ElapG+s c+gkLG1gEEjuWMxASPJGp47aBDUPKiJOzRLPAioY0lA/1EuAf0uctYsMe98MT4GjhwJhkN/xP/8j m9RZ4lhd6ROqVSJfvWmH1NTWSXZGmhTkZUt5ZZWs2KCOFzVNof7m77xl6xVsixTUy6Rv93w5oHFm LVzt4lZU1Tjtwb7SA/L8rI9k0arNDtAnjxrggP5///6GbFVmMmxADzl56kjJy86Up99e6MC/trZe Lj55kmzavleefHOBzP5oraQkJcu4oX0kX8tet2W3vPXhSrnqzGlywYkTZMPWPfKlnz8qo4f0kd7K mCYMb3wJU7wdmnCgBzjRfwO6mBUiMQOsqGHQy2MFg4SNZI+0j5kjjACrFiRtAB7/N9imm9sC8kS6 x0eO6dUxV8R0EnUPTIQA8bG4gXGg6kElY7ryIEGMubBhCmMJnl6Nl3BHIh4rkM5S1yNBH1+mp4BR AHXN7vvvl3Vf/KKkqsCXxDkbfbZDpecLTpwYIRRC5O59ZXLJKaH9PcKe4jKVoCvluAlqFh72mVVW USkTRvSTJ16eJ4X5OXLM2EFOdTO4T5Gs2rhD8nIyHWPYta9Ueql0nqGqmnKV2gf37e6+71Opf+zQ vk7ls313sfTrWeDerdm8Uz521nSpUOH22PFDNK+dbiVw0pQRimd1Tpr/xAXHy7Fal1fmLJNh/Xu6 clurxkko0CNVA+IcGgLor732WgfMqFwwWcTaBXAHwJH0MXNEBYNkTRxUNkjtvEftgrkkgXxR9fAb 6ZzfpOUZqwAOWfEMgMfUEkDEvw3uimEIQaLYyV10/9SJ33R2awnX3lOKesKgaE9zer32rpcvz1Og I1IAUM9QS7csXblXqtm0m+f6bN6yDQJo56qUjYqmIC9L3l+i75N1w1IFSqRqniOl//T+l+QSlb6r FXCnjh4oPfLzZNzI/m5VgCqFVcHMycOlVjUMw/r1kN5FaoSioD5Gpe/123ZL9/xcydO8UMUsW7tV slQ1k5OVKZWqs9+6a5/DnZ4FefLC7MUyY9wQfZchIwf1kpKyCrfaoA3TlKG8MW+FPP7KPDlO1TzU sS1YlTCgp3A7FIWPGyR53A3bc/4CygC0nWYF1G1zgvikQyqPZzeasvhgY2/BbNgpyzxoxiIK+ZMW 657OFBgYHOgyd86dqe6+rp4C7UoBxYBcXdGP0L26NapZqFMtA/5sz585QeYtXS879pY6lQyS9Xkz x8uClZukXvXjQ8KA/Y2bz1MVz04F7D0yYmAv2a1S/rhh6oTx9MlOdbNj936nwwfUzzl+nKp+dsgq /eSrzh9d+pzFa51Ev2nHXsdUfvS5y2WL6u6z0tVKT7EHRnHhSROd9I+U3y0ny5FnWP8equrJUGE1 BM3DB/R0qqQeBblykcZPSTnCQG+dyKEiPj4cPgq0haMfvtr4nD0FOiYFmCdZqjEYrj6xUnUFD3B/ qBJ9VthaZv3W3bJs3TaVwlMiVjH8XrBik2So9J2Gykd1QEjjJarKAWTXbt7tNmgB59mL1qpqJ1nz 3ChVKuUTHnlprosHoJN2verYqQfP+JQrk3h/8Tq3KkAFg6oGNVOtMhme1SEwazyeW2CTlvo89uoH jtlMGN6v1QRPmERvJXsQanUf+ASeAp4Ch4kCqD8yVYVD6JddJbnT1NV5G8qKPosT+U1eATPJuPEP LqDpokN0OcH3REe905bQJNCbJUpbiNKaitSrJipGe1uThY/rKeAp4CkQmwIKLganmar3Nmm+05JL 24PU39p9uiaB3vmO12UGy4k2scAAJdExmRljkMA8S0s5mJXEo6PvtB3lK+4p4CnQKSkALrUWYGko e2vBcCj5IIBj4GIuV+IlZJNAz2mu5Zt2u02CgxcY8WbvDqap/5gqNa/cFdlgCK92pETtUIfpAYLh etAgdDgh2TUCwmBdw8Ysz8xlMe8w3bTDT0Gim9974hthySOayPHX3Mc8nBQI9qv1Ef1Mn8e9/D2c FfR5ewoEKGDWeZz6j3d8hnTzKQ7TgidzGe8t5YNwjOQewsqGfEjbFkxrEuix4cxSfdDEEf0PucPX rt0og8cP01Ot+a6SxtE+XLhcivWUGZsbaifjAB13BphRcgkHljgQhINVHHTCnTHmmIA9gMA7A30O SGEuSf7megHzS7OxP+RG+AwSRgEzFeVuAsxtAX0+nLewk89898FToKNQgDHLWR40HQA3G6vYxxNq nHCi5py6YZqCCxjVgnDytUJxCpcteOw1cCYfxnaxYlqWmqBzopbNV8CcPEIWgclSVl4ZUWkjxGIh iGv2tp6jaXYzFq5C4HATl4hgw43Tr4kTJ6ibgUHOxQG271y4MXDgAK20Xs2nFT/jjDOdCWC45i4P bOXr61HhmM8HcQ0tVzMjxP66ulr585//7Fz+AvRcKs4Bq0ceeUT+4z/+w90jy+Ug3CSFd0r84wAU 2NtDCE7RcokHLhFwhwAzwEUCtvx2fWFHGTRHez0YrLh7xi8RS9A77rjDmd5+UQ+34OWTiYGriljO 4o522vn2H1kKIHByqHObukxYsIJzPbXuBCxWOAtWbnbWOUP1INRZx46W2ppqd64oVijQk/2FhQVq r7/FuTnIyVTmoQJvqQL8VjXdLC6tkCvVlBOzygq1+8fLwKGEuKxusG/Hidgbb7zhHIohSZeXV7hr +rBjZ9LiF/6mm25y32EMgCwLD9PAl+ohAE6tjhkzTtavWyt9+vaT7j37hqR7jYeEjuROORyseuyx x5ybY/zmIKnjCdMOSsHZOAzFLVIQAPfFEJR6Af7UCUkx6PrgUIjk0yaWAvQ1QA5D5ywF/fbDH/7Q ua+gPznVzM1cPPfBU6AjUSB0uLJOlqjJ5UMvztNDVDnqsmCVXDBznDz6ygeyZt12+cTFx8uFJ46T ksqmb41zEr6K8Dv3lsivHn1TXSgUyGg9LHWgolqem7VYD1LlKsZWym2XnQg6HjIJ4gJ6lipMwpEj RzofM0jaHHyCAQCmXLmHmoTnLL05oRodyrUBmZnd5H9/8yspKCyS6z/5aZW0q100li1I/FzUwYUh 6LW4jYlr/igbyY6VBHUwDgkgEBfA5zQs1/HBiMiHtHjP/OQnP+mv6DvkIZL4DOhfTjPjcO473/mO W44i3bMqmz17tlumsiK0/ZjE18Dn6CnQNgoglPJZo35rOBm7Tg9U3XbZTAfMOCGbOn6wTFOfN2Fl SIuFcDgKx2rkhVVQis4FHJptVF84nLLlWXlFOwE9EthJJ53kliyAKrpzviPd8x3Pknz+7//+zwFu LI+QVfiKmHiMAnGWuh7upekLVD+vHuNU1QNVqlTVgq96fNdwKQh/KYsLu+F+MBhWCiztuQkKlQ3g j3M0dF7oz8yvDheEA/pIhjCneDdPWuwVHyFhFEDNxqoLHSbMmv776U9/GvIqqIICF9PwnrHng6dA h6EACI5LFj3R2rsoT1bqwSZOypao9D1jzCB3MlbPPqmbhWq399hUMEMS5yVA0xR2y3a+bTL1oNWp 00bo4a5d0kvzJ29ToR8KDZqV6K0y/fv11UnXT2+NOkmW6gXau3fvkUGDBymwZsvijxarJH6MlKqK pZ9OzHxlAHW16i1SpXBLT3vZcMBcc9x43Zhwmxd1jns5w6PwrjK6dZyQAeqANx82ZdHXI6l//vOf d2APyOPLHhAAFFDvkO7CCy+MXOqNtI8qyIP8oQyPw5OWfvvUpz7l+pfVGncDfO9733OMGemeOwRg +jB8HzwFOgoFwBLGLnr5SergbEjfItWtp8sW1df3LsqVO686GTBz+nUwr0qBO5agQj4Ir9WqDRnW r1A+f/XJDhvZxEUn300dpG1TPX3/nvmaT72T9ttiaROkW7NAzwZDserW83uEVDF1yslGjpsko9QD EIxt2MixcsLJp0cuF+EoMdyMzYNy9dbGIod4pZV1snnLDgVd9RwUDnC7faXqt75PD/cEpmA3Opl6 hmeohczsDp0t3i/NSoP35huHd2wMm/UGkjzv/UZsR5kmjeuBSg71DAOYe3kBfLyT2iQITagG99Id sxW+VkcLBUxoxfkiUni6aiJyVHitKy+V/nnJUrJ7mxTvclKrw51d29SlgRqJmLfdaDqh9mYlCw5i eaNisX4UK/eUyv5d+A1LlnVrdzl7Fru8yUw820LzmEAfckSm5kOqVVm9YVtEMueMWcR2PWxcHzwK jJQeHUIbrSq9q6lmo8MGWkZhRqH07ZHv3lNmrIkdbWYH8eIJHuDjodKRiwOQm7TDuDCvpFYjvxI7 cn3jSz6YAoxVVppY/JnXgOboZHEQYIJSPc9RMSOImql5PPQmH/Oy25a50aREj+njBHWg05ZMDwJ7 ncjYnTY6eRVWX9XU6PIm6uRYPA33cTwFPAU8BdqbAnZHRmvKbcqDbmvycGuF8AGqtpwNign0SFjO Dr4dQkpcdj/tUBFfhKeAp4CnQCehQGsF8Gadmh2JNsfyJRFrqRQ8UhysZ/B5kBjR+baWULFoEVFb NeOVjTjB+iei3Pbql+ZoFk/bqWc88YxGwXZFp2vpd0s0CaZv7VhoaxtaqpN/7ynQXhTokPI0VjTm tAfLGcwso4OBQzQTCIJG8Hs06Acne0sMIRbzoT7ozNj8jQZzW2bx3Hzw2KYxz1oCjqaY3eEeFNG0 C5aHpROWTcEj2GyAs4wMPmuKKTcHtMYQYqUN0sJo2RRDaKqfouPTFvZ+KA8LLz5NMRJLG82so8ui f9mkixU6E3M/3GPM539kKNChgJ7J89xzz8lXvvIV4T5XTOwuv/xyZ17517/+1U1OzCzZzPjSl77k /r722msuHj4oOGiDBQf2/ZjssePNcXrS8HvNmjXOuoPDOrfccovb9R44cGDkXlmAm4NYTFq+A2zE x6ab7wANZTKhudeW+24pg4Ne48aNcyc9Scd7fO8Q7td7K8844wznsoHTwpiQEodTvVOnTo3Z65TP SWDOKnBL18knnxzzbEKihgx0B7Qxb8SqiVBRUSG/+93v3HPaA524x5c2Uy/ON2CBcNtttzkaQCMO tPEOVxmLFy92eSxRc1ysadjEIi350xecf6CdxMOmHnNLaMZJWQ5NcfiOU9KcjobR03dz586Vs88+ 25X3z3/+09ETmlMul90wBkhDudzERZkcnuM59aM8zHXpC+4wBoC5r5gT3RzYwiSXI+4E8iUNaakT pru0Dbt/NtK4LpMycd0ALagzY3bSpEnuGXVgnNEm6tkUE0hUH/p8PAWao0CHAnomHpMQ3zkEdrnt isFn9EowAJ2Jw/7B7bff7t5xNywrAPzhMBE5ZIPFDQDC78mTQ5f+4gyNyQ+QM/lJi2sFTvLaBeIA AQetkFABOIANoMd2n0kLwwA8iMfkp2wmNW4fRo8e7UCNvDneTz0BAwLuHJB8KQvGBHjzDgAkDxgI TAzABRBYzcCEWM3gTwjw4HAY4XBJh5SNnyDAG1CHVrQRaffZZ5919MXsFQDkvl9OtUIf6PT3v//d HWIDvPlwHy/poAsmr9CGNIA14AhY8p3DdbjRwI8SfX3VVVe5MklHvI0bNzqmAd1xa0E59A2MFZ9I 1IdL5elb+pnf9957r8sXpsLl9O+9954bT/Q7tINpQm+7Zxhbfdpudxob0NPvjB/GA3WBIZAGBgFw czIcWtGvMCqYJEwB2hGH8nHQB5NnzNgG2uHqPw9zngKdBuipKCdwkd4BUCYn4MhEZwKadBlU5QCA MAAA5rrrrnPxARXAEvAAUAB1GACS9B//+Ee5+OKLI5I58QAeJLrj9Y7JmTNnugnNxLQddiY9kxof PAAYaa6++moHBDxnghMfaZ1VBSsQswdn5fDkk0+6d7SBugF+gA1AT92Q7snDgB6gBCgAGCvTOjGW PjsRQxwmBZgBYkjI1A/AgslAL97xjHjUC4AExAhIvrQN5gZzAmhZ4bAqueaaa1wc6k1+9CmH3KAb /Qpjg4nArAFl6MA7wPm4445zTBUa4N8IiRnakzeAShwkfFYIMHb6FyYA7Th/QTr6DkYAc4VZYMZ5 7rnnunzpM9LbuQzGEuOFfJHg6X/aAEMjEA8GTB/bZfXQh1UjPpZYrdA2aEN7KJ8VBHW2/m0vI4dE jAmfR9ehQIeS6AEDpB+ABsANSphMLCYvEh5Sn50Us2U5KgSzNQU4mXysDl588UX58pe/7CTRf+jd kUxMAyjAGGkM8OEZKgGAmAlNWRYoCwYEE0HyBogJSHsc3Qew0fsirSP9I3mSHyokQJ78AULKgzlQ JpK8qXdoazDQRtQBtA1GgLQIeCJZ443TLgePRycd71AFwKgfZSMZA46cRGa1Q12oL1KsMSXqxaqE /kIFBU2ghfULAE5/oGIBTHlPffFAinqN/IkLnegX4t56662OXjBCQJa+gOEjvQOcd911l5PgUYcB 1PQx9RkyZIijJUwYyZy6kR71CfUgD9QtMCGYDaDMB9Bn1UB6AvWgnxAaCDACaII6kTZYH7DKot7m Gps86WsYIWVAMxztMZ5sdfjggw9GVi1ejRPvqPTxEkWBDgX0TF6A5u6773aTGGkQ6QnpDVe2SMVI ZUh+SOtMQiYNz82lLZMXUEHqw/8O0hjSKFI7HhFtUtsynknKBEbq4hnvkWoJtgFnwGPAzHPqymQm PpIpn3POOcfVgwmPdMhf6oNEbAHwZvIDJk0t42Eo+A0COAEvgJ28TNKmroCmuWluq49qayN1Peus sxy9AHnypz3QFQYGaFJXmC31AsyoI/FoHyoSgJh41NPohktpJGlbqcCkiEc7LKByoQ+pA/kDkqhX oBMADViyGkNShg74QGIMMD6gNX3CCg8akAdMxPZK6CN0/ZQJYyEtTICxAINihWinsXmHJE/d7Bn5 syJDsKBNtPeGG26IuN6gDYwN2kc5lG+H/mAYl112mWMcMDTaGfJjHnvDNlET2ufjKRCLAh0K6Jms TNTmAhPG9O42+QykSWdLdb6zkWtgBoDwCYIrDMGkc3tu1j7228Df8rG6MWFxsGbPKdf0uxaHtFde eWUkDl9gUFdccUWjZ9HtBTgADdPLW7uCKxHyBpSRxA8FPGzTmY1IpN5g3SnDaMR3+gegDDqtM90z KxWCScGWD0DYXB9Qd+tP6gLTaCpYHSw+8VDpBOsc7FOeG/2DeSI4BAP50ibUPsF+NoZldOE36phg HOofpBu/jSkaw6A/WREF0zXZSP/CU+AwUKBDAX1bJkIsqbg9nkXXtSnpPPp5U/Gi+zaeeKxa+CQi UF5LdIunTtEA2tzvaBrGMsFsiX7RZpGtrWOQScSiY0vlJ7rfE9GXPg9PgWgKdDigj57sNpGi9dFt ndBdaQh0RRoEV1Lx9FVXpEE87fZxPAVaQ4EOB/RMXHSn5vXNAB69MOoBNkPb4m+iNUQ5nHGjDyV5 oDqc1PZ5ewp4CkCBDgX0gCB26Gz4ocfmUBIbo+jCf/KTn7jNOEzn7rzzTnd71KHopo9U97NZZ5un WIWYuZ3pg02dEWsF09KJ2iPVJl+up4CnQMemQIcCesDub3/7mzzwwAPONhubZk7JYtmC5QXv+NtZ gzEy9OpYimB2CdCbv2nTk8MIYAK2MUx7SYtFi9l8d1Ya+Hp7CngKtD8FOhTQA2Z23+z777/vrE5Q 46CywT4d0zY7nYnZJSZtnU31gWkfJ3cBd0wPOezDb6xHOBGKBQc0wIQQs1CsWFBjYZEC48NihIM5 ibShb/9h50v0FPAUaE8KdCigN7XF+eef7w7ncMIQu3oAD5tyDubgTuDjH/+4M3PrbCBvkjl7DEjm 5isHhsXJXBga9uO4ewDIOTBkJ2OxCecd9DB/Ou05UHxZngKeAp2XAh0K6AEzjr1z0ATfKUi2HMzh 0BDSPNIu/lA47AJQdkagZ1/hkUcecUwMu37svu1QDe2EBtiJwwRwycChKBxmcSQf5sfhn87Y7s47 RXzNPQU6PwU6FNAD3kjzBDuGblI+QE8A/OxZZyM/AM0JTHTzqGTMPS7Se/DgD8yAAzYwAJyL8R2G x6lNdPp2Criztd/X11PAU+DIUKBDAX0QwKOdd3UVKRbXAna6srkuD3pRNCdudvq0q9DiyAx5X6qn wNFHgQ4H9NYFRwOYHQ1tPPqmlG+xp0DHo0CHBfqOR6rE1YjLMfCtgifNtlrPeCaRuP7wOXkKdHUK eKBvxx4G1NlYxbSSE754zjRvkTjAslua0OFjM098NmuJjxdJNqMxM0WHj76+rUyiHZvsi/IU8BTo ABTwQN/OnQBQ486YzVUu2OC8ANI9tvJ4osR00m7AMo+Y2M5jYw9jwGUuB8h4Fu0psp2b4ovzFPAU 6CQU8EDfzh2FD3sOQ2FLj0QOWCOx41edA1SYlXJugPdI+fhIx8SSG5QwycRShzgcsjIXwe3cBF+c p4CnQCejgAf6duww9OrcJsV9qwQuz+AQFNY0qGJwe8AlKAS7O9YsbfBjz/kBLtUgBH3wt2MTfFGe Ap4CnZACHujbudMAcC4Pt8D9shbsYpFglZDqCXaBh/n68Zux7dxxvjhPgU5MAQ/0h7HzWrrI24P1 YSS+z9pTwFMgQgEP9IdpMERcCku9JOl/FrCmwaoG1YupZXhnboqbclfc1PvDVH2fraeAp0AXooAH +sPQmYD8hj0b5JmFz8jtp9wuyUnqlwfA1+evv/66M5UE6PHrw+Ysz40xBE0m+Y7vG9Q9we9Y5uAu oqUVw2Foms/SU8BToBNSwAN9AjvNQLq4vFjuePAOuXTSpZKSHLos2gLSPBuv/F27dq2ztMGMEnfM mFtyQTXvsLZBl4+FDZI/JpjY2bOBi6tjvFiefvrpflM2gf3ns/IU6KoU8ECfoJ4F5LcWb5XFWxbL y0tflrPGnCW3nXLbQZ4mMaXEVBILGg5AvfLKK7JixQrn/2b8+PHyxhtvuO84L8OsctOmTY4BmAtj ysFfzrPPPutO1nbmi1gSRHqfjaeAp0ALFPBAn8AhguT+36/8t/TI7SHfv/j7MXPGXh6VDcDNPbhI 55hO4pKZQ1BI6kjvuCnGTz1xsJ3nOkUkerxZclkJ6b0dfQI7z2flKdCFKeCBPkGdC8j3K+gnj93+ mGSlZcXUnxMHdYv50gesb7nlFgfYdkUgYA+Q472SKwdxy4xqBz0933k+dOhQp7v3tvQJ6jyfjadA F6eAB/oEdjBAnp2e7XJsynQy6LbAxdcTsMEA4KPSQY8f7c7YXBejummujAQ2yWflKeAp0AUo4IE+ wZ0Yj2180FomVnzUO7GA3FvZJLizfHaeAkcJBTzQt2NHA9Rbtmxx6pdoST5WNYKmljAEzDLxZmkh HqbSjs3zRXkKeAp0UAp4oG/njnnvvfecCSVAD+hzgArwxjaeT3l5ufuL0zLi4OUSE0zUOLg2Buwx v8QnDmoeHzwFPAU8BVqigAf6liiU4PeAs+nYcTk8d+5cGTNmjPNeicUNoM4mLJeAcxk4unps6adN m+bcGHPACjfG+MiZOnWqvyg8wf3js/MU6IoU8EDfzr2KVI7dPJ4qN27cKB999JFzP4x9PUCfm5vr wB07ecwpsa3nHXGR8gF70uPkDKD3wVPAU8BToCUKeKBviUIJfo+0zqlX9OuAOPbznHZdsGCBs6MH 5LkMHPXOMcccE3FfjI96AmodDlONHj3aS/MJ7hufnadAV6WAB/p27FnAffLkye4THbh1KhhOOOGE yM/o068cniL4zdh27DxflKdAJ6aAB/p27rxo75TNFe/NKdu5c3xxngJdlAIe6Nu5YwFvLGs42Yo+ viX3xNHVM/CPuEHWVULwezs3xxfnKeAp0Ako4IG+HTsJQMa3DVcJ8h1LGjZiCdHuidm0xSIneAOV VTU6bvC5V+e0Y4f6ojwFOgkFPNC3c0dhGskmLIC8b98+2bFjhzOfxBPlrFmznH08JpR8x7oGRkA8 /OLs3LnT2dAPGTLEmWGyMYv/Gyx3WB3MmDEj4kennZvli/MU8BTowBTwQN/OnYOpJFYzuCrGDTEA XlRU5ByZAdyYWALcbNgC7LgtxswScMe1Md/nz5/vmAFpYQa4MsYmf8KECc7zpQ+eAp4CngJBCnig b+fxgO07p2PxSGmHoPA3j0dKDlMB9jg+w00xYI4LY6T60tJSxxA4SQvAI/lz8IoLS8rKypwr46BK p52b5YvzFPAU6MAU8EDfjp2DugZAB7yR7LGh51QsPuexnecZAaDnYBQ+cTIyMtxvAB1gJz0rAtwW E/iL2od33m1xO3amL8pToBNRwAN9O3cWYG+OyfgOkPfs2dPVwlwj8D3adt7eIdVHB3Nf7Ddi27kz fXGeAp2EAh7oj0BHBQHZg/MR6ABfpKfAUUYBD/RHWYf75noKeAocfRTwQH/09blvsaeAp8BRRgEP 9EdZh/vmegocbRRwp8lptO6JxRtiuR+Jx6rNVLHB9NHpYsUJ1iu67EScfPdAH2/P+3ieAp4CnY4C gGRtcTHmaZKshwqToloQ9D3V8KpeXZTUaZKGi32It2n7XqnR5wXdsmTv/gMysHehlJRVqlm0lqHP M9JTJTszPWLmbAC9Zec+6dM9X1Zv2ilF+dnSPT/XFbWnuEx/xz73Eu3qpFot8tLU+q6te3oe6Dvd 0PUV9hTwFIiHAoBljd7Itu5Tn5L+P/qRZOmJ9G27i+WtD1ZKrZ5XOXb8UBnWv4es27JL3l20RpI1 /slTRzpQfvPDlVJ6oELKK6vl3OPHSVZGunzq+/fJmTPGyLqtu2X4gJ5y1ZnT5N6n33W/AfDRg/rI rZefJE++uUAWrtwkE0f2lxMmDpNd+0pl1sI18sa85TJ2SF+58+pTZefeEvnbC+/LyVNGyJI1W2TK 6IHSLSdLy6uSuUvWyzFjB8vYoX1k4apN8uDzcyQ3K0O+/ekLHaOKf13SQCUP9PGMGB/HU8BToFNR AJCvWr9e1t1yi+x/9VUZ8NOfuvrnZWfKiZOHS6pK+Hk5mU76LuyWI6cowKempkhhXrYUlx5QIN4v l5wyRfaXlTsA3rRjj/Qu6iZzPlqroJ7r4pF21cYdMkuZxOA+RZKbmakMpF4+WLpBDihgz9O/hbnZ ugLI1u/rHXPZs79USpSBVFbVyIZte+Sef77tyl6j0n6v7t3kXWUIHy7fKAM1vzFDektpWYWWvVcm jxwoj74yV646Y1qb3Jx4oO9Uw9dX1lPAUyBeChQ//7zsVZDnFHqSnjqv1YRvq6R++vTRqmZJc9lU VFW7ZxedPCmS7YGKKlm+brssHbhVpo0Z5NQyfXvkS7+eBfLoC3qqXVU0x04YLOlpKXLWcWOltLxS xg3rp1L4ICepD+nX3UnxudkZcpqWtbu4VDbv2CenHjNKiksOqLqnQooKcjVekazdvMsxAJjMzEnD ZcvOYsdATps2UqpqamXLrmI5+7hxbgXx0erNboWRo9J9a4MH+tZSzMf3FPAU6PAUQJdddP31Uq43 t+34/e+lXt2Cc5YcgH/qrYUK/EkyoFehHD9hqKQoE/jHax9InaYZMbCXTBk10OnRUcEsXbtV+ijI I3UD9jdffrKUKSOorq2XisoaGdy3u9ymz0hbeqDSMYPjJg510jzuTOYsXiv7Syvc6uGDZeulR0Ge SvSVskv185lal+njhsiuvaVuRUAYM7i3W1Eo2isjSVX10DHy8Evvq4polnz26tMcyLdFT++BvsMP WV9BTwFPgbZQIEVdjQz87W8lKTtbN2OTnRqmX898t2lapyqWFAV7VC9DVU+P1I1RDtI7z86bOd7p 6AFlQPpfC1ZLz8JcOeeEcQ5oV21Qr7Oqm2fzddSgXrJiw3bNv8KlzcpIU118HyepI533LMqTL3z8 DJef3h7h9PD7SsqdBE9cAvVZqWl3aT2G9e/p8kEXz77BpJEDZKQyoG65Wa6eRapqam3wQN9aivn4 ngKeAp2CAs6iRqX1AT//uSJprWzbtk8l9G1qvRLyE8V7LGIAUxwKEvaqagWdOM8AaT4843cvBWx0 6YRMBWgAGzXP9t37VT2UotJ6rizWjVVNJcnKWNzGqZYBYPPdrHCQ/mEy65VRhKRzzD/1P/1O3YhH PhaoG+Wj0x+jDCShQB+PzWin6G1fSU8BT4GjmgLOpDI5xenO+XT2kFDVDd4S4SJtM+aJJiUcM9qC NRSH5Q3LFh88BTwFPAU8BVqmAB5rzXtty7FDMZpQ3dQLV9nt2FemrnPrQuuOQwjJSclSUVHplieR oF+TdHnTQ+1Pc1TPZVyKBrBUwe96dOC5Wwo1ccItESfIDqGZPqmngKdAF6YA+GIqnnib6Wz5w+7H Lc2h5AP24Y48m32HVoQmgD5JqtW0Z8f+ChnSp4fTGaViohQGfC62tgsy3KaGAja/LQRBmrS7du6R YrUfzcvNaQTS69Zvlv29u8vUkf3ciTMaAIPhg+td8sE9L/7XWWFQhoE8PtoJRngu3CZgSmXcjvSk 82qoVoyIdohKH9Kv9BWToLKy0vUR/Uwf84nF6Nuhar4IT4EmKcA4LdZTtoY5Dg513DJewcDUsJ7/ /7d3psFRFVscbxQIBB6rRGULYEDZERGQTUA2EdwXoFgeZSnPD5ZiiR/88LSsst4HPlplWWopWlKC C9sTFURQQFBBZHFlXyUQeCwJCVvI698JJ17GmcnMZHEmc7qYynCnb3eff5/zP+f27YWA9oIPkJXg r7/++it4D06iHO69GlL1/4hdS8fxS8fyGQG5cMHzrL926TLfUk6iKeLLWCpmcUHrrMa+FZfkbFM9 AKOJP80oIyNTDrpu6I3z7NlCV5sFCl4A9le/LuvKcbDiM/muU3aOy2xwpReqV7uWy/NvnzVt27bN LV++3O3cudPNmjVLDtngiLwNGza4zp07y28jRoyQOo75FW84HJwCafTo0XLsHgd2sL87RME9nMRE PkvJgwB69Msvv8ixiN27d5c+gvTpP/qO82/Zsz/e6Cl5JLSW1DQEIN+zZ89KgNLA62cdT+y8UGWu e6ZfNZvrX8ie9DN0atcm6HV+hk4jd8HzIedBc1JccH8bHIYs2PInxRX5l7m8yGWKJzN+zntyv+gL yPOza7Kva+4dCPWec3v27HEQfaJBa9RZN9q4HzdvcXPnzpVzTjFKjsCDROfPn+9uuOEGt3LlSjd4 8GA5LQlPNXz4cDk9SfeRkDmmfurRH4ePekPO8kffFch75ot+LirDOrIfhSfjpUuXus/8IgeAIEIn Ml+/fr174oknhPj5jWP0+vTp4xYuXOi2bt3qjhw5IoSQn58v566uWLHC3X///XI/R/Q99dRT8t1S 8iCAXmA0nKz1+uuvu//45ek4c/5yNi6HnE+cOFH0IpEXT8kjqbWkJiGAPhKQ1K+X4bZsP+QWrNri if9q19bvecNWCh/7/x/KPeFG9r/J/XNcP89tpafFhSYpxzuMzPr13Pe/HHBrNpdO3WS1LXPxN20/ KE8IE0b09ts0ZEu0H66ceLCNaXolxEv0TgTG8EqnTp3kYGsicCJ9iJYzS3v16uUWL178l8duHkeK zl5wH3/0kQB1JDfXDRk63LVs3e7PxxafCSMngu/YsaN77rnn3Kuvvir1Qfj7/HJmoj/q41Ep15cB UXBeapcuXdyNN94o56xS/ocffugmTZrk+vfvb0MA8WhDNeWl/wYOHCi6whm6POLOnj1bnPKuXbuk bzlukb61ZAgkFQKX3w/uzT3u/pd/Rsg5zy946trheln9evjYCR+VX5T59Sc8b0ZKGsAwj/5nP+Wz 0dEM18vPl7/oA16mXbJSdq13ADff2CquXTcj1RcT0UOeQ4cOlciYSD4nJ0eGToiuMUiGSU6ePCmP 3RxkHRpBg83ZovNuwMARbv68Oa5d+xzXNruTXwqcLy9kmdmDs4DUIQDS7bffLmXhYIj2cS482gfP XO3qNynavHlz2bmqEAN1Q/yM9w4aNEicgaXkQoDo5M0335Rggac1AgnIffv27eLQSYk+oiaXpNaa moaAzok/5YecWfS0bstuN+ffk2WVK+PqXXJa++0KrpGtCmJKPggmescx1K9XxxUWlcgTwi6/NUJm /Toyr/5cJQw9x0T0NJhoe8qUKa6goEBIvU2bNnIoNcTKi1OIf9GiRRJt65moQUGLfdTWoGEjN2Xa vyTq5iVu2WP55TfTkDOGT3RO+RDA8ePHZaiGqG/s2LFC6hA+iXcCY8aMkSif7zggIsRXXnnFzZs3 zy1ZssQNGzbMHv9j0rjqy6Q6MmrUKOnfjRs3yrAfw26MgXJe7urVq12/fv3siaz6usVqigEBRhdY hMVq2iG9L7k+fpfJbbtz/UrYa91TjwyVhVSFfvSCGeNE5ZESgW0tP2zNIquhfg8cwl3K7uD3tLm1 azu30y/M6uafEhjeZjy/oikq0WtU1aXzTdKIuhn1XN5Rv9T3dL7LymrhevXsIS/VIHoM9Nprr5VI mnzBqIyXFrL2y7/UzfAvLmTs3r9P5v8lJV5EVoR58ofIlcBxIOSbOXOme+aZZ4TIeRlBhH/ixAk3 depUyYsD0Jd2OIjHH39c/j9jxgxxSDbGW1EVqfz7Ifrx48eLTtGv+sTIi3SeDuk/po/ZS/TKx95K TBwB9BH+4f1SuxaZrm3zbNfED92wMrZZ43p+mniGJ3jmydRyp0+e8MPVZ8MGKug/Iw3o+j/qlLhx fTvIkA07X2b6qB5ib9WEMfwMl3/6lAS82ElFUkSiZ9OfUwVFfv+FY/JowSPLpeJ8b5QZro7feD/v TLF/2VDbdejaR8iUxh8vvOhK/CwY8mmSJcSnz7n9Bw6LByu77r+c8UB0aN+qbPlvuDFZ2Xnu8ksQ CB5yYIgoNFE/+fgL+fMdBxSc9lkRoOzeykVA+xrdYViOfsJR6wtYjApDsCGcysXdSkscAUYTeAJF d5klw7vH3MJ8mVBy7FiROxZSNDpN8BsabBIU4ywIZmUq5eUpltxedIaAuHSPm1OnStcdUU5WVlYZ vyUiQcQFU3X9Y0e7Fn78/eL5shO4oOliv62nTlbkb9H50umNwfQnnfurJbXcNU0b+D2f21+ZiXmj 3pmwoX60lbGhRB2NuIOARltYlQhQdk/VIICi65z50AjeSL5qMLdS40cAPmHaL+//4kkaeOo9lMPT akXLiacN5I24YKpBgwaywKmyUiSjheSZfmnJEDAEDAFDoHwEEllfEnHopqLzNstvbmkOJt1U/FVD rLVZPkPAEDAEUhuBRN47RlkZ+/dE2fE8ricicGp3sbXeEDAEDIH4EYh5emX8Rcd/ByTPCtdPP/1U pnPy0oMXIEyvZPpmcJ8bXsgm8ggTf6vsDkPAEDAEUhuBpCJ6oGRJ/LPPPisLpphlw2pJCP7FF1+U qU2swGVh1XvvveeaN29u0ydTW/+s9YaAIVANCCQV0fOGmsid9Ouvv8qUIlbfcp3NyyB6vjNt0oZt qkE7rApDwBCoEQgkFdEzFDNhwgT3kd8TJzs7WxZj6b7LTG3SbTr5bkRfI/TPhDAEDIFqQCCpiJ5o ne0MWA7ft29fWRjF/ifsr9OzZ0/Zb4ctjFetWmXj89WgHFaFIWAI1AwEkorogZRtkN944w3Z5pgV rrt375a9c3ghy5g8L2vvvPNOGau3qL5mKKFJYQgYAlWLQFIRPbNu2N9eE3P5WR6vCWJnt0w+JCP6 qlUOK90QMARqBgJJRfSxkLeRe81QPJPCEDAEqg+BpCP66hPdajIEDAFDID0QMKJPj342KQ0BQyCN ETCiT+PON9ENAUMgPRAwok+PfjYpDQFDII0RMKJP48430Q0BQyA9EEhaoteThiJ1Q3CXy9CZOKH3 al7NF+3e9Oj2qpcy3C6kkWZMhfZPtD6XYyj9NFz9S95w/a9lBPs83hlboTJEuz9RnSpPz2PpqWAZ sZYXa75g/cF+Cu2DcP0Qru2J1BsLBpYnOgJJR/RBg4m2ZTFnKHIkFylcvnBGGilfkDQqqjChZYVz LmoU4QguErlEyhup/FgNr6LyhsOfFc6cc8k6CE6N4sNZwuEIOtb+1nZqGdSB7NQRSU9CsSkvX3lY RHJewevsycSme/HsrBpKoOH0I1qwEtoH4coLOj79PVp/xOJIuV/PbC497DqyAw7t51jKj9cxl9d/ 6fx7UhE9xrt+/XpXUFDgfv/9d9e6dWtZMNWyZUu3b98+2Q6BxVJskcD/OYKOvFxjRe3Bgwf9OYun ZGM0tjdmb5y9e/fKdTZHmz59uhwH9tlnn8mGadxPWay4zcvLk1W4nPHIb2yzgDOhTXy6d+/umjVr JgeOUz7bKJOXM2xJBw4ckP/jfDhXMjc3V/KxCyeJFb1cI7HqlzZzjQ/yaaK9elZq27Zt5eBsjGT/ /v2uVatWZfUFiY/vbB2B7BjHli1b3KhRo6pl9TBtoy9YvYzcYAcGa9ascd99951sREffDBw4UHBG 1iNHjjhOMGNzOtLPP/8s35EPzDZt2iSHJ1M25d16663ujz/+cIcOHRKdIE/Xrl3dF198UUby9Gu3 bt1EH8hHe2iHLsDbuHGjnEmLY6CvaQvtZZsNnFC4hA7u2rVLZOnYsaObPHmytJ3+geCQhXp/+OEH t27dOulT/n/33XfLNdqJDMiPbNxLm/bs2SPy9+7d2y1ZskR0qVevXuIckBt95ag5+pw6aDPXKEMJ E8xVbzdv3ixbhnD/ihUr3F133SW6qun7778XZ4sO076tW7eKXOgI7cApUz7txAbatGkjeodOg6Pi s3r1avmOLW3bts0NHjxY+pi+A0u2KsGe2F4cjJFLyRq5KI8tTPr16yf9qnjQ1iCpYwPca9F/5bmm pCJ6FPXw4cOyqRlGA7FD1hgayknHQxxNmzYVJXnrrbfEEDCexx57TJQXssOoUTqcBNsZo+TkQ5nu ueceuQ+l3rBhgxs9erR7/vnn5RpKjkFDLNRDeyiT+7mOg0CJidool/t27NghRoIRjBkzRsqHlGbN miVGAqlDMBwGzCZttAFjQT6cxrJly1yPHj0kD84Jw8EIcADqOOhuMEBu6qAsiIU2UgcGB26//fab lMfGcBhwVUdE9AdtAW9IaP78+UJyODdkhIjYqgJipF8gLtqLc/zqq6/cvffe67799lv3ySefCK4j Roxwt912m5DdokWLZEM7+pX/Q5wrV64Uopg2bZqUTVDw448/St9C6FzDyS1dulScNFtcQ0pff/21 gwxpC3XQDrClvePHj3fDhw+X9tEfyKQOBsw/+OAD2S4bJ03b0Enu5f/0IXnffvttwZr+gejoFxzv +++/L/LilMaOHet++ukn6UcifogZ+bhG+ejZyJEjRU6cFW0Bg4cffljImTMakBHnj25D3ujJ4sWL 5e+wYcMkD4S7YMECyYNzRZ/QT4ibMtEL9BgH9+6770pf0XeUR/noEAn7AEtsCyLGSUDutAXdpN/A nWvIQP+B9cyZM2VDQuRQsqY8nDd40xYc3ZNPPilY0ieUrw4MZzB79myxB3RdV8ZXtS5XHqUmZ0lJ RfR0tj6KY0hEOVxDOSB6Oh0iU+MhusOg+WBcGlmgjERL3I8iQdgPPfSQKBbRHsZI1NC/f3/Xvn17 MQ4MAAPGGCgfBVaD5TeiegybKA3lp2zy8RvEgbJCBLQXRSZaGjBggJAOhoRx4AQ0UR4OAWOHFCF5 ToXHYDBaTSg4To06yKMJIwIPSAySYtM3iI4PZBZMVWkkYE+bqRc5ISLwBg/ko+0QNbLjnCB9+pi/ yItThRRwgsgDnjhc+u+bb75xa9eulf6CmIgEiT4hIY006WvKol8oF8fK5ncQF/kgHxwzETjOGD1g C+xge8EKR8mTBU6IPkQ3wJzoljJycnKkHuTlyYHfSWCvkTa6RnsgchwgUTmy4wAgP/SVMnAu6DRR 74MPPih/IXpkJ6hANogZLAkwIEmwY78niJC+R5/QQch26tSp0kbu56lj7ty58n8SZE37wA1dwZng eHACr732mtgH8uJcSLQTHKgbHUVeytKnCuwS5wAR0zbsCOzBlvsgcJLqKu0GL3U8BFcQuD4J69MC DpD+pT3oBPfob/Qd9VelHicnPVdeq5KK6BEL5cIQUEqIFhJGkW6++WaJHFF2lG3QoEGiMJAJTgBj IR8GRrQEYUMeGAURE4qOUUDmOATIA5LFKCFuSIGEopEHAyZ6xMAhUYyW34iaMByiQMgBR0EevmPQ KCMGQLvJy30YL6SFMWk0j9Mg2ho3bpwoPWRJW4iUuJfrYAHREBkiD3l41CcSpr1EZhgFpEXCIIhw aQ9yEzVjkDwVVeZ7iKD6QWwYKX0DjtRP3fQJDg/MkB9iQvY5c+ZIdEj/0d4vv/xSCAviYSiGJyz6 8oEHHiiTCazoCwhHD5uB8OgDyqR88Kd+yJk89DEETztoI/XR559//rkQJ9hDprQXjPmNjyawpx9x HMuXL5cAgbpox0svvSSESh4l24ULF8p3iJ0IGyeGfNxHu5Gf+nBifCAynCFEDPmho7QdWXiKePnl l+VeZEcX0X9kwkmhLwQ8RNJ8Rx6cG/WjH+BOoIJu3nHHHTIMiu7QNtqATrzzzjtiX8gP+aNzPKWi r+gUNoZtMQyE7tAGysUJQd7YEm2hr3AG6Bj6q1uJQ/o4Np4QaDty0ke0FycHtjgYnsrQbWTlN9qj 9oeOcx0ngt1zj5F9YuSfVERPJ95yyy2iTETHKBLRB4aLkqB4KDvkAVkQMUPsSmjcjxGhcHxHqSFl NTwUCCVnOABFRuEgJQwRIiAKwSAgkYkTJ0q5DKtg0Bgi7ZkyZYoYEI/MSrCQAfmoF+UletGxfciI 9kJkkA7XMQCMCTJDsXFCKDEyEREhA4bCozRRGlhQBgSOcSpp89SAjPyfD7LQboyD78hDOWp8YKVH MkZ6MRmPGlEndTz99NMiF4ZKJAhZ0S6GWMAfQ9ZIlncfRG7IxXXIk37UIRMIEbKBeJCXSA55cN70 HZE9OkLdEDNlMV5NX+JIcf6QIyQKphAu/UGUy5AWbaOvuZ/2QvL8DX05yFMJZUFk9C1lQmhE4NSH LuhwIH2LPOgZwQO6QrnoK3917B0sZsyYIX1CX6DnkCCyQ9Lci3zoF09CyMdv9DNERyDB79T1wgsv iN7oOQ3gTTQONgQm2A1y0UaNntFTdBR9B0/aq0Of6A2OhicpEjgNGTJEnAgJDHBu5IfoKYP28H/6 nqdQghnqwi7Qb/qNe3DA9AU6gC6TkIu2oo/IoX2DbaBTlMXTAm0Gd0sVQyCpiB5RICgSCqxRNgqJ sRLlooAYjj4aouA8AWiCDDSRl/IgC5I+/kECfCAUEkaO4hL9BJPWzzWiM8bCIVzSo48+KobJvRiz 5tWIA0Pjo+Xze7A88mH4fDRxDbLnE7ymwwRcw1lpHUrywbwYCh/yYFTqBDAsSBTDxTArI+m4NNFk MFG+RuSh9RCxKyY4bcWcsiAoEqQXTBCE4hQc1iIPxAKJ8KFene2iw1foEX2Hg9ZDbIIvKrUtwb/6 HVLlE5qoK4g5DolPaFIHRrsgO2SkbvRI6+D/BAOalIiRWfuXdmvb9d2L6m6wHUEM9TplqE1pnWBG 24L34iT4BPNQR7AeHBBJnQHfg7p63333lY21B2WiXRA2n2CdyMQ9mug7fXn+yCOPlF2fNGlSGRZ/ AdkuxIRA0hF9uEezoKIHFaU8CVFoDCOYlPhC7w1Xb3C6GE4iuAe+kjzl6DTPYBmh5YUrvyLX1CCj yaFRqsoMafGytLJTqByh0/vCyRmu/ZovONuC70GHFm0mBkQRrgz6LpEx3kjtLk93VP7Q2TzhdC9S HUGZY9WTSDpRXnuj9UXw3vKeAvXJKNbyYpUrNKCpbP1Nh/KSjujDgR6rwcWi0PF0qtZbnkIm2r54 2pJo3lDnU56xxltPeSSeCDbxOsxwzj9aGfHKGG/+RGSubN2Nt82x5K8MuWKpJxWwSESOv/OelCD6 vxOgmlb332WsNQ1Hk8cQSCUEjOhTqbesrYaAIWAIJICAEX0CoNkthoAhYAikEgJG9KnUW9ZWQ8AQ MAQSQMCIPgHQ7BZDwBAwBFIJASP6VOota6shYAgYAmEQ0AWHwb/BbEb0pjaGgCFgCKQwApB7cfEl 5zeJ9gvW/ALQq5xfOOi/+7+ajOhTuIOt6YaAIZDeCEDyhYWn/VYSp1zjRqW7qfK5dKnErwgvKvu/ EX1664lJbwgYAimOQCG7xzZr7LeYyPLkXuxXgV8tf/ft3SPbf5CM6FO8k635hoAhkN4IlO5+W+R3 kV3nunTt4bb//qvfsK70ECQbuklv3TDpDQFDoIYgcNVVfsPCgkJ/UM1/5dCmC+cvuAmTprv22S38 uH1psoi+hnS2iWEIGALpiQDbmmRk1HP33jfRLft8kd+ZdKjfzv0a/4K2dNimjOh17/TSS+oD0hM0 k9oQMAQMgVRCAKI/d+68P9uhgXvo4Wmylfv58+fcxeI/ubw2F5s0aewPQWjiZWN6TkkqyWhtNQQM AUMgrRFo3qyRO1OQ6+rWgb+L/ThNifOTbmQWTt2MujIDp3Zm/Qwf9rd0O3cdczt25qU1YCa8IWAI GAKphkAtP2G+xB9uE7oz7fHj+f74yDP+EKf6rvaRo8d8NN/M5W0/mWryWXsNAUPAEDAEGHBnpVRI Yki+YcNMfwzrUfd/YeRCFobwCcsAAAAASUVORK5CYIIAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAPAOgDc1wAAAEA6QMoAAAAgBYAAOAQAABAEQAA 4BYAAAUAAAAKAAAABAAAABUBAAABAAAAAAAAAQ8ACQS4AAAAAAAKBAQAAAB9CAAADwDMD6QAAAAA AM0PCAAAAAAAAAABAAAAAQDDDxgAAAABAAAAAAAAADYEAAAAAAAAPQEAAAEPAAAgALoPIgAAAFAA bwB3AGUAcgBQAG8AaQBuAHQALgBTAGgAbwB3AC4AOAAwALoPQgAAAE0AaQBjAHIAbwBzAG8AZgB0 ACAAUABvAHcAZQByAFAAbwBpAG4AdAAgAFAAcgBlAHMAZQBuAHQAYQB0AGkAbwBuAA8A8gOuAQAA LwDIDwwAAAAwANIPBAAAAAEAAAAPANUH5AAAAAAAtw9EAAAAQQByAGkAYQBsAAAAbgBnAHMAAACo uRMAqLkTAGACigcouBMAELgTAPboBzAIAAAAAAAAACi4EwDSQgkwILgTAAAABAAQALcPRAAAAFcA aQBuAGcAZABpAG4AZwBzAAAAqLkTAKi5EwBgAooHKLgTABC4EwD26AcwCAAAAAAAAAAouBMA0kIJ MCC4EwACAAYCIAC3D0QAAACLW1NPAABnAGQAaQBuAGcAcwAAAKi5EwCouRMAYAKKByi4EwAQuBMA 9ugHMAgAAAAAAAAAKLgTANJCCTAguBMAhgAEAAAApA8KAAAAgABCAAAA//8YAAAApQ8MAAAAAAAA CC4AAAAHAAAAAACpDwoAAAAHAAAAAgAJBAAAQACjD24AAAAFAP/9PwAAACIgAABkAAAAAP8AAGQA AAAAAAAAAABAAgAAAAAHAAAA///vAAAAAAD///////8SAAAAAAEAAAAFAAAgASABAAAAAAAFAABA AkACAAAAAAAFAABgA2ADAAAAAAAFAACABIAEAAAAAA8ACwTURgAADwAA8MxGAAAAAAbwODYAAAQU GwDGBgAAOgAAAAwAAAABAAAAOgAAAAAAAAAEAAAAAAAAAAQAAAAHAAAACAAAAAAAAAAEAAAAAAAA AAQAAAAAAAAABAAAAAAAAAAMAAAAAAAAAAQAAAAAAAAADgAAAAAAAAAEAAAAAAAAAAUAAAAAAAAA CAAAAAAAAAAKAAAAAAAAABUAAAAAAAAAyAAAAAAAAAAEAAAAAAAAACkAAAAAAAAABAAAAAAAAAAu AAAAAAAAAAQAAAAAAAAACAAAAAAAAAAEAAAAAAAAABcAAAAAAAAABAAAAAAAAAAQAAAAAAAAAAQA AAAAAAAARQAAAAAAAAAEAAAAAAAAAMkAAAAAAAAA/gIAAAAAAAAMAAAAAAAAAAQAAAAAAAAACgAA AAAAAAAEAAAAAAAAAAcAAAAAAAAABAAAAAAAAAA3AAAAAAAAAAQAAAAAAAAACgAAAAAAAAAfAAAA AAAAAA4AAAAAAAAABAAAAAAAAAAxAAAAAAAAAAQAAAAAAAAACAAAAAAAAAAEAAAAAAAAAAoAAAAA AAAACgAAAAAAAAAEAAAAAAAAAF0AAAAAAAAAKgAAAAAAAAAEAAAAAAAAAAkAAAAAAAAABAAAAAAA AAA8AAAAAAAAAAwAAAACAAAAFQAAAAAAAAASAAAAAAAAAAQAAAAAAAAABAAAAAAAAAADAAAAAAAA AAUAAAAAAAAADAAAAAAAAAADAAAAAAAAAAQAAAAAAAAABAAAAAAAAAADAAAAAAAAAAUAAAAAAAAA AwAAAAAAAAAEAAAAAAAAAAQAAAAAAAAABAAAAAAAAABNAAAAAAAAAAMAAAAAAAAABAAAAAAAAAAE AAAAAAAAAAYAAAAAAAAABwAAAAAAAAAGAAAAAAAAAIwAAAAAAAAAAwAAAAAAAAAEAAAAAAAAAAQA AAAAAAAAOQAAAAAAAAAGAAAAAAAAAAYAAAAAAAAAAwAAAAAAAAAEAAAAAAAAAAQAAAAAAAAABwAA AAAAAABbAAAAAAAAAAMAAAAAAAAABAAAAAAAAAB1AAAAAAAAAAYAAAAAAAAATAAAAAAAAABMAAAA AAAAAAMAAAAAAAAABAAAAAAAAABfAAAAAAAAACQAAAAAAAAABgAAAAAAAAAGAAAAAAAAAAMAAAAA AAAABAAAAAAAAAAHAAAAAAAAAAsAAAAAAAAABwAAAAAAAAAGAAAAAAAAAAMAAAAAAAAABAAAAAAA AAAEAAAAAAAAAAkAAAAAAAAABAAAAAAAAAADAAAAAAAAAAQAAAAAAAAAFQAAAAAAAAAHAAAAAAAA AAwAAAAAAAAAGQAAAAAAAAANAAAAAAAAABUAAAAAAAAABAAAAAAAAAAnAAAAAAAAACMAAAAAAAAA BAAAAAAAAAAjAAAAAAAAABMAAAAAAAAAEQAAAAAAAAApAAAAAAAAAAQAAAAAAAAAKQAAAAAAAAAM AAAAAAAAAAcAAAAAAAAABgAAAAAAAAAIAAAAAAAAAAYAAAAAAAAACgAAAAAAAAAEAAAAAAAAACMA AAAAAAAADgAAAAAAAAAEAAAAAAAAAAgAAAAAAAAABwAAAAAAAAAGAAAAAAAAAAgAAAAAAAAACQAA AAAAAAAEAAAAAAAAAAMAAAAAAAAABAAAAAAAAAAEAAAAAAAAAI0AAAAAAAAABgAAAAAAAAAGAAAA AAAAAAMAAAAAAAAABAAAAAAAAAAEAAAAAAAAAAcAAAAAAAAA0wAAAAAAAAADAAAAAAAAAAQAAAAA AAAAcwAAAAAAAAAGAAAAAAAAALIAAAAAAAAASgAAAAAAAAAkAAAAAAAAAAAEAAAAAAAABAAAAAAA AABWAAAAAAAAAG0AAAAAAAAAAwAAAAAAAAAGAAAAAAAAAAcAAAAAAAAABAAAAAAAAAADAAAAAAAA AAQAAAAAAAAABAAAAAAAAAAEAAAAAAAAAE0AAAAAAAAABAAAAAAAAAAWAAAAAAAAAAQAAAAAAAAA BAAAAAAAAAAEAAAAAAAAAAYAAAAAAAAACAAAAAAAAAAKAAAAAAAAAAQAAAAAAAAABQAAAAAAAABe AwAAAAAAAAQAAAAAAAAABQAAAAAAAAAEAAAAAAAAAAYAAAAAAAAABgAAAAAAAAAGAAAAAAAAAAQA AAAAAAAACAAAAAAAAAAEAAAAAAAAAAQAAAAAAAAABAAAAAAAAADNAAAAAAAAAAYAAAAAAAAABgAA AAAAAAAHAAAAAAAAAAYAAAAAAAAABgAAAAAAAAAGAAAAAAAAAAQAAAAAAAAACgAAAAAAAAAEAAAA AAAAAAgAAAAAAAAACQAAAAAAAAALAAAAAAAAAC8AAAAAAAAABAAAAAAAAAAEAAAAAAAAAAQAAAAA AAAABQAAAAAAAAAEAAAAAAAAAAUAAAAAAAAABAAAAAAAAAAFAAAAAAAAAAQAAAAGAAAABgAAAAAA AAAMAAAAAAAAAAQAAAAAAAAABwAAAAAAAAAFAAAAAAAAAAQAAAAAAAAABAAAAAAAAAAFAAAAAAAA AAQAAAAAAAAABAAAAAAAAAAEAAAAAAAAAAQAAAAAAAAABAAAAAAAAAAEAAAAAAAAAAQAAAAAAAAA BAAAAAAAAAAEAAAAAAAAAAQAAAAAAAAABAAAAAAAAAAEAAAAAAAAAAQAAAAAAAAABAAAAAAAAAAE AAAAAAAAAAQAAAAAAAAABAAAAAAAAAAEAAAAAAAAAAQAAAAAAAAABAAAAAAAAAAEAAAAAAAAAAQA AAAAAAAABAAAAAAAAAAEAAAAAAAAAAQAAAAAAAAABAAAAAAAAAAEAAAAAAAAAAQAAAAAAAAABAAA AAAAAAAEAAAAAAAAAAQAAAAAAAAABAAAAAAAAAAEAAAAAAAAAAQAAAAAAAAABAAAAAAAAAAEAAAA AAAAAAQAAAAAAAAABAAAAAAAAAAEAAAAAAAAAAQAAAAAAAAABAAAAAAAAAAGAAAAAAAAAAcAAAAA AAAABAAAAAAAAAAYAAAAAAAAAAcAAAAAAAAACAAAAAAAAAAVAAAAAAAAACQAAAAAAAAAJgAAAAAA AAAEAAAAAAAAACcAAAAAAAAABgAAAAAAAAAIAAAAAAAAAAQAAAAAAAAAMQAAAAAAAABEAAAAAAAA AAQAAAAAAAAABAAAAAAAAAAEAAAAAAAAAAgAAAAAAAAACgAAAAAAAAAGAAAAAAAAABYAAAAAAAAA IwAAAAAAAAAFAAAAAAAAAAUAAAAAAAAABQAAAAAAAAAFAAAAAAAAAAUAAAAAAAAABQAAAAAAAAAF AAAAAAAAAAQAAAAAAAAABgAAAAAAAAAEAAAAAAAAAAQAAAAAAAAABQAAAAAAAAAEAAAAAAAAAAUA AAAAAAAABAAAAAAAAAAEAAAAAAAAAAQAAAAAAAAABQAAAAAAAAAEAAAAAAAAAAMAAAAAAAAABAAA AAAAAAAGAAAAAAAAAAQAAAAAAAAABQAAAAAAAAAEAAAAAAAAAAMAAAAAAAAABAAAAAAAAAAFAAAA AAAAAAQAAAAAAAAABgAAAAAAAAAFAAAAAAAAACUAAAAAAAAABAAAAAAAAAAoAAAAAAAAAAQAAAAA AAAABAAAAAAAAAAGAAAAAAAAAAMAAAAAAAAAAwAAAAAAAAADAAAAAAAAAAQAAAAAAAAABAAAAAAA AAAGAAAAAAAAAAQAAAAAAAAABAAAAAAAAAA5AAAAAAAAAAQAAAAAAAAAagAAAAAAAAAGAAAAAAAA ABUAAAAAAAAABAAAAAAAAAAVAAAAAAAAAAQAAAAAAAAAFQAAAAAAAAAEAAAAAAAAABkAAAAAAAAA BAAAAAAAAAAEAAAAAAAAAAUAAAAAAAAABAAAAAAAAAAFAAAAAAAAAAQAAAAAAAAABAAAAAAAAAAE AAAAAAAAAAUAAAAAAAAABAAAAAAAAAAFAAAAAAAAAAQAAAAAAAAABwAAAAAAAAACAAAAAAAAAAUA AAAAAAAABAAAAAAAAAAlAAAAAAAAAAIAAAAAAAAAJgAAAAAAAAACAAAAAAAAABEAAAAAAAAABAAA AAAAAAAOAAAAAAAAAAQAAAAAAAAARAAAAAAAAAAEAAAAAAAAAAQAAAAAAAAABAAAAAAAAAAGAAAA AAAAAAIAAAAAAAAAJQAAAAAAAAACAAAAAAAAADIAAAAAAAAABAAAAAAAAAAHAAAAAAAAAAQAAAAA AAAABQAAAAAAAAAEAAAAAAAAAAUAAAAAAAAABAAAAAAAAAAnAAAAAAAAAAQAAAAAAAAAOQAAAAAA AAAEAAAAAAAAAAUAAAAAAAAABAAAAAAAAAAFAAAAAAAAAAQAAAAAAAAABgAAAAAAAAAEAAAAAAAA AAUAAAAAAAAABAAAAAAAAAApAAAAAAAAAAQAAAAAAAAABQAAAAAAAAAEAAAAAAAAAAUAAAAAAAAA BAAAAAAAAAASAAAAAAAAAAQAAAAAAAAABQAAAAAAAAAEAAAAAAAAADgAAAAAAAAABAAAAAAAAAAH AAAAAAAAAAQAAAAAAAAAMgAAAAAAAAAEAAAAAAAAAAYAAAAAAAAABAAAAAAAAAAmAAAAAAAAAAQA AAAAAAAAFQAAAAAAAAAEAAAAAAAAABAAAAAAAAAABAAAAAAAAAAFAAAAAAAAAAQAAAAAAAAAJQAA AAAAAAAEAAAAAAAAACYAAAAAAAAABAAAAAAAAABVAAAAAAAAAAQAAAAAAAAABAAAAAAAAAAEAAAA AAAAAAgAAAAAAAAABAAAAAAAAAApAAAAAAAAAAQAAAAAAAAABQAAAAAAAAAEAAAAAAAAACUAAAAA AAAABAAAAAAAAABBAAAAAAAAAAQAAAAAAAAAogAAAAAAAAAEAAAAAAAAACsAAAAAAAAABAAAAAAA AAAtAAAAAAAAAAQAAAAAAAAAHQAAAAAAAAAEAAAAAAAAACUAAAAAAAAABAAAAAAAAAAyAAAAAAAA AAQAAAAAAAAAJQAAAAAAAAAEAAAAAAAAACUAAAAAAAAABAAAAAAAAAAmAAAAAAAAAAQAAAAAAAAA JQAAAAAAAAAEAAAAAAAAACUAAAAAAAAABAAAAAAAAAAFAAAAAAAAAAQAAAAAAAAAKQAAAAAAAAAE AAAAAAAAAEYAAAAAAAAABAAAAAAAAAAGAAAAAAAAAAQAAAAAAAAAJgAAAAAAAAAEAAAAAAAAAEAA AAAAAAAABAAAAAAAAAAUAAAAAAAAAAQAAAAAAAAABQAAAAAAAAAEAAAAAAAAACYAAAAAAAAABAAA AAAAAAAmAAAAAAAAAAQAAAAAAAAAMgAAAAAAAAAEAAAAAAAAACYAAAAAAAAABAAAAAAAAAAnAAAA AAAAAAQAAAAAAAAABQAAAAAAAAAEAAAAAAAAAAUAAAAAAAAABAAAAAAAAAAFAAAAAAAAAAQAAAAA AAAABQAAAAAAAAAEAAAAAAAAAAMAAAAAAAAABAAAAAAAAAAkAAAAAAAAAAQAAAAAAAAABgAAAAAA AAAEAAAAAAAAAAMAAAAAAAAABAAAAAAAAAAYAAAAAAAAAAQAAAAAAAAABQAAAAAAAAAEAAAAAAAA ABcAAAAAAAAABAAAAAAAAAAXAAAAAAAAAAQAAAAAAAAAFwAAAAAAAAAEAAAAAAAAABgAAAAAAAAA BAAAAAAAAAAGAAAAAAAAAAQAAAAAAAAABgAAAAAAAAAEAAAAAAAAAAUAAAAAAAAABAAAAAAAAAAE AAAAAAAAAAQAAAAAAAAAKAAAAAAAAAAEAAAAAAAAAAQAAAAAAAAABAAAAAAAAAAEAAAAAAAAAAQA AAAAAAAABAAAAAAAAAAEAAAAAAAAAAQAAAAAAAAABAAAAAAAAAAFAAAAAAAAAAQAAAAAAAAABAAA AAAAAAAEAAAAAAAAAB8AAAAAAAAABAAAAAAAAAAlAAAAAAAAAAQAAAAAAAAABgAAAAAAAAAEAAAA AAAAAAQAAAAAAAAABAAAAAAAAAAEAAAAAAAAAAQAAAAAAAAABAAAAAAAAAAEAAAAAAAAAAQAAAAA AAAABAAAAAAAAAAEAAAAAAAAAAQAAAAAAAAABAAAAAAAAAAEAAAAAAAAAAcAAAAAAAAABAAAAAAA AAAFAAAAAAAAAAQAAAAAAAAABAAAAAAAAAAGAAAAAAAAAAUAAAAAAAAABQAAAAAAAAAGAAAAAAAA AAYAAAAAAAAABgAAAAAAAAAFAAAAAAAAAAQAAAAAAAAABQAAAAAAAAAEAAAAAAAAACUAAAAAAAAA BAAAAAAAAAAVAAAAAAAAAAQAAAAAAAAACAAAAAAAAAAEAAAAAAAAAAUAAAAAAAAABAAAAAAAAAAG AAAAAAAAAAQAAAAAAAAABgAAAAAAAAAEAAAAAAAAAAYAAAAAAAAABAAAAAAAAAAHAAAAAAAAAAYA AAAAAAAABAAAAAAAAAAyAAAAAAAAADEAAAAAAAAAEQAAAAAAAAAEAAAAAAAAAA8AAAAAAAAABAAA AAAAAABEAAAAAAAAAAQAAAAAAAAATAAAAAAAAAAyAAAAAAAAAAQAAAAAAAAABgAAAAAAAAAEAAAA AAAAADkAAAAAAAAABAAAAAAAAAAGAAAAAAAAAAQAAAAAAAAABgAAAAAAAAAEAAAAAAAAADkAAAAA AAAABAAAAAAAAAAIAAAAAAAAAAQAAAAAAAAAMgAAAAAAAAAEAAAAAAAAAAcAAAAAAAAABAAAAAAA AAACAAAAAAAAAAIAAAAAAAAAAgAAAAAAAAACAAAAAAAAAAUAAAAAAAAABAAAAAAAAAAJAAAAAAAA AAQAAAAAAAAAKAAAAAAAAAAEAAAAAAAAAAYAAAAAAAAABAAAAAAAAAAmAAAAAAAAAAQAAAAAAAAA OAAAAAAAAAAEAAAAAAAAAKMAAAAAAAAABAAAAAAAAAAmAAAAAAAAAAQAAAAAAAAAOAAAAAAAAAAE AAAAAAAAACYAAAAAAAAABAAAAAAAAAAmAAAAAAAAAAQAAAAAAAAAJwAAAAAAAAAEAAAAAAAAACYA AAAAAAAABAAAAAAAAAAmAAAAAAAAAAQAAAAAAAAABgAAAAAAAAAEAAAAAAAAADEAAAAAAAAAAgAA AAAAAAAEAAAAAAAAAAQAAAAAAAAAGAAAAAAAAAAEAAAAAAAAAAUAAAAAAAAABAAAAAAAAAAXAAAA AAAAAAQAAAAAAAAAFwAAAAAAAAAEAAAAAAAAABcAAAAAAAAABAAAAAAAAAAYAAAAAAAAAAQAAAAA AAAABwAAAAAAAAAEAAAAAAAAAAcAAAAAAAAABAAAAAAAAAAGAAAAAAAAAAQAAAAAAAAABgAAAAAA AAAEAAAAAAAAAAYAAAAAAAAABAAAAAAAAAAzAAAAAAAAACoAAAAAAAAAMQAAAAAAAAAtAAAAAAAA AAYAAAAAAAAABAAAAAAAAAAqAAAAAAAAAAQAAAAAAAAABAAAAAAAAAAEAAAAAAAAACoAAAAAAAAA BAAAAAAAAAAGAAAAAAAAAAQAAAAAAAAAAgAAAAAAAAACAAAAAAAAAAIAAAAAAAAAAgAAAAAAAAAq AAAAAAAAAAQAAAAAAAAANwAAAAAAAAAEAAAAAAAAAAYAAAAAAAAABAAAAAAAAAA5AAAAAAAAAAQA AAAAAAAABgAAAAAAAAAEAAAAAAAAACwAAAAAAAAABAAAAAAAAAAJAAAAAAAAAAQAAAAAAAAABAAA AAAAAAAqAAAAAAAAAAQAAAAAAAAAFwAAAAAAAAAEAAAAAAAAABgAAAAAAAAABAAAAAAAAAAYAAAA AAAAAAQAAAAAAAAAMAAAAAAAAAACAAAAAAAAAAgAAAAAAAAABAAAAAAAAAAYAAAAAAAAAAcAAAAA AAAABAAAAAAAAAACAAAAAAAAABEAAAAAAAAABAAAAAAAAAAJAAAAAAAAAAQAAAAAAAAABwAAAAAA AAAEAAAAAAAAADUAAAAAAAAABAAAAAAAAAAzAAAAAAAAAAQAAAAAAAAABQAAAAAAAAAEAAAAAAAA AAgAAAAAAAAAKgAAAAAAAAAEAAAAAAAAADcAAAAAAAAABAAAAAAAAAAIAAAAAAAAAAQAAAAAAAAA MAAAAAAAAAACAAAAAAAAADQAAAAAAAAAAgAAAAAAAAAwAAAAAAAAADQAAAAAAAAAAgAAAAAAAAAH AAAAAAAAAAQAAAAAAAAAFgAAAAAAAAAEAAAAAAAAAAYAAAAAAAAALgAAAAAAAAAEAAAAAAAAAAYA AAAAAAAABAAAAAAAAAAFAAAAAAAAAAQAAAAAAAAABwAAAAAAAAAEAAAAAAAAAAUAAAAAAAAABAAA AAAAAAAHAAAAAAAAAAQAAAAAAAAALgAAAAAAAAAEAAAAAAAAACoAAAAAAAAABAAAAAAAAAAuAAAA AAAAAAQAAAAAAAAALAAAAAAAAAAEAAAAAAAAAC0AAAAAAAAABAAAAAAAAAAuAAAAAAAAAAQAAAAA AAAABQAAAAAAAAAEAAAAAAAAAC0AAAAAAAAABAAAAAAAAAAqAAAAAAAAAAQAAAAAAAAANAAAAAAA AAAEAAAAAAAAAC4AAAAAAAAABAAAAAAAAAAqAAAAAAAAAAQAAAAAAAAAMAAAAAAAAAAyAAAAAAAA AAQAAAAAAAAALQAAAAAAAAAEAAAAAAAAAC0AAAAAAAAABAAAAAAAAAACAAAAAAAAAC0AAAAAAAAA BAAAAAAAAAAzAAAAAAAAADIAAAAAAAAAAgAAAAAAAAACAAAAAAAAADEAAAAAAAAABAAAAAAAAAAG AAAAAAAAAAcAAAAAAAAABQAAAAAAAAAEAAAAAAAAAAgAAAAAAAAABAAAAAAAAAAHAAAAAAAAAAQA AAAAAAAABgAAAAAAAAAGAAAAAAAAAAQAAAAAAAAABQAAAAAAAAAGAAAAAAAAAAYAAAAAAAAACQAA AAAAAAAGAAAAAAAAAAgAAAAAAAAABgAAAAAAAAAGAAAAAAAAAAQAAAAAAAAABgAAAAAAAAAGAAAA AAAAAAYAAAAAAAAABgAAAAAAAAAGAAAAAAAAADYAAAAAAAAABAAAAAAAAAAGAAAAAAAAAAYAAAAA AAAABgAAAAAAAAAGAAAAAAAAAAYAAAAAAAAABgAAAAAAAAAGAAAAAAAAAAYAAAAAAAAABgAAAAAA AAAGAAAAAAAAAAYAAAAAAAAABgAAAAAAAAAGAAAAAAAAAAYAAAAAAAAABgAAAAAAAAAGAAAAAAAA AAYAAAAAAAAABgAAAAAAAAAGAAAAAAAAAAYAAAAAAAAABgAAAAAAAAApAAAAAAAAAAIAAAAAAAAA KAAAAAAAAAACAAAAAAAAAAQAAAAAAAAABAAAAAAAAAAGAAAAAAAAAAIAAAAAAAAABwAAAAAAAAAq AAAAAAAAAAIAAAAAAAAANgAAAAAAAAAEAAAAAAAAAAUAAAAAAAAABAAAAAAAAAAFAAAAAAAAAAQA AAAAAAAABAAAAAAAAAAFAAAAAAAAAAQAAAAAAAAABAAAAAAAAAArAAAAAAAAAAQAAAAAAAAABQAA AAAAAAAGAAAAAAAAAAUAAAAAAAAABQAAAAAAAAAFAAAAAAAAACsAAAAAAAAABAAAAAAAAAA0AAAA AAAAAAQAAAAAAAAABQAAAAAAAAAEAAAAAAAAAAUAAAAAAAAABAAAAAAAAAAFAAAAAAAAAAQAAAAA AAAABwAAAAAAAAAFAAAAAAAAACsAAAAAAAAABAAAAAAAAAA2AAAAAAAAAGIAAAAAAAAABQAAAAAA AAAEAAAAAAAAAAUAAAAAAAAABAAAAAAAAAARAAAAAAAAAAQAAAAAAAAABgAAAAAAAAAEAAAAAAAA AAUAAAAAAAAABAAAAAAAAAArAAAAAAAAAAQAAAAAAAAACgAAAAAAAAAEAAAAAAAAABUAAAAAAAAA BAAAAAAAAAAGAAAAAAAAAAUAAAAAAAAABAAAAAAAAAAFAAAAAAAAAAQAAAAAAAAABQAAAAAAAAAE AAAAAAAAAAcAAAAAAAAABAAAAAAAAAAFAAAAAAAAAAQAAAAAAAAAKwAAAAAAAAAEAAAAAAAAAAUA AAAAAAAABwAAAAAAAAAEAAAAAAAAAAUAAAAAAAAABQAAAAAAAAAEAAAAAAAAAAQAAAAAAAAABQAA AAAAAAAGAAAAAAAAAAYAAAAAAAAABAAAAAAAAAAEAAAAAAAAAAQAAAAAAAAABAAAAAAAAAAEAAAA AAAAAAQAAAAAAAAABAAAAAAAAAAEAAAAAAAAAAQAAAAAAAAABAAAAAAAAAAEAAAAAAAAAAQAAAAA AAAABAAAAAAAAAAEAAAAAAAAAAQAAAAAAAAABAAAAAAAAAAEAAAAAAAAAAQAAAAAAAAABAAAAAAA AAAEAAAAAAAAAAQAAAAAAAAABAAAAAAAAAAEAAAAAAAAAAQAAAAAAAAABAAAAAAAAAAEAAAAAAAA AAQAAAAAAAAABAAAAAAAAAAEAAAAAAAAAAUAAAAAAAAABAAAAAAAAAAFAAAAAAAAAAQAAAAAAAAA AwAAAAAAAAAEAAAAAAAAAAMAAAAAAAAABAAAAAAAAAAGAAAAAAAAAAQAAAAAAAAABQAAAAAAAAAF AAAAAAAAAAQAAAAAAAAABAAAAAAAAAAFAAAAAAAAAAYAAAAAAAAABQAAAAAAAAAIAAAAAAAAAAQA AAAAAAAACgAAAAAAAAACAAAAAAAAABYAAAAAAAAABAAAAAAAAAAXAAAAAAAAAAQAAAAAAAAADgAA AAAAAAAEAAAAAAAAAAcAAAAAAAAABAAAAAAAAAAGAAAAAAAAAAQAAAAAAAAABQAAAAAAAAAEAAAA AAAAACwAAAAAAAAABAAAAAAAAAAFAAAAAAAAAAQAAAAAAAAARAAAAAAAAAAEAAAAAAAAAAcAAAAA AAAABAAAAAAAAAAEAAAAAAAAAAQAAAAAAAAAKgAAAAAAAAAEAAAAAAAAAAUAAAAAAAAABAAAAAAA AAAtAAAAAAAAAAQAAAAAAAAABQAAAAAAAAAEAAAAAAAAADkAAAAAAAAABAAAAAAAAAAHAAAAAAAA AAQAAAAAAAAABQAAAAAAAAAEAAAAAAAAADkAAAAAAAAABAAAAAAAAAAHAAAAAAAAAAQAAAAAAAAA BQAAAAAAAAAEAAAAAAAAAAUAAAAAAAAABAAAAAAAAAAsAAAAAAAAAAQAAAAAAAAABQAAAAAAAAAE AAAAAAAAAEIAAAAAAAAABAAAAAAAAAAEAAAAAAAAAAQAAAAAAAAAQgAAAAAAAAAEAAAAAAAAAGAA AAAAAAAABAAAAAAAAAAYAAAAAAAAAAQAAAAAAAAAFwAAAAAAAAAEAAAAAAAAAAQAAAAAAAAABAAA AAAAAAAEAAAAAAAAAAQAAAAAAAAABAAAAAAAAAAEAAAAAAAAAAQAAAAAAAAABAAAAAAAAAAPAAAA AAAAAAQAAAAAAAAABgAAAAAAAAAEAAAAAAAAAAQAAAAAAAAABAAAAAAAAAAFAAAAAAAAAAUAAAAA AAAADwAAAAAAAAAEAAAAAAAAAAYAAAAAAAAABQAAAAAAAACuAQAAAAAAAAQAAAAAAAAABAAAAAAA AAAEAAAAAAAAAAUAAAAAAAAABAAAAAAAAAAGAAAAAAAAAAQAAAAAAAAABAAAAAAAAAAEAAAAAAAA ACcAAAAAAAAAJgAAAAAAAAAEAAAAAAAAAAgAAAAAAAAAWwAAAAAAAAAxAAAAAAAAAAQAAAAAAAAA OAAAAAAAAAAEAAAAAAAAADQAAAAAAAAABAAAAAAAAAAGAAAAAAAAADcAAAAAAAAABAAAAAAAAAAE AAAAAAAAADQAAAAAAAAABAAAAAAAAAAEAAAAAAAAAAQAAAAAAAAABAAAAAAAAABEAAAAAAAAAAQA AAAAAAAABQAAAAAAAAAlAAAAAAAAAAQAAAAAAAAABAAAAAAAAABWAAAAAAAAAAQAAAAAAAAABQAA AAAAAABHAAAAAAAAACoAAAAAAAAABAAAAAAAAAAuAAAAAAAAAD8AAAAAAAAABAAAAAAAAABeAAAA AAAAAAYAAAAAAAAALgAAAAAAAAAEAAAAAAAAAAQAAAAAAAAACQAAAAAAAAAEAAAAAAAAAAcAAAAA AAAABAAAAAAAAAAEAAAAAAAAAAsAAAAAAAAABQAAAAAAAAAFAAAAAAAAAEUAAAAAAAAABgAAAAAA AAAHAAAAAAAAAAYAAAAAAAAABAAAAAAAAAAEAAAAAAAAAAUAAAAAAAAABAAAAAAAAAAoAAAAAAAA AFMAAAAAAAAABAAAAAAAAAA1AAAAAAAAAAQAAAAAAAAAKAAAAAAAAAADAAAAAAAAAAQAAAAAAAAA BQAAAAAAAAAFAAAAAAAAAEYAAAAAAAAABgAAAAAAAAAlAAAAAAAAAAQAAAAAAAAABAAAAAAAAAAE AAAAAAAAABIAAAAAAAAALgAAAAAAAAAEAAAAAAAAACUAAAAAAAAABAAAAAAAAAAlAAAAAAAAAAQA AAAAAAAALAAAAAAAAAAEAAAAAAAAACMAAAAAAAAABAAAAAAAAAAWAAAAAAAAACkAAAAAAAAABAAA AAAAAAAuAAAAAAAAAAQAAAAAAAAAJAAAAAAAAAAEAAAAAAAAACsAAAAAAAAABAAAAAAAAAAkAAAA AAAAAAQAAAAAAAAALgAAAAAAAAAEAAAAAAAAAAQAAAAAAAAALgAAAAAAAAClAAAAAAAAAAQAAAAA AAAAPQAAAAAAAAAEAAAAAAAAADMAAAAAAAAABAAAAAAAAABBAAAAAAAAAAQAAAAAAAAASQAAAAAA AAAEAAAAAAAAAC0AAAAAAAAABAAAAAAAAAAWAAAAAAAAAAgAAAAAAAAACgAAAAAAAABMAAAAAAAA AEUAAAAAAAAABAAAAAAAAABEAAAAAAAAAAQAAAAAAAAALAAAAAAAAAAEAAAAAAAAACcAAAAAAAAA BAAAAAAAAAAkAAAAAAAAAAQAAAAAAAAABgAAAAAAAAAEAAAAAAAAAC0AAAAAAAAABAAAAAAAAAAI AAAAAAAAAA0AAAAAAAAADAAAAAAAAAAKAAAAAAAAAAUAAAAAAAAABAAAAAAAAAAFAAAAAAAAAAQA AAAAAAAABAAAAAAAAAAEAAAAAAAAAAQAAAAAAAAAHgAAAAAAAAAEAAAAAAAAAAUAAAAAAAAABAAA AAAAAAAmAAAAAAAAAAQAAAAAAAAAKQAAAAAAAAAEAAAAAAAAABYAAAAAAAAADgAAAAAAAAAQAAAA AAAAAAwAAAAAAAAACwAAAAAAAAARAAAAAAAAABMAAAAAAAAADAAAAAAAAAAOAAAAAAAAAAsAAAAA AAAACwAAAAAAAAAMAAAAAAAAAA0AAAAAAAAADAAAAAAAAAAOAAAAAAAAAAwAAAAAAAAAEAAAAAAA AAAjAAAAAAAAAAsAAAAAAAAADwAAAAAAAAAmAAAAAAAAAAoAAAAAAAAAIgAAAAAAAAAVAAAAAAAA AA8AAAAAAAAADAAAAAAAAAAMAAAAAAAAAAkAAAAAAAAACwAAAAAAAAAKAAAAAAAAAAsAAAAAAAAA CgAAAAAAAAAPAAAAAAAAAA8AAAAAAAAAEAAAAAAAAACeAAAAAAAAAAQAAAAAAAAACAAAAAAAAAAI AAAAAAAAAGMAAAAAAAAABAAAAAAAAAAHAAAAAAAAAAUAAAAAAAAABAAAAAAAAAAdAAAAAAAAAB4A AAAAAAAAqQAAAAAAAAAJAAAAAAAAAAsAAAAAAAAACAAAAAAAAAAHAAAAAAAAAAUAAAAAAAAABAAA AAAAAAAEAAAAAAAAAAgAAAAAAAAACAAAAAAAAAAHAAAAAAAAAAgAAAAAAAAACAAAAAAAAAAIAAAA AAAAAAkAAAAAAAAACQAAAAAAAAAHAAAAAAAAAAgAAAAAAAAABwAAAAAAAAAHAAAAAAAAAAcAAAAA AAAACAAAAAAAAAAIAAAAAAAAAAgAAAAAAAAACAAAAAAAAAAOAAAAAAAAAAkAAAAAAAAABgAAAAAA AAAIAAAAAAAAAAcAAAAAAAAABwAAAAAAAAAHAAAAAAAAAAgAAAAAAAAABwAAAAAAAAAIAAAAAAAA AAcAAAAAAAAACAAAAAAAAAAHAAAAAAAAAAcAAAAAAAAACAAAAAAAAAAHAAAAAAAAAAgAAAAAAAAA CAAAAAAAAAAJAAAAAAAAAAkAAAAAAAAAEAAAAAAAAAAIAAAAAAAAANEAAAAAAAAAEgEAAAAAAAAT AAAAAAAAAAgAAAAAAAAABwAAAAAAAAAIAAAAAAAAAAgAAAAAAAAACAAAAAAAAAAJAAAAAAAAAAkA AAAAAAAABwAAAAAAAAAIAAAAAAAAAAcAAAAAAAAABwAAAAAAAAAHAAAAAAAAAAgAAAAAAAAACAAA AAAAAAAIAAAAAAAAAAgAAAAAAAAADgAAAAAAAAAJAAAAAAAAAAYAAAAAAAAACAAAAAAAAAAHAAAA AAAAAAcAAAAAAAAABwAAAAAAAAAIAAAAAAAAAAcAAAAAAAAACAAAAAAAAAAHAAAAAAAAAAgAAAAA AAAABwAAAAAAAAAHAAAAAAAAAAgAAAAAAAAABwAAAAAAAAAIAAAAAAAAAAgAAAAAAAAACQAAAAAA AAAJAAAAAAAAABAAAAAAAAAAAwAAAAAAAAAIAAAAAAAAAA0AAAAAAAAABAAAAAAAAAAHAAAAAAAA AAQAAAAAAAAABgAAAAAAAAAEAAAAAAAAAAUAAAAAAAAABAAAAAAAAAAEAAAAAAAAAAsAAAAAAAAA CwAAAAAAAAAKAAAAAAAAAAsAAAAAAAAACwAAAAAAAAALAAAAAAAAAAwAAAAAAAAADAAAAAAAAAAK AAAAAAAAAAsAAAAAAAAACgAAAAAAAAAKAAAAAAAAAAoAAAAAAAAACwAAAAAAAAAMAAAAAAAAAAoA AAAAAAAACgAAAAAAAAAQAAAAAAAAAA0AAAAAAAAACAAAAAAAAAALAAAAAAAAAAoAAAAAAAAACQAA AAAAAAAJAAAAAAAAAAoAAAAAAAAACgAAAAAAAAALAAAAAAAAAAkAAAAAAAAACgAAAAAAAAAJAAAA AAAAAAkAAAAAAAAACgAAAAAAAAAJAAAAAAAAAAoAAAAAAAAACgAAAAAAAAALAAAAAAAAAAsAAAAA AAAAEQAAAAAAAAAIAAAAAAAAAAcAAAAAAAAABwAAAAAAAAAGAAAAAAAAAAcAAAAAAAAABwAAAAAA AAAHAAAAAAAAAAkAAAAAAAAACAAAAAAAAAAGAAAAAAAAAAcAAAAAAAAABgAAAAAAAAAGAAAAAAAA AAYAAAAAAAAABwAAAAAAAAAHAAAAAAAAAAcAAAAAAAAACAAAAAAAAAAIAAAAAAAAAAkAAAAAAAAA CQAAAAAAAAAOAAAAAAAAAAoAAAAAAAAACQAAAAAAAAAGAAAAAAAAABIAAAAAAAAABAAAAAAAAAAN AAAAAAAAAAYAAAAAAAAACAAAAAAAAAAKAAAAAAAAAAkAAAAAAAAADAAAAAAAAAAIAAAAAAAAAAYA AAAAAAAABwAAAAAAAAAGAAAAAAAAAA0AAAAAAAAABAAAAAAAAAAHAAAAAAAAAAQAAAAAAAAABAAA AAAAAAAEAAAAAAAAAAUAAAAAAAAAAwAAAAAAAAADAAAAAAAAAAMAAAAAAAAABQAAAAAAAAADAAAA AAAAAAMAAAAAAAAAAwAAAAAAAAAGAAAAAAAAAAUAAAAAAAAABgAAAAAAAAAFAAAAAAAAAAcAAAAA AAAACAAAAAAAAAAGAAAAAAAAAAUAAAAAAAAAAwAAAAAAAAADAAAAAAAAAAMAAAAAAAAABgAAAAAA AAAGAAAAAAAAAAQAAAAAAAAAAwAAAAAAAAADAAAAAAAAAAgAAAAAAAAABwAAAAAAAAAHAAAAAAAA AAYAAAAAAAAAAwAAAAAAAAAGAAAAAAAAAAcAAAAAAAAABgAAAAAAAAAGAAAAAAAAAAUAAAAAAAAA AwAAAAAAAAADAAAAAAAAAAMAAAAAAAAAAwAAAAAAAAAGAAAAAAAAAAcAAAAAAAAABgAAAAAAAAAE AAAAAAAAAAkAAAAAAAAAGAAAAAAAAAALAAAAAAAAAAQAAAAAAAAABAAAAAAAAAAHAAAAAAAAAAcA AAAAAAAABgAAAAAAAAAHAAAAAAAAAAcAAAAAAAAABgAAAAAAAAAGAAAAAAAAAAQAAAAAAAAABgAA AAAAAAAIAAAAAAAAAA0AAAAAAAAABgAAAAAAAAAGAAAAAAAAAAgAAAAAAAAABwAAAAAAAAAEAAAA AAAAAAoAAAAAAAAABwAAAAAAAAAGAAAAAAAAAAcAAAAAAAAABwAAAAAAAAAHAAAAAAAAAAcAAAAA AAAACAAAAAAAAAAIAAAAAAAAABIAAAAAAAAACAAAAAAAAAAHAAAAAAAAAAYAAAAAAAAAFAAAAAAA AAAJAAAAAAAAAAcAAAAAAAAACwAAAAAAAAAWAAAAAAAAABMAAAAAAAAACAAAAAAAAAAIAAAAAAAA AA4AAAAAAAAABAAAAAAAAAAHAAAAAAAAAAcAAAAAAAAACgAAAAAAAAAGAAAAAAAAACAAAAAAAAAA igAAAAAAAAB5AAAAAAAAAJ0AAAAAAAAAWgAAAAAAAAAEAAAAAAAAAAQAAAAAAAAAZwAAAAAAAAAE AAAAAAAAACkCAAAAAAAACQAAAAAAAABpAAAAAAAAAAkAAAAAAAAACAAAAAAAAAAHAAAAAAAAAAYA AAAAAAAABwAAAAAAAAAGAAAAAAAAAAYAAAAAAAAABgAAAAAAAAAFAAAAAAAAAAkAAAAAAAAABwAA AAAAAAAGAAAAAAAAAAYAAAAAAAAABgAAAAAAAAAIAAAAAAAAAAgAAAAAAAAABAAAAAAAAAAGAAAA AAAAAAQAAAAAAAAABwAAAAAAAAAHAAAAAAAAAAcAAAAAAAAABgAAAAAAAAAHAAAAAAAAAAcAAAAA AAAABgAAAAAAAAAGAAAAAAAAAAQAAAAAAAAABwAAAAAAAAAJAAAAAAAAAA0AAAAAAAAACQAAAAAA AAAHAAAAAAAAAAcAAAAAAAAABgAAAAAAAAAEAAAAAAAAAAcAAAAAAAAABgAAAAAAAAAGAAAAAAAA AAYAAAAAAAAABgAAAAAAAAAGAAAAAAAAAAcAAAAAAAAABwAAAAAAAAAGAAAAAAAAAAgAAAAAAAAA BwAAAAAAAAAHAAAAAAAAAAYAAAAAAAAABwAAAAAAAAAGAAAAAAAAAAgAAAAAAAAABAAAAAAAAAAE AAAAAAAAAAQAAAAAAAAABAAAAAAAAAAEAAAAAAAAAAQAAAAAAAAABAAAAAAAAAAEAAAAAAAAAAQA AAAAAAAABAAAAAAAAAAEAAAAAAAAAAQAAAAAAAAABAAAAAAAAAAEAAAAAAAAAAQAAAAAAAAABAAA AAAAAAAEAAAAAAAAAAQAAAAAAAAABAAAAAAAAAAEAAAAAAAAAAQAAAAAAAAABAAAAAAAAAAEAAAA AAAAAAQAAAAAAAAABAAAAAAAAAAEAAAAAAAAAAQAAAAAAAAABAAAAAAAAAAEAAAAAAAAAAQAAAAA AAAABAAAAAAAAAAEAAAAAAAAAAQAAAAAAAAABAAAAAAAAAAEAAAAAAAAAAQAAAAAAAAABAAAAAAA AAAEAAAAAAAAAAQAAAAAAAAABAAAAAAAAAAEAAAAAAAAAAQAAAAAAAAABAAAAAAAAAAEAAAAAAAA AAQAAAAAAAAABAAAAAAAAAAbAAAAAAAAAAQAAAAAAAAACAAAAAAAAAAOAAAAAAAAAA4AAAAAAAAA BwAAAAAAAAALAAAAAAAAAA8AAAAAAAAABAAAAAAAAAAEAAAAAAAAAAQAAAAAAAAABAAAAAAAAAAE AAAAAAAAAAgAAADnAAAACwAAAOgAAAAEAAAAAAAAAAwAAAAAAAAABAAAAAAAAAAHAAAAAAAAAAQA AAAAAAAABwAAAAAAAAAEAAAAAAAAAAkAAAAAAAAABAAAAAAAAAAJAAAAAAAAAAQAAAAAAAAAFwAA AAAAAAAEAAAAAAAAAAYAAAAAAAAABgAAAAAAAAAGAAAAAAAAAAYAAAAAAAAACAAAAAAAAAAEAAAA 9wAAAAsAAAD4AAAABAAAAAAAAAAHAAAAAAAAAAYAAAAAAAAABAAAAAAAAAAHAAAAAAAAAAQAAAAA AAAABgAAAAAAAAAEAAAAAAAAAAYAAAAAAAAABAAAAAAAAAAEAAAAAAAAAAgAAAAAAAAABAAAAAAA AAAEAAAABQEAAAQAAAAGAQAABAAAAAAAAAA9AAAAAAAAAAQAAAAAAAAAGAAAAAAAAAAEAAAAAAAA AAQAAAAAAAAABAAAAAAAAAAEAAAAAAAAAAQAAAAAAAAABQAAAAAAAAAEAAAAAAAAAAUAAAAAAAAA BAAAAAAAAAAEAAAAAAAAAAQAAAAAAAAABAAAAAAAAAAEAAAAAAAAAAQAAAAAAAAABAAAABkBAAAE AAAAGgEAAAQAAAAAAAAACAAAAAAAAAAEAAAAzwQB8BANAAACAAfwJAAAAAAAAAAAAAAAAAAAAAAA AAAAAP8AAAAAAAAAAAAAAAAAAAAAAAIAB/AkAAAAAAAAAAAAAAAAAAAAAAAAAAAA/wAAAAAAAAAA AAAAAAAAAAAAAgAH8CQAAAAAAAAAAAAAAAAAAAAAAAAAAAD/AAAAAAAAAAAAAAAAAAAAAAACAAfw JAAAAAAAAAAAAAAAAAAAAAAAAAAAAP8AAAAAAAAAAAAAAAAAAAAAAGIAB/AkAAAABgaW6ZwKs0p7 /awPoUWmVoWt/wDFrwAAAgAAAAAAAAAAAAAAAgAH8CQAAAAAAAAAAAAAAAAAAAAAAAAAAAD/AAAA AAAAAAAAAAAAAAAAAAACAAfwJAAAAAAAAAAAAAAAAAAAAAAAAAAAAP8AAAAAAAAAAAAAAAAAAAAA AAIAB/AkAAAAAAAAAAAAAAAAAAAAAAAAAAAA/wAAAAAAAAAAAAAAAAAAAAAAAgAH8CQAAAAAAAAA AAAAAAAAAAAAAAAAAAD/AAAAAAAAAAAAAAAAAAAAAAACAAfwJAAAAAAAAAAAAAAAAAAAAAAAAAAA AP8AAAAAAAAAAAAAAAAAAAAAAAIAB/AkAAAAAAAAAAAAAAAAAAAAAAAAAAAA/wAAAAAAAAAAAAAA AAAAAAAAAgAH8CQAAAAAAAAAAAAAAAAAAAAAAAAAAAD/AAAAAAAAAAAAAAAAAAAAAAACAAfwJAAA AAAAAAAAAAAAAAAAAAAAAAAAAP8AAAAAAAAAAAAAAAAAAAAAAAIAB/AkAAAAAAAAAAAAAAAAAAAA AAAAAAAA/wAAAAAAAAAAAAAAAAAAAAAAAgAH8CQAAAAAAAAAAAAAAAAAAAAAAAAAAAD/AAAAAAAA AAAAAAAAAAAAAAACAAfwJAAAAAAAAAAAAAAAAAAAAAAAAAAAAP8AAAAAAAAAAAAAAAAAAAAAAAIA B/AkAAAAAAAAAAAAAAAAAAAAAAAAAAAA/wAAAAAAAAAAAAAAAAAAAAAAAgAH8CQAAAAAAAAAAAAA AAAAAAAAAAAAAAD/AAAAAAAAAAAAAAAAAAAAAAACAAfwJAAAAAAAAAAAAAAAAAAAAAAAAAAAAP8A AAAAAAAAAAAAAAAAAAAAAAIAB/AkAAAAAAAAAAAAAAAAAAAAAAAAAAAA/wAAAAAAAAAAAAAAAAAA AAAAAgAH8CQAAAAAAAAAAAAAAAAAAAAAAAAAAAD/AAAAAAAAAAAAAAAAAAAAAAACAAfwJAAAAAAA AAAAAAAAAAAAAAAAAAAAAP8AAAAAAAAAAAAAAAAAAAAAAAIAB/AkAAAAAAAAAAAAAAAAAAAAAAAA AAAA/wAAAAAAAAAAAAAAAAAAAAAAAgAH8CQAAAAAAAAAAAAAAAAAAAAAAAAAAAD/AAAAAAAAAAAA AAAAAAAAAAACAAfwJAAAAAAAAAAAAAAAAAAAAAAAAAAAAP8AAAAAAAAAAAAAAAAAAAAAAAIAB/Ak AAAAAAAAAAAAAAAAAAAAAAAAAAAA/wAAAAAAAAAAAAAAAAAAAAAAAgAH8CQAAAAAAAAAAAAAAAAA AAAAAAAAAAD/AAAAAAAAAAAAAAAAAAAAAAACAAfwJAAAAAAAAAAAAAAAAAAAAAAAAAAAAP8AAAAA AAAAAAAAAAAAAAAAAAIAB/AkAAAAAAAAAAAAAAAAAAAAAAAAAAAA/wAAAAAAAAAAAAAAAAAAAAAA AgAH8CQAAAAAAAAAAAAAAAAAAAAAAAAAAAD/AAAAAAAAAAAAAAAAAAAAAAACAAfwJAAAAAAAAAAA AAAAAAAAAAAAAAAAAP8AAAAAAAAAAAAAAAAAAAAAAAIAB/AkAAAAAAAAAAAAAAAAAAAAAAAAAAAA /wAAAAAAAAAAAAAAAAAAAAAAAgAH8CQAAAAAAAAAAAAAAAAAAAAAAAAAAAD/AAAAAAAAAAAAAAAA AAAAAAACAAfwJAAAAAAAAAAAAAAAAAAAAAAAAAAAAP8AAAAAAAAAAAAAAAAAAAAAAAIAB/AkAAAA AAAAAAAAAAAAAAAAAAAAAAAA/wAAAAAAAAAAAAAAAAAAAAAAAgAH8CQAAAAAAAAAAAAAAAAAAAAA AAAAAAD/AAAAAAAAAAAAAAAAAAAAAAACAAfwJAAAAAAAAAAAAAAAAAAAAAAAAAAAAP8AAAAAAAAA AAAAAAAAAAAAAAIAB/AkAAAAAAAAAAAAAAAAAAAAAAAAAAAA/wAAAAAAAAAAAAAAAAAAAAAAAgAH 8CQAAAAAAAAAAAAAAAAAAAAAAAAAAAD/AAAAAAAAAAAAAAAAAAAAAAACAAfwJAAAAAAAAAAAAAAA AAAAAAAAAAAAAP8AAAAAAAAAAAAAAAAAAAAAAAIAB/AkAAAAAAAAAAAAAAAAAAAAAAAAAAAA/wAA AAAAAAAAAAAAAAAAAAAAAgAH8CQAAAAAAAAAAAAAAAAAAAAAAAAAAAD/AAAAAAAAAAAAAAAAAAAA AAACAAfwJAAAAAAAAAAAAAAAAAAAAAAAAAAAAP8AAAAAAAAAAAAAAAAAAAAAAAIAB/AkAAAAAAAA AAAAAAAAAAAAAAAAAAAA/wAAAAAAAAAAAAAAAAAAAAAAAgAH8CQAAAAAAAAAAAAAAAAAAAAAAAAA AAD/AAAAAAAAAAAAAAAAAAAAAAACAAfwJAAAAAAAAAAAAAAAAAAAAAAAAAAAAP8AAAAAAAAAAAAA AAAAAAAAAAIAB/AkAAAAAAAAAAAAAAAAAAAAAAAAAAAA/wAAAAAAAAAAAAAAAAAAAAAAAgAH8CQA AAAAAAAAAAAAAAAAAAAAAAAAAAD/AAAAAAAAAAAAAAAAAAAAAAACAAfwJAAAAAAAAAAAAAAAAAAA AAAAAAAAAP8AAAAAAAAAAAAAAAAAAAAAAAIAB/AkAAAAAAAAAAAAAAAAAAAAAAAAAAAA/wAAAAAA AAAAAAAAAAAAAAAAYgAH8CQAAAAGBhhEYr97vp5AsYX++zeOGXf/ACGFAAABAAAAxa8AAAAAAAAC AAfwJAAAAAAAAAAAAAAAAAAAAAAAAAAAAP8AAAAAAAAAAAAAAAAAAAAAAAIAB/AkAAAAAAAAAAAA AAAAAAAAAAAAAAAA/wAAAAAAAAAAAAAAAAAAAAAAAgAH8CQAAAAAAAAAAAAAAAAAAAAAAAAAAAD/ AAAAAAAAAAAAAAAAAAAAAAACAAfwJAAAAAAAAAAAAAAAAAAAAAAAAAAAAP8AAAAAAAAAAAAAAAAA AAAAAAIAB/AkAAAAAAAAAAAAAAAAAAAAAAAAAAAA/wAAAAAAAAAAAAAAAAAAAAAAAgAH8CQAAAAA AAAAAAAAAAAAAAAAAAAAAAD/AAAAAAAAAAAAAAAAAAAAAAACAAfwJAAAAAAAAAAAAAAAAAAAAAAA AAAAAP8AAAAAAAAAAAAAAAAAAAAAAAIAB/AkAAAAAAAAAAAAAAAAAAAAAAAAAAAA/wAAAAAAAAAA AAAAAAAAAAAAAgAH8CQAAAAAAAAAAAAAAAAAAAAAAAAAAAD/AAAAAAAAAAAAAAAAAAAAAAACAAfw JAAAAAAAAAAAAAAAAAAAAAAAAAAAAP8AAAAAAAAAAAAAAAAAAAAAAAIAB/AkAAAAAAAAAAAAAAAA AAAAAAAAAAAA/wAAAAAAAAAAAAAAAAAAAAAAAgAH8CQAAAAAAAAAAAAAAAAAAAAAAAAAAAD/AAAA AAAAAAAAAAAAAAAAAAACAAfwJAAAAAAAAAAAAAAAAAAAAAAAAAAAAP8AAAAAAAAAAAAAAAAAAAAA AAIAB/AkAAAAAAAAAAAAAAAAAAAAAAAAAAAA/wAAAAAAAAAAAAAAAAAAAAAAAgAH8CQAAAAAAAAA AAAAAAAAAAAAAAAAAAD/AAAAAAAAAAAAAAAAAAAAAAACAAfwJAAAAAAAAAAAAAAAAAAAAAAAAAAA AP8AAAAAAAAAAAAAAAAAAAAAAAIAB/AkAAAAAAAAAAAAAAAAAAAAAAAAAAAA/wAAAAAAAAAAAAAA AAAAAAAAAgAH8CQAAAAAAAAAAAAAAAAAAAAAAAAAAAD/AAAAAAAAAAAAAAAAAAAAAAACAAfwJAAA AAAAAAAAAAAAAAAAAAAAAAAAAP8AAAAAAAAAAAAAAAAAAAAAAAIAB/AkAAAAAAAAAAAAAAAAAAAA AAAAAAAA/wAAAAAAAAAAAAAAAAAAAAAAYgAH8CQAAAAGBlqcwKKjjFDMLPz9QeBzhWj/AJ/UAQAB AAAA5jQBAAAAAABiAAfwJAAAAAYGDTpJIxKdYDXiRKrYaigeKf8Avl0BAAEAAACFCQMAAAAAAAIA B/AkAAAAAAAAAAAAAAAAAAAAAAAAAAAA/wAAAAAAAAAAAAAAAAAAAAAAYgAH8CQAAAAGBh3PThMI baaV5Hxx2Q79m6j/AJAWAQABAAAAQ2cEAAAAAABiAAfwJAAAAAYGzbK5H7kwMaLYp7BHsakduv8A L/IAAAEAAADTfQUAAAAAAAMIC/AAAwAAgQAAAAAAggAAAAAAgwAAAAAAhAAAAAAAhQAAAAAAhwAC AAAAiAAAAAAAiQAAAAAAvwAAAA8ADAH0AAAQDQEAAAAgDgEAAAAggAEAAAAAgQEEAAAIggEAAAEA gwEAAAAIhAEAAAEAhQEAAAAghkEAAAAAh8EAAAAAiAEAAAAAiQEAAAAAigEAAAAAiwEAAAAAjAEA AAAAjQEAAAAAjgEAAAAAjwEAAAAAkAEAAAAAkQEAAAAAkgEAAAAAkwEAAAAAlAEAAAAAlQEAAAAA lgEAAAAAl8EAAAAAmAEAAAAAmQEAAAAAmgEAAAAAmwEAAAAAnAEDAABAvwEMAB4AwAEBAAAIwQEA AAEAwgH///8AwwEAAAAgxAEAAAAAxUEAAAAAxsEAAAAAxwEAAAAAyAEAAAAAyQEAAAAAygEAAAAA ywE1JQAAzAEAAAgAzQEAAAAAzgEAAAAAz8EAAAAA1wECAAAA/wEGAA4AAAIAAAAAAQICAAAIAgLL y8sAAwIAAAAgBAIAAAEABQI4YwAABgI4YwAABwIAAAAACAIAAAAACQIAAAEACgIAAAAACwIAAAAA DAIAAAEADQIAAAAADgIAAAAADwIAAQAAEAIAAAAAEQIAAAAAPwIAAAMAgAIAAAAAgQIAAAEAggIF AAAAgwKcMQAAhAIAAAAAhQLw+QYAhgIAAAAAhwL3AAAQiAIAAAAgvwIBAA8AwAIAAAAAwQIAAAAA wgJkAAAAwwIAAAAAxAIAAAAAxQIAAAAAxgIAAAAAxwIAAAAAyAIAAAAAyQIAAAAAygIwdQAAywLQ EhMAzAIw7ez/zQJAVIkAzgIAgAAAzwIAgP//0AIAAHn/0QIyAAAA0gIgTgAA0wJQwwAA1AIAAAAA 1QIQJwAA1gJwlAAA1wKwPP//2AIAAAAA2QIQJwAA2gJwlAAA/wIWAB8ABAMBAAAAQQOoKQEAQgMA AAAAQwMDAAAARAN8vgEARQMAAAAAfwMAAA8AhAN8vgEAhQMAAAAAhgN8vgEAhwMAAAAAYwAi8SQA AAC/AAAAYACPAwAAAACQAwIAAACRAwAAAACSAwIAAAC/AwCCAIKAABrxIAAAAMwAAABVVVUA/+/g AOD/8AD//+AA//SwAP/LsAD/sLsAQAAe8RAAAAD/////AQAACP/////3AAAQHwDwDzgAAAAAAPMD FAAAAAIAAAAEAAAAAAAAAAAAAIAAAAAAAADzAxQAAABdAAAABAAAAAAAAAABAACAAAAAAA8A0Adb CQAAHwAUBBwAAAAAABUEFAAAAB20zgoAypo7o+E5NwDKmjsBAgAADwD6A2cAAAAAAP4DAwAAAAAA AAAA/QM0AAAASwAAAGQAAABLAAAAZAAAAAgAAAAAAAAAQLgTANJCCTAAAAAAAAAAADz9//+C/P// AAATAHAA+wMIAAAAAAAAAN8QAABwAPsDCAAAAAEAAAAAAAAAHwATBDwAAAAAAP0DNAAAAGQAAABk AAAAZAAAAGQAAABsuBMAcEMJMKi5EwA4AooHAAAAAAAAAAAAAAAAAAAAAAABEwAfAP8DFAAAAAIA AAQMAAAAAAAAAAAAAAACAAAAHwAIBDwAAAAAAP0DNAAAAGQAAABkAAAAZAAAAGQAAAACAAAAbLgT AGhHCTCouRMAAAAAAAAAAAAAAAAAAAAAAAAAEwAfAAcEPAAAAAAA/QM0AAAAIQAAAGQAAAAhAAAA ZAAAAAIAAABsuBMAaEcJMKi5EwAAAAAAAAAAAAAAAAAAAAAAAAETAB8A+gNnAAAAAAD+AwMAAAAA AAAAAP0DNAAAAEUAAABkAAAARQAAAGQAAAAIAAAAAAAAAEC4EwDSQgkwAAAAAAAAAACe+P//mv// /wEAEwBwAPsDCAAAAAAAAABwCwAAcAD7AwgAAAABAAAAoAgAAA8AiBNpBwAADwCKE7AGAAAAALoP FgAAAF8AXwBfAFAAUABUAE0AYQBjADEAMQAAAIsTigYAAEAAGhBmBQAABQAAAAAIDAEAAAAAAAIA AAEMAAAAAAAAABQAAAAgAAAAAQAAAAEAAAAAAAAAAQAAAOgAAAAIAAAABAAAAAAAAAEAAAAAAQAA AAAAAAEBAAAAAQAAAAAAAAECAAAAAQAAAAAAAAEDAAAAAQAAAAAAAAEEAAAAAQAAAAAAAAEFAAAA aG5hbWQAAABgAAAAAgAAAAQAAAAAAAAAAwAAAAAAAAAKAEEAcgBpAGEAbAAAAAAACAAAAAAAAAAD AAAAAAAAACYATQBvAG4AbwB0AHkAcABlACAAVAB5AHAAbwBnAHIAYQBwAGgAeQAAAAABBgAAAAQA GAAAAAABBwAAAAYAAAAAAAAAAAAEAAAADgAJABEAAAAaAAEAAAAIDAEAAAAAAAIAAAEMAAAAAAAA ABQAAAAgAAAAAQAAAAEAAAAAAAAAAQAAAOgAAAAIAAAABAAAAAAAAAEAAAAAAQAAAAAAAAEBAAAA AQAAAAAAAAECAAAAAQAAAAAAAAEDAAAAAQAAAAAAAAEEAAAAAQAAAAAAAAEFAAAAaG5hbWQAAABg AAAAAgAAAAQAAAAAAAAAAwAAAAAAAAAKAEEAcgBpAGEAbAAAAAAACAAAAAAAAAADAAAAAAAAACYA TQBvAG4AbwB0AHkAcABlACAAVAB5AHAAbwBnAHIAYQBwAGgAeQAAAAABBgAAAAQAGAAAAAABBwAA AAYAAAAAAAAAAAAEAAAADgAJABEAAAAaAAEAAAAIDAEAAAAAAAIAAAEMAAAAAAAAABQAAAAgAAAA AQAAAAEAAAAAAAAAAQAAAOgAAAAIAAAABAAAAAAAAAEAAAAAAQAAAAAAAAEBAAAAAQAAAAAAAAEC AAAAAQAAAAAAAAEDAAAAAQAAAAAAAAEEAAAAAQAAAAAAAAEFAAAAaG5hbWQAAABgAAAAAgAAAAQA AAAAAAAAAwAAAAAAAAAKAEEAcgBpAGEAbAAAAAAACAAAAAAAAAADAAAAAAAAACYATQBvAG4AbwB0 AHkAcABlACAAVAB5AHAAbwBnAHIAYQBwAGgAeQAAAAABBgAAAAQAGAAAAAABBwAAAAYAAAAAAAAA AAAEAAAADgAJABEAAAAaAAEAAAAIDAEAAAAAAAIAAAEMAAAAAAAAABQAAAAgAAAAAQAAAAEAAAAA AAAAAQAAAOgAAAAIAAAABAAAAAAAAAEAAAAAAQAAAAAAAAEBAAAAAQAAAAAAAAECAAAAAQAAAAAA AAEDAAAAAQAAAAAAAAEEAAAAAQAAAAAAAAEFAAAAaG5hbWQAAABgAAAAAgAAAAQAAAAAAAAAAwAA AAAAAAAKAEEAcgBpAGEAbAAAAAAACAAAAAAAAAADAAAAAAAAACYATQBvAG4AbwB0AHkAcABlACAA VAB5AHAAbwBnAHIAYQBwAGgAeQAAAAABBgAAAAQAGAAAAAABBwAAAAYAAAAAAAAAAAAEAAAADgAJ ABEAAAAaAAEAAAAIDAEAAAAAAAIAAAEMAAAAAAAAABQAAAAgAAAAAQAAAAEAAAAAAAAAAQAAAOgA AAAIAAAABAAAAAAAAAEAAAAAAQAAAAAAAAEBAAAAAQAAAAAAAAECAAAAAQAAAAAAAAEDAAAAAQAA AAAAAAEEAAAAAQAAAAAAAAEFAAAAaG5hbWQAAABgAAAAAgAAAAQAAAAAAAAAAwAAAAAAAAAKAEEA cgBpAGEAbAAAAAAACAAAAAAAAAADAAAAAAAAACYATQBvAG4AbwB0AHkAcABlACAAVAB5AHAAbwBn AHIAYQBwAGgAeQAAAAABBgAAAAQAGAAAAAABBwAAAAYAAAAAAAAAAAAEAAAADgAJABEAAAAaAAEA ABwQFAEAAAAAAAgMAQAAAAAAAgAAAQwAAAAAAAAAFAAAACAAAAABAAAAAQAAAAAAAAABAAAA6AAA AAgAAAAEAAAAAAAAAQAAAAABAAAAAAAAAQEAAAABAAAAAAAAAQIAAAABAAAAAAAAAQMAAAABAAAA AAAAAQQAAAABAAAAAAAAAQUAAABobmFtZAAAAGAAAAACAAAABAAAAAAAAAADAAAAAAAAAAoAQQBy AGkAYQBsAAAAAAAIAAAAAAAAAAMAAAAAAAAAJgBNAG8AbgBvAHQAeQBwAGUAIABUAHkAcABvAGcA cgBhAHAAaAB5AAAAAAEGAAAABAAYAAAAAAEHAAAABgAAAAAAAAAAAAQAAAAOAAkAEQAAABoAAQ8A ihNoAAAAAAC6DxQAAABfAF8AXwBQAFAAVAAyADAAMAAxAAAAixNEAAAADwCIFzwAAAAAAIkXNAAA AAAAAAAAAAAAAAAAAFgCAAAAAQEAAQEAAAEBAQABAAAAAAAAAADQAAAAAAAAAAAAAIACAeAPAIoT OQAAAAAAug8QAAAAXwBfAF8AUABQAFQAMQAwAAAAixMZAAAAAAANBAgAAAAAwAAAAMAAAAAAsTYB AAAAAT8A2Q8MAAAAAADaDwQAAAAAAAwATwDZDwwAAAAAANoPBAAAAA0APQAPAPAPnggAAAAA8wMU AAAAigYAAAAAAAACAAAACAMAAAAAAAAAAJ8PBAAAAAAAAAAAAKgPJQAAAFJlbGVhc2UgNy4wIEZl YXR1cmVzIGFuZCBFbmhhbmNlbWVudHMQAJ8PBAAAAAcAAAAAAKgPDQEAAE11bHRpLWJ5dGUgTGFu Z3VhZ2UgU3VwcG9ydA0NTGFuZ3VhZ2UgUGFjayBFZGl0b3INDUJsYWNrYm9hcmQgQmFja3BhY2sg KE9mZmxpbmUgU3luY2hyb25pemF0aW9uIEFwcGxpY2F0aW9uKSANDUVtYmVkZGVkIFF1aWNrIFR1 dG9yaWFscw0NTmV3IEluc3RhbGxlcnMgYW5kIFVwZGF0ZXJzDQ1Db3Vyc2UvQ29tbXVuaXR5L1Nl cnZpY2VzIGFzIE1vZHVsZSBUYWJzDQ1JbXByb3ZlZCBFbWFpbCANDUFzeW5jaHJvbm91cyBJbXBv cnQvRXhwb3J0L0FyY2hpdmUvUmVzdG9yZQ0NAAChD0gAAAAcAAAAAAAAEAAAWgABAAAAAAABEAAA AgBaAO8AAAAAAAAQAABaAAEAAAAAAAEQAAACAFoAAQAAAAAAABAAAFoADgEAAAAAAAAAAPMDFAAA AHoGAAAEAAAAAQAAAAYDAAAAAAAAAACfDwQAAAAAAAAAAACoDxsAAABNdWx0aS1CeXRlIExhbmd1 YWdlIFN1cHBvcnQAAPMDFAAAAG4GAAAEAAAAAQAAAP4CAAAAAAAAAACfDwQAAAAAAAAAAACoDxQA AABMYW5ndWFnZSBQYWNrIEVkaXRvcgAA8wMUAAAAnQYAAAAAAAACAAAAEgMAAAAAAAAAAJ8PBAAA AAAAAAAAAKgPNwAAAFJlbGVhc2UgNy4wIC0tIE11bHRpLUJ5dGUgU3VwcG9ydC9MYW5ndWFnZSBQ YWNrIEVkaXRvciAQAJ8PBAAAAAEAAAAAAKgPZgQAAEZ1bGx5IGludGVybmF0aW9uYWxpemVkIGRh dGFiYXNlIHdpdGggbXVsdGktY2hhcmFjdGVyIGJ5dGUgc3VwcG9ydA1TaW1wbGlmaWVkIENoaW5l c2UNSmFwYW5lc2UNTXVsdGlwbGUgbGFuZ3VhZ2UgaW5zdGFsbGF0aW9ucyBvbiBhIHNpbmdsZSBz eXN0ZW0uIA1CYXNpYyBFZGl0aW9uIGNsaWVudHMgY2FuIG9ubHkgaGF2ZSBFbmdsaXNoICsgMQ1M YW5ndWFnZSBwcmVmZXJlbmNlIHNldHRpbmdzIGNhbiBiZSBzZXQgZm9yIGluc3RpdHV0aW9ucywg Y291cnNlLCBhbmQvb3IgaW5kaXZpZHVhbCB1c2Vycy4NV2hhdCBpcyBhIExhbmd1YWdlIFBhY2s/ DUEgZG93bmxvYWRhYmxlIGZpbGUgcGFja2FnZSB0aGF0IGNvbnRhaW5zIGFsbCB0aGUgdGV4dCwg Z3JhcGhpY3MsIGFuZCBjb2RlIHRvIHN1cHBvcnQgYSBnaXZlbiBsYW5ndWFnZSB0byBkaXNwbGF5 IHdpdGhpbiB0aGUgVXNlciBJbnRlcmZhY2UgaW5jbHVkaW5nIGxvY2FsZSBwcmVmZXJlbmNlcy4g DVdoYXQgaXMgdGhlIExhbmd1YWdlIFBhY2sgRWRpdG9yPw1BIHRvb2wgYWxsb3dpbmcgY2xpZW50 cyB3aXRoIGFuIEVudGVycHJpc2UgbGljZW5zZSB0byBtb2RpZnkgYW55IG9mIHRoZSBleGlzdGlu ZyBsYW5ndWFnZSBwYWNrcyAoaW5jbHVkaW5nIEVuZ2xpc2gpIG9yIHRvIGNyZWF0ZSBhIG5ldyBs YW5ndWFnZSBwYWNrLg1XaGF0IGlzIHRoZSBMYW5ndWFnZSBQYWNrIGNhdGFsb2c/DUFuIG9ubGlu ZSBjYXRhbG9nIHdoZXJlIHRoZSBCYiBjb21tdW5pdHkgY2FuIGV4Y2hhbmdlIGxhbmd1YWdlIHBh Y2tzIHRoYXQgd2VyZSBjcmVhdGVkIHVzaW5nIHRoZSBsYW5ndWFnZSBwYWNrIGVkaXRvci4NV2hh dCBkb2VzIHRoaXMgbWVhbiBmb3IgTUw/DUVuZC1vZi1saWZlIGZvciBNTCB3aWxsIGJlIGFubm91 bmNlZCBzaG9ydGx5IGFmdGVyIEVkdWN1YXNlLiBBY3R1YWwgc3VwcG9ydCB3aWxsIGVuZCBpbiBT cHJpbmcgMjAwNy4gRXhpc3RpbmcgTUwgY2xpZW50cyBhcmUgZW5jb3VyYWdlZCB0byBtb3ZlIHRv IFJlbGVhc2UgNy4wIGFzIHNvb24gYXMgcG9zc2libGUgdG8gbGV2ZXJhZ2UgdGhlIGxhdGVzdCBp bm5vdmF0aXZlIGZlYXR1cmVzLiBUaGVyZSBpcyBhIGNvbnZlcnNpb24gdG9vbCB0byBmYWNpbGl0 YXRlIHRoZSB1cGRhdGUuIA0AAKEPKgEAAEMAAAAAAAAAAAAcAAAAAQAAAAAANQAAAAAAAAAAAIsA AAABAAAAAAAZAAAAAAAAAAAAqwAAAAEAAAAAACIAAAAAAAAAAACWAAAAAQAAAAAAIwAAAAAAAAAA AHcAAAABAAAAAAAcAAAAAAAAAAAAFQEAAAEAAAAAAAEAAAAAALIAAAABABMgAAAAAAD/QwAAAAEA AgABABAAHAAAAAAAAgAOADUAAAABBAIAAQQQAIsAAAAABAIAAAQOABkAAAABCAIAAQgQAKsAAAAA DGIAAAwCAAAADgAiAAAAARACAAEQEACWAAAAABACAAAQDgAjAAAAARQCAAEUEAB3AAAAABQCAAAU DgAcAAAAARgCAAEYEAAVAQAAABgCAAAYDgABAAAAABgCAAAYDgAAAKoPLgAAADgBAAAAAAAAqwAA AAYAAAAJBAQIoQEAAAAAAAAIAAAAAQAAAAEA2wAAAAAAAAAvAPAPcAAAAAAA8wMUAAAAbwYAAAAA AAAAAAAANAEAAAAAAAAAAPMDFAAAAHsGAAAAAAAAAAAAADwBAAAAAAAAAADzAxQAAACLBgAAAAAA AAAAAAA+AQAAAAAAAAAA8wMUAAAAnwYAAAAAAAAAAAAASAEAAAAAAAAAAOoDAAAAAA8A+APcCgAA AgDvAxgAAAABAAAAAQIHCQgAAAAAAAAAAAAAAAAAEwBgAPAHIAAAAP///wAAAAAAgICAAAAAAAC7 4OMAMzOZAACZmQCZzAAAYADwByAAAAD///8AAAAAAJaWlgAAAAAA+99TAP+ZZgDMMwAAmWYAAGAA 8AcgAAAA////AAAAAACAgIAAAAAAAJnM/wDMzP8AMzPMAK9n/wBgAPAHIAAAAN728QAAAAAAlpaW AAAAAAD///8Ajcb/AABmzAAAqAAAYADwByAAAAD//9kAAAAAAHd3dwAAAAAA///3ADPMzAD/UFAA /5kAAGAA8AcgAAAAAICAAP///wAAWlgA//+ZAABkYgBtb8cAAP//AAD/AABgAPAHIAAAAIAAAAD/ //8AXB8AAN/SkwDMMwAAvnlgAP//mQDTohkAYADwByAAAAAAAJkA////AAAzZgDM//8AM2bMAACw AABmzP8A/+cBAGAA8AcgAAAAAAAAAP///wAzZpkA4+vxAAAzmQBGiksAZsz/APDlAABgAPAHIAAA AGhrXQD///8Ad3d3ANHRywCQkIIAgJ6oAP/MZgDp3LkAYADwByAAAABmZpkA////AD4+XAD///8A YFl7AGZm/wCZzP8A//+ZAGAA8AcgAAAAUj4mAP///wAtIBUA38CNAIx7cACPXy8AzLQAAIyeoAAA AKMPPgAAAAEA//0/AAAAIiAAAGQAAAAA/wAAZAAAAAAAAAAAAEACAAAAAAcAAAD//+8AAQAAAP// /////xgAAH67/gAAEACjD4QAAAAFAP/9PwADAPwAAQBkAAAAAAAAAGQAFAAAANgAAABAAgAAAAAH AAAA///vAAAAAAD///////8YAAAAAAEAALIFAAABABMgAAAAAAD/1AEgAQAAAgAUAIAFAAAiINAC QAIAAAIAEgCABQAAEyDwA2ADAAACABAAgAUAALsAEAWABAAAAAAgAKMPbgAAAAUA//0/AAAAIiAA AGQAAAAA/wAAZAAeAAAAAAAAAEACAAAAAAcAAAD//+8AAAAAAP///////wwAAAAAAQAAAAUAACAB IAEAAAAAAAUAAEACQAIAAAAAAAUAAGADYAMAAAAAAAUAAIAEgAQAAAAAUACjD1oAAAAFAAAAAQkA AAIAAQAAAAEABgABABQAAAAAAAEAAQkAAAAAAQAgAQAAAAACAAEJAAAAAAEAQAIAAAAAAwABCQAA AAABAGADAAAAAAQAAQkAAAAAAQCABAAAAABgAKMPDgAAAAEAAAAACAAAAQAAAAAAcACjDz4AAAAF AAAAAAAAAAAAAgAUAAEAAAAAAAAAAgASAAIAAAAAAAAAAgAQAAMAAAAAAAAAAgAOAAQAAAAAAAAA AgAOAIAAow8+AAAABQAAAAAAAAAAAAIAEgABAAAAAAAAAAIAEAACAAAAAAAAAAIADgADAAAAAAAA AAIADAAEAAAAAAAAAAIADAAPAAwE/AUAAA8AAvD0BQAAEAAI8AgAAAAIAAAAOQQAAA8AA/CSBQAA DwAE8CgAAAABAAnwEAAAAAAAAAAAAAAAAAAAAAAAAAACAArwCAAAAAAEAAAFAAAADwAE8GAAAAAS AArwCAAAADEEAAAACgAAcwAL8CoAAACFAAIAAACHAAEAAACBAUBAQAC/ARAAEADAAQEAAAj/AQgA CAABAgIAAAgTACLxBgAAAL8DAAQABAAAEPAIAAAAAAAAAIAW4BAPAATwbAAAACIACvAIAAAANAQA AAAKAACTAAvwNgAAAH8AAAAEAIUAAgAAAIcAAQAAAEcBvwUAAIEBAAAACL8BEAAQAMABAQAACP8B AAAIAAECAgAACBMAIvEGAAAAvwMABAAEAAAQ8AgAAABIAAAAgBaLDw8ABPDkAAAAEgAK8AgAAAAO BAAAAAoAAIMAC/AwAAAAfwABAAUAgACYYIoHgQEEAAAIgwEAAAAIvwEBABEAwAEBAAAI/wEBAAkA AQICAAAIEwAi8QYAAAC/AwAAAAQAABDwCAAAANwP/P/gAQgRDwAR8BAAAAAAAMMLCAAAAAQAAAAI AooHDwAN8F4AAAAAAJ8PBAAAAAQAAAAAAKAPAgAAACoAAAChDxoAAAACAAAAAAAACAAAAQACAAAA AAAGAA4AAAAAAAAA2A8EAAAAAAAAAAAAqg8SAAAAAQAAAAEAAAAAAAEAAAAAAAAADwAE8JYAAAAS AArwCAAAAA8EAAAQCgAAswAL8EwAAAALATYEAAA/AQAAAQCBAQQAAAiDAQAAAAi/AQAAEADAAQEA AAj/AQAACAABAgIAAAg/AgAAAgCAwwoAAAC/AwIAAgBCAGEAcwBlAAAAEwAi8QYAAAC/AwAEAAQA ABDwCAAAAHADwAPAEnANDwAR8AwAAAAAAMELBAAAADYEAAAPAATwcAEAABIACvAIAAAAJQQAAAAK AAAjAQvwlgAAAH8AAQAFAIAAgGSKB4EAAAAAAIIAAAAAAIMAAAAAAIQAAAAAAIcAAQAAAL8AAAAP AD8BAAAGAIEBBAAACIMBAAAACL8BDQAfAMABAQAACP8BBwAPAAECAgAACD8CAAADAH8DAAAPAIDD KgAAAFQAaQB0AGwAZQAgAC0AIABTAGwAaQBkAGUAIABNAGEAcwB0AGUAcgAAAJMAIvE2AAAAPwEA AEAAvwEAAGAA/wEAAMABvwMAggCGfwUGAE4AvwUGAE4A/wUGAE4APwYGAE4AfwYGAA4AAAAQ8AgA AABuAFABUBVGAg8AEfAQAAAAAADDCwgAAAAAAAAAAQCKBw8ADfBUAAAAAACfDwQAAAAAAAAAAACo DyAAAABDbGljayB0byBlZGl0IE1hc3RlciB0aXRsZSBzdHlsZQAAog8GAAAAIQAAAAAAAACqDwoA AAAhAAAAAQAAAAAADwAE8FAAAACyBArwCAAAADUEAAAACgAAQwAL8BoAAAB/AIAAgAAEQQUAAAAF wQIAAAAGAQEAAAAAABMAIvEGAAAAvwMABAAEAAAQ8AgAAACTD3IUsBXREA8ABPAkAQAAEgAK8AgA AAA5BAAAAAoAAIMAC/AwAAAAfwABAAUAgAC4ZooHgQEEAAAIgwEAAAAIvwEBABEAwAEBAAAI/wEB AAkAAQICAAAIEwAi8QYAAAC/AwAAAAQAABDwCAAAAO8CTQFIFRMPDwAR8BAAAAAAAMMLCAAAAAEA AAACAIoHDwAN8J4AAAAAAJ8PBAAAAAEAAAAAAKgPUgAAAENsaWNrIHRvIGVkaXQgTWFzdGVyIHRl eHQgc3R5bGVzDVNlY29uZCBsZXZlbA1UaGlyZCBsZXZlbA1Gb3VydGggbGV2ZWwNRmlmdGggbGV2 ZWwAAKIPHgAAACEAAAAAAA0AAAABAAwAAAACAA0AAAADAAwAAAAEAAAAqg8KAAAAUwAAAAEAAAAA AA8ABPBCAAAAEgAK8AgAAAABBAAAAAwAAHMAC/AqAAAAgQEAAAAIkwGOn4sAlAHevWgAvwESABIA /wEAAAgABAMJAAAAPwMBAAEAEADwByAAAAD///8AAAAAAICAgAAAAAAAu+DjADMzmQAAmZkAmcwA AA8AiBM4AAAADwCKEzAAAAAAALoPEAAAAF8AXwBfAFAAUABUADEAMAAAAIsTEAAAAAAA6y4IAAAA UZnBAYDKr+ggALoPHAAAAEQAZQBmAGEAdQBsAHQAIABEAGUAcwBpAGcAbgAPAO4DLwQAAAIA7wMY AAAAAgAAAAMEBwkIAAAAAAAAgAAAAAAAABMADwAMBJ8DAAAPAALwlwMAACAACPAIAAAABgAAABTo AAAPAAPwNQMAAA8ABPAoAAAAAQAJ8BAAAAAAAAAAAAAAAAAAAAAAAAAAAgAK8AgAAAAA6AAABQAA AA8ABPBgAAAAEgAK8AgAAAAP6AAAAAoAAHMAC/AqAAAAhQACAAAAhwABAAAAgQFAQEAAvwEQABAA wAEBAAAI/wEAAAgAAQICAAAIEwAi8QYAAAC/AwAEAAQAABDwCAAAAAAAAACEFuAQDwAE8GwAAAAi AArwCAAAABLoAAAACgAAkwAL8DYAAAB/AAAABACFAAIAAACHAAEAAABHAb8FAACBAQAAAAi/ARAA EADAAQEAAAj/AQAACAABAgIAAAgTACLxBgAAAL8DAAQABAAAEPAIAAAASAAAAIAWUA0PAATw3QAA ABIACvAIAAAABOgAAAAKAACDAAvwMAAAAH8AAQAFAIAAPHzOB4EBBAAACIMBAAAACL8BAQARAMAB AQAACP8BAQAJAAECAgAACBMAIvEGAAAAvwMAAAAEAAAQ8AgAAAB/DWADIBNnDw8AEfAQAAAAAADD CwgAAAABAAAABADOBw8ADfBXAAAAAACfDwQAAAAFAAAAAACoDyMAAABDbGljayB0byBlZGl0IE1h c3RlciBzdWJ0aXRsZSBzdHlsZQAAog8GAAAAJAAAAAAAAACqDwoAAAAkAAAAAQAAAAAADwAE8FAA AACyBArwCAAAABPoAAAACgAAQwAL8BoAAAB/AIAAgAAEQQUAAAAFwQIAAAAGAQEAAAAAABMAIvEG AAAAvwMABAAEAAAQ8AgAAADuDkMKJgzREA8ABPDkAAAAEgAK8AgAAAAU6AAAAAoAAIMAC/AwAAAA fwABAAUAgACwwYoHgQEEAAAIgwEAAAAIvwEBABEAwAEBAAAI/wEBAAkAAQICAAAIEwAi8QYAAAC/ AwAAAAQAABDwCAAAANwP/P/gAQgRDwAR8BAAAAAAAMMLCAAAAAQAAAAIAs4HDwAN8F4AAAAAAJ8P BAAAAAQAAAAAAKAPAgAAACoAAAChDxoAAAACAAAAAAAACAAAAQACAAAAAAAGAA4AAAAAAAAA2A8E AAAAAAAAAAAAqg8SAAAAAQAAAAEAAAAAAAEAAAAAAAAADwAE8EIAAAASAArwCAAAAAHoAAAADAAA cwAL8CoAAACBAQAAAAiTAY6fiwCUAd69aAC/ARIAEgD/AQAACAAEAwkAAAA/AwEAAQAQAPAHIAAA AP///wAAAAAAgICAAAAAAAC74OMAMzOZAACZmQCZzAAADwCIEzgAAAAPAIoTMAAAAAAAug8QAAAA XwBfAF8AUABQAFQAMQAwAAAAixMQAAAAAADrLggAAABRmcEBgMqv6A8A8AMoBwAAAQDxAwgAAAAA AACAAAAKMA8ADASoBgAADwAC8KAGAABwAAjwCAAAAAcAAAAHEAAADwAD8DgGAAAPAATwKAAAAAEA CfAQAAAAAAAAAAAAAAAAAAAAAAAAAAIACvAIAAAAABAAAAUAAAAPAATwDAEAABIACvAIAAAAAhAA AAAKAADTAAvwTgAAAH8AAQAFAIAAnLHOB4EA+WsBAIIA/bUAAIMA+WsBAIQA/bUAAL8AEAAfAIEB BAAACIMBAAAACL8BAQARAMABAQAACP8BAQAJAAECAgAACAAAEPAIAAAAAAAAAHoHJQEPABHwEAAA AAAAwwsIAAAAAAAAAAoCzgcPAA3wdgAAAAAAnw8EAAAABAAAAAAAoA8CAAAAKgAAAKEPFAAAAAIA AAAAAAAAAAACAAAAAAACAAwAAAD5DwQAAAAAAAAAAACqDxIAAAABAAAAAQAAAAAAAQAAAAAAAAAA AKYPFgAAAPEeAABLAiUBJQFLAksCcANwA5YElgQPAATwDgEAABIACvAIAAAAAxAAAAAKAADTAAvw TgAAAH8AAQAFAIAA0LvOB4EA+WsBAIIA/bUAAIMA+WsBAIQA/bUAAL8AEAAfAIEBBAAACIMBAAAA CL8BAQARAMABAQAACP8BAQAJAAECAgAACAAAEPAIAAAAAADFCT8RJQEPABHwEAAAAAAAwwsIAAAA AQAAAAcAzgcPAA3weAAAAAAAnw8EAAAABAAAAAAAoA8CAAAAKgAAAKEPFgAAAAIAAAAAAAAIAAAC AAIAAAAAAAIADAAAAPgPBAAAAAAAAAAAAKoPEgAAAAEAAAABAAAAAAABAAAAAAAAAAAApg8WAAAA 8R4AAEsCJQElAUsCSwJwA3ADlgSWBA8ABPBkAAAAEgAK8AgAAAAEEAAAAAoAAGMAC/AkAAAAfwAE AQQBhwABAAAAfwEAAAEAvwERABEA/wEIAAkAPwIBAAEAAAAQ8AgAAAC3AegCWA5LCg8AEfAQAAAA AADDCwgAAAACAAAABQDOBw8ABPA0AQAAEgAK8AgAAAAFEAAAAAoAANMAC/BOAAAAfwABAAUAgADg xc4HgQD5awEAggD9tQAAgwD5awEAhAD9tQAAvwAQAB8AgQEEAAAIgwEAAAAIvwEBABEAwAEBAAAI /wEBAAkAAQICAAAIAAAQ8AgAAADeCroBhg8pFQ8AEfAQAAAAAADDCwgAAAADAAAABgLOBw8ADfCe AAAAAACfDwQAAAACAAAAAACoD1IAAABDbGljayB0byBlZGl0IE1hc3RlciB0ZXh0IHN0eWxlcw1T ZWNvbmQgbGV2ZWwNVGhpcmQgbGV2ZWwNRm91cnRoIGxldmVsDUZpZnRoIGxldmVsAACiDx4AAAAh AAAAAAANAAAAAQAMAAAAAgANAAAAAwAMAAAABAAAAKoPCgAAAFMAAAABAAAAAAAPAATwEgEAABIA CvAIAAAABhAAAAAKAADjAAvwVAAAAH8AAQAFAIAAmMrOB4EA+WsBAIIA/bUAAIMA+WsBAIQA/bUA AIcAAgAAAL8AEAAfAIEBBAAACIMBAAAACL8BAQARAMABAQAACP8BAQAJAAECAgAACAAAEPAIAAAA uhUAAHoH3xYPABHwEAAAAAAAwwsIAAAABAAAAAkCzgcPAA3wdgAAAAAAnw8EAAAABAAAAAAAoA8C AAAAKgAAAKEPFAAAAAIAAAAAAAAAAAACAAAAAAACAAwAAAD6DwQAAAAAAAAAAACqDxIAAAABAAAA AQAAAAAAAQAAAAAAAAAAAKYPFgAAAPEeAABLAiUBJQFLAksCcANwA5YElgQPAATwFAEAABIACvAI AAAABxAAAAAKAADjAAvwVAAAAH8AAQAFAIAA3NTOB4EA+WsBAIIA/bUAAIMA+WsBAIQA/bUAAIcA AgAAAL8AEAAfAIEBBAAACIMBAAAACL8BAQARAMABAQAACP8BAQAJAAECAgAACAAAEPAIAAAAuhXF CT8R3xYPABHwEAAAAAAAwwsIAAAABQAAAAgCzgcPAA3weAAAAAAAnw8EAAAABAAAAAAAoA8CAAAA KgAAAKEPFgAAAAIAAAAAAAAIAAACAAIAAAAAAAIADAAAANgPBAAAAAAAAAAAAKoPEgAAAAEAAAAB AAAAAAABAAAAAAAAAAAApg8WAAAA8R4AAEsCJQElAUsCSwJwA3ADlgSWBA8ABPBIAAAAEgAK8AgA AAABEAAAAAwAAIMAC/AwAAAAgQEAAAAIgwEFAAAIkwEuEWsAlAHe8o0AvwESABIA/wEAAAgABAMJ AAAAPwMBAAEAEADwByAAAAD///8AAAAAAICAgAAAAAAAu+DjADMzmQAAmZkAmcwAAA8AiBM4AAAA DwCKEzAAAAAAALoPEAAAAF8AXwBfAFAAUABUADEAMAAAAIsTEAAAAAAA6y4IAAAAUpnBAeCEhwUP AMkPgAQAAA8ADAQQBAAADwAC8AgEAABgAAjwCAAAAAUAAAAFiAMADwAD8KADAAAPAATwKAAAAAEA CfAQAAAAAAAAAAAAAAAAAAAAAAAAAAIACvAIAAAAAIgDAAUAAAAPAATw0AAAABIACvAIAAAAAogD AAAKAACDAAvwMAAAAH8AAQAFAIAA7MHjB4EBBAAACIMBAAAACL8BAQARAMABAQAACP8BAQAJAAEC AgAACAAAEPAIAAAAAAAAAHoHJQEPABHwEAAAAAAAwwsIAAAAAAAAAAoC4wcPAA3wWAAAAAAAnw8E AAAABAAAAAAAoA8CAAAAKgAAAKEPFAAAAAIAAAAAAAAAAAACAAAAAAACAAwAAAD5DwQAAAAAAAAA AACqDxIAAAABAAAAAQAAAAAAAQAAAAAAAAAPAATw0gAAABIACvAIAAAAA4gDAAAKAACDAAvwMAAA AH8AAQAFAIAALMzjB4EBBAAACIMBAAAACL8BAQARAMABAQAACP8BAQAJAAECAgAACAAAEPAIAAAA AADFCT8RJQEPABHwEAAAAAAAwwsIAAAAAQAAAAcC4wcPAA3wWgAAAAAAnw8EAAAABAAAAAAAoA8C AAAAKgAAAKEPFgAAAAIAAAAAAAAIAAACAAIAAAAAAAIADAAAAPgPBAAAAAAAAAAAAKoPEgAAAAEA AAABAAAAAAABAAAAAAAAAA8ABPDWAAAAEgAK8AgAAAAEiAMAAAoAAJMAC/A2AAAAfwABAAUAgAB4 tuMHhwACAAAAgQEEAAAIgwEAAAAIvwEBABEAwAEBAAAI/wEBAAkAAQICAAAIAAAQ8AgAAAC6FQAA egffFg8AEfAQAAAAAADDCwgAAAACAAAACQLjBw8ADfBYAAAAAACfDwQAAAAEAAAAAACgDwIAAAAq AAAAoQ8UAAAAAgAAAAAAAAAAAAIAAAAAAAIADAAAAPoPBAAAAAAAAAAAAKoPEgAAAAEAAAABAAAA AAABAAAAAAAAAA8ABPDYAAAAEgAK8AgAAAAFiAMAAAoAAJMAC/A2AAAAfwABAAUAgACQVAAGhwAC AAAAgQEEAAAIgwEAAAAIvwEBABEAwAEBAAAI/wEBAAkAAQICAAAIAAAQ8AgAAAC6FcUJPxHfFg8A EfAQAAAAAADDCwgAAAADAAAACALjBw8ADfBaAAAAAACfDwQAAAAEAAAAAACgDwIAAAAqAAAAoQ8W AAAAAgAAAAAAAAgAAAIAAgAAAAAAAgAMAAAA2A8EAAAAAAAAAAAAqg8SAAAAAQAAAAEAAAAAAAEA AAAAAAAADwAE8EgAAAASAArwCAAAAAGIAwAADAAAgwAL8DAAAACBAQAAAAiDAQUAAAiTAS4RawCU Ad7yjQC/ARIAEgD/AQAACAAEAwkAAAA/AwEAAQAQAPAHIAAAAP///wAAAAAAgICAAAAAAAC74OMA MzOZAACZmQCZzAAADwCIEzgAAAAPAIoTMAAAAAAAug8QAAAAXwBfAF8AUABQAFQAMQAwAAAAixMQ AAAAAADrLggAAAAhXMMBUNSvGw8A7gOVAgAAAgDvAxgAAAAIAAAADQ4TAAAAAAAAAACAPgEAAAcA EwAPAAwErAEAAA8AAvCkAQAAUBAI8AgAAAADAAAAA7gaAA8AA/A8AQAADwAE8CgAAAABAAnwEAAA AAAAAAAAAAAAAAAAAAAAAAACAArwCAAAAAC4GgAFAAAADwAE8H4AAAASAArwCAAAAAK4GgAgAgAA cwAL8CoAAAAEAAAAAAB/AAAABACAAExSzge/AQAAAQD/AQAAAQABAyUEAACIAwAAAAAAABDwCAAA AG4AUAFQFUYCDwAR8BAAAAAAAMMLCAAAAAAAAAANAM4HDwAN8AwAAAAAAJ4PBAAAAAAAAAAPAATw fgAAABIACvAIAAAAA7gaACACAABzAAvwKgAAAAQAAAAAAH8AAAAEAIAADFDOB78BAAABAP8BAAAB AAEDOQQAAIgDAAAAAAAAEPAIAAAABwJNAf4VEw8PABHwEAAAAAAAwwsIAAAAAQAAAA4BzgcPAA3w DAAAAAAAng8EAAAAAQAAAA8ABPBIAAAAEgAK8AgAAAABuBoAAAwAAIMAC/AwAAAAgQEAAAAIgwEF AAAIkwGOn4sAlAHevWgAvwESABIA/wEAAAgABAMJAAAAPwMBAAEAEADwByAAAAD///8AAAAAAICA gAAAAAAAu+DjADMzmQAAmZkAmcwAAA8AiBORAAAADwCKE4kAAAAAALoPEAAAAF8AXwBfAFAAUABU ADEAMAAAAIsTaQAAAAAA6y4IAAAA7+jDAXDFWxwAAAArBAAAAAAAAAAfAETxPQAAAAAAJ/EgAAAA AAAAAAMAAAAAAAAAAAAAAAAAAAAAuRMA/////xIAAAAPAD3xDQAAAEABQvEFAAAAAQkAAAAPAAIr AAAAAA8A7gNPBQAAAgDvAxgAAAAKAAAADRMTEwAAAAAAAACAPAEAAAcAEwAPAAwEZgQAAA8AAvBe BAAAcA8I8AgAAAAGAAAACnwaAA8AA/D2AwAADwAE8CgAAAABAAnwEAAAAAAAAAAAAAAAAAAAAAAA AAACAArwCAAAAAB8GgAFAAAADwAE8H4AAAASAArwCAAAAAJ8GgAgAgAAcwAL8CoAAAAEAAAAAAB/ AAAABACAAFy/ige/AQAAAQD/AQAAAQABAyUEAACIAwAAAAAAABDwCAAAAG4AUAFQFUYCDwAR8BAA AAAAAMMLCAAAAAAAAAANAIoHDwAN8AwAAAAAAJ4PBAAAAAAAAAAPAATwIAIAABIACvAIAAAAA3wa AAAKAACjAAvwPAAAAH8AAAAFAIAAPCiJB4EAAAAAAIMAAAAAAIEBBAAACIMBAAAACL8BAAARAMAB AQAACP8BAAAJAAECAgAACBMAIvEGAAAAvwEAAGAAAAAQ8AgAAACTAlkBrAfWDg8ADfCmAQAAAACf DwQAAAABAAAAAACoD2IBAABFbmFibGVzIGluc3RpdHV0aW9ucyB0byBydW4gbXVsdGlwbGUgbGFu Z3VhZ2VzIG9uIHRoZSBzYW1lIHN5c3RlbS4gVG8gc3VwcG9ydCBjcm9zcy1ib3JkZXIgZWR1Y2F0 aW9uIGFzIHdlbGwgYXMgZm9yZWlnbiBsYW5ndWFnZSBjb3Vyc2VzLCBpbnN0cnVjdG9ycyBjYW4g c2V0IHRoZSBsYW5ndWFnZSBvZiB0aGUgY291cnNlIGluZGVwZW5kZW50bHkgZnJvbSB0aGUgbGFu Z3VhZ2Ugc2V0dGluZyBvZiB0aGUgb3ZlcmFsbCBzeXN0ZW0uIFRoZSBmdWxsIEJsYWNrYm9hcmQg QWNhZGVtaWMgU3VpdGUgbm93IHN1cHBvcnRzIG11bHRpLWJ5dGUgY2hhcmFjdGVyIHNldHMgaW5j bHVkaW5nIEphcGFuZXNlIGFuZCBDaGluZXNlLg0AAKEPGgAAAGMBAAAAAAEgAAACAAoAYwEAAAAE AgAABA4AAACmDwYAAAAIAAAAAAAPAATwUAAAALIECvAIAAAABHwaAAAKAABDAAvwGgAAAH8AgACA AARBMwAAAAXBAgAAAAYBAQAAAAAAEwAi8QYAAAC/AQAAYAAAABDwCAAAAJQOvgB3AzUPDwAE8FoA AACyBArwCAAAAAl8GgAACgAAQwAL8DIAAAB/AIAAgAAEQUsAAAAFwRoAAAAGAQEAAABKAHAAXwBD AG8AbgBuAGUAYwB0AF8AMQAAAAAAEPAIAAAAwQJhCW8SzwsPAATwVgAAALIECvAIAAAACnwaAAAK AABDAAvwLgAAAH8AgACAAARBTAAAAAXBFgAAAAYBAQAAAEoAcABfAEwAZQBhAHIAbgBfADIAAAAA ABDwCAAAANEFaQxHFa8ODwAE8EgAAAASAArwCAAAAAF8GgAADAAAgwAL8DAAAACBAQAAAAiDAQUA AAiTAY6fiwCUAd69aAC/ARIAEgD/AQAACAAEAwkAAAA/AwEAAQAQAPAHIAAAAP///wAAAAAAgICA AAAAAAC74OMAMzOZAACZmQCZzAAADwCIE5EAAAAPAIoTiQAAAAAAug8QAAAAXwBfAF8AUABQAFQA MQAwAAAAixNpAAAAAADrLggAAAB9asQBcPGJJQAAACsEAAAAAAAAAB8ARPE9AAAAAAAn8SAAAAAA AAAAAwAAAAAAAAAAAAAAAAAAAAC5EwD/////EgAAAA8APfENAAAAQAFC8QUAAAABCQAAAA8AAisA AAAADwDuA/sZAAACAO8DGAAAAAgAAAANExMAAAAAAAAAAIA0AQAABwATAA8ADAQSGQAADwAC8AoZ AABwDgjwCAAAAAUAAAAKLBoADwAD8KIYAAAPAATwKAAAAAEACfAQAAAAAAAAAAAAAAAAAAAAAAAA AAIACvAIAAAAACwaAAUAAAAPAATwpgcAABIACvAIAAAAAiwaACACAAATBgvwRgIAAAQAAAAAAH8A AAAEAIAA8DGJB4EAAAAAAIIAAAAAAIMAAAAAAIQAAAAAAIUAAAAAAIcAAQAAAIgAAAAAAIkAAAAA AL8AAAAPAAgBAAABAAkBAAAAAAwB9AAAEA0BAAAAIA4BAAAAID8BAAAGAIABAAAAAIEBBAAACIIB AAABAIMBAAAACIQBAAABAIUBAAAAIIZBAAAAAIfBAAAAAIgBAAAAAIkBAAAAAIoBAAAAAIsBAAAA AIwBAAAAAI0BAAAAAI4BAAAAAI8BAAAAAJABAAAAAJEBAAAAAJIBAAAAAJMBAAAAAJQBAAAAAJUB AAAAAJYBAAAAAJfBAAAAAJgBAAAAAJkBAAAAAJoBAAAAAJsBAAAAAJwBAwAAQL8BDAAfAMABAQAA CMEBAAABAMMBAAAAIMQBAAAAAMVBAAAAAMbBAAAAAMcBAAAAAMgBAAAAAMkBAAAAAMoBAAAAAMsB NSUAAMwBAAAIAM0BAAAAAM4BAAAAAM/BAAAAANcBAgAAAP8BBgAPAAACAAAAAAECAgAACAICy8vL AAMCAAAAIAQCAAABAAUCOGMAAAYCOGMAAAcCAAAAAAgCAAAAAAkCAAABAAoCAAAAAAsCAAAAAAwC AAABAA0CAAAAAA4CAAAAAA8CAAEAABACAAAAABECAAAAAD8CAAADAAEDJQQAAAQDAQAAAEEDqCkB AEIDAAAAAEMDAwAAAEQDfL4BAEUDAAAAAH8DAAAPAIQDfL4BAIUDAAAAAIYDfL4BAIcDAAAAAIgD AAAAAGMNIvEEBQAAGgH/////GwH/////HAH/////HQEAAAAgHsEAAAAAHwH/////PwEAAEAAngH/ ////nwH/////oAEAAAAgocEAAAAAogH/////owH/////pAEAAAAgpcEAAAAApgH/////pwH///// vwEAAGAA2QH/////2gH/////2wEAAAAg3MEAAAAA3QH/////3gH/////3wEAAAAg4MEAAAAA4QH/ ////4gH//////wEAAMABEgL/////EwL/////FAIAAAAgFcIAAAAAFgL/////FwL/////GAIAAAAg GcIAAAAAGgL/////GwL/////jwMAAAAAkAMCAAAAkQMAAAAAkgMCAAAAvwMAggCCQAUAAAAAQQUA AAEAQgX///8AQwUAAAAgRAUAAAAARUUAAAAARsUAAAAARwUAAAAASAUAAAAASQUAAAAASgUAAAAA SwU1JQAATAUAAAgATQUAAAAATgUAAAAAT8UAAAAAUAUAAAAAUQUAAAAAUgUBAAAAUwUBAAAAVAUB AAAAVQUBAAAAVwUCAAAAWQX/////WgX/////WwUAAAAgXMUAAAAAXQX/////XgX/////XwUAAAAg YMUAAAAAYQX/////YgX/////fwUGAE4AgAUAAAAAgQUAAAEAggX///8AgwUAAAAghAUAAAAAhUUA AAAAhsUAAAAAhwUAAAAAiAUAAAAAiQUAAAAAigUAAAAAiwU1JQAAjAUAAAgAjQUAAAAAjgUAAAAA j8UAAAAAkAUAAAAAkQUAAAAAkgUBAAAAkwUBAAAAlAUBAAAAlQUBAAAAlwUCAAAAmQX/////mgX/ ////mwUAAAAgnMUAAAAAnQX/////ngX/////nwUAAAAgoMUAAAAAoQX/////ogX/////vwUGAE4A wAUAAAAAwQUAAAEAwgX///8AwwUAAAAgxAUAAAAAxUUAAAAAxsUAAAAAxwUAAAAAyAUAAAAAyQUA AAAAygUAAAAAywU1JQAAzAUAAAgAzQUAAAAAzgUAAAAAz8UAAAAA0AUAAAAA0QUAAAAA0gUBAAAA 0wUBAAAA1AUBAAAA1QUBAAAA1wUCAAAA2QX/////2gX/////2wUAAAAg3MUAAAAA3QX/////3gX/ ////3wUAAAAg4MUAAAAA4QX/////4gX//////wUGAE4AAAYAAAAAAQYAAAEAAgb///8AAwYAAAAg BAYAAAAABUYAAAAABsYAAAAABwYAAAAACAYAAAAACQYAAAAACgYAAAAACwY1JQAADAYAAAgADQYA AAAADgYAAAAAD8YAAAAAEAYAAAAAEQYAAAAAEgYBAAAAEwYBAAAAFAYBAAAAFQYBAAAAFwYCAAAA GQb/////Ggb/////GwYAAAAgHMYAAAAAHQb/////Hgb/////HwYAAAAgIMYAAAAAIQb/////Igb/ ////PwYGAE4AQAYAAAAAQQYAAAEAQgb///8AQwYAAAAgRAYAAAAARUYAAAAARsYAAAAARwYAAAAA SAYAAAAASQYAAAAASgYAAAAASwY1JQAATAYAAAgATQYAAAAATgYAAAAAT8YAAAAAUAYAAAAAUQYA AAAAUgYBAAAAUwYBAAAAVAYBAAAAVQYBAAAAVwYCAAAAWQb/////Wgb/////WwYAAAAgXMYAAAAA XQb/////Xgb/////XwYAAAAgYMYAAAAAYQb/////Ygb/////fwYGAA4AAAAQ8AgAAABuAFABUBVG Ag8AEfAQAAAAAADDCwgAAAAAAAAADQCKBw8ADfAMAAAAAACeDwQAAAAAAAAADwAE8EoBAAASAArw CAAAAAMsGgAACgAAowAL8DwAAAB/AAAABQCAAEg9iQeBAAAAAACDAAAAAACBAQQAAAiDAQAAAAi/ AQAAEQDAAQEAAAj/AQAACQABAgIAAAgTACLxBgAAAL8BAABgAAAAEPAIAAAAkAJaAUgH0w4PAA3w 0AAAAAAAnw8EAAAAAQAAAAAAqA+CAAAARW5hYmxlcyBpbnN0aXR1dGlvbnMgdG8gYWRkIG5ldyBM YW5ndWFnZSBQYWNrcyBvciBtb2RpZnkgZXhpc3RpbmcgTGFuZ3VhZ2UgUGFja3MgZm9yIHRoZWly IEJiIEFjYWRlbWljIFN1aXRlIGltcGxlbWVudGF0aW9ucy4NDQ0NDQAAoQ8kAAAAggAAAAAAASAA AAIACgABAAAAAAAAIAAACgCDAAAAAAACAA4AAACmDwYAAAAIAAAAAAAPAATwsgcAALIECvAIAAAA CSwaACAKAAAzBgvwZgIAAAQAAAAAAH8AhACFAIEAAAAAAIIAAAAAAIMAAAAAAIQAAAAAAIUAAAAA AIcAAgAAAIgAAAAAAIkAAAAAAL8AAAAPAARBSAAAAAXBFAAAAAYBAQAAAAgBAAABAAkBAAAAAAwB 9AAAEA0BAAAAIA4BAAAAID8BAAAGAIABAAAAAIEBBAAACIIBAAABAIMBAAAACIQBAAABAIUBAAAA IIZBAAAAAIfBAAAAAIgBAAAAAIkBAAAAAIoBAAAAAIsBAAAAAIwBAAAAAI0BAAAAAI4BAAAAAI8B AAAAAJABAAAAAJEBAAAAAJIBAAAAAJMBAAAAAJQBAAAAAJUBAAAAAJYBAAAAAJfBAAAAAJgBAAAA AJkBAAAAAJoBAAAAAJsBAAAAAJwBAwAAQL8BDAAfAMABAgAACMEBAAABAMMBAAAAIMQBAAAAAMVB AAAAAMbBAAAAAMcBAAAAAMgBAAAAAMkBAAAAAMoBAAAAAMsBNSUAAMwBAAAIAM0BAAAAAM4BAAAA AM/BAAAAANcBAgAAAP8BDgAPAAACAAAAAAECAgAACAICy8vLAAMCAAAAIAQCAAABAAUCOGMAAAYC OGMAAAcCAAAAAAgCAAAAAAkCAAABAAoCAAAAAAsCAAAAAAwCAAABAA0CAAAAAA4CAAAAAA8CAAEA ABACAAAAABECAAAAAD8CAAADAAEDOQQAAAQDAQAAAEEDqCkBAEIDAAAAAEMDAwAAAEQDfL4BAEUD AAAAAH8DAAAPAIQDfL4BAIUDAAAAAIYDfL4BAIcDAAAAAIgDAAAAAHUAbgB0AGkAdABsAGUAZAAy AAAAYw0i8QQFAAAaAf////8bAf////8cAf////8dAQAAACAewQAAAAAfAf////8/AQAAQACeAf// //+fAf////+gAQAAACChwQAAAACiAf////+jAf////+kAQAAACClwQAAAACmAf////+nAf////+/ AQAAYADZAf/////aAf/////bAQAAACDcwQAAAADdAf/////eAf/////fAQAAACDgwQAAAADhAf// ///iAf//////AQAAwAESAv////8TAv////8UAgAAACAVwgAAAAAWAv////8XAv////8YAgAAACAZ wgAAAAAaAv////8bAv////+PAwAAAACQAwIAAACRAwAAAACSAwIAAAC/AwCCAIJABQAAAABBBQAA AQBCBf///wBDBQAAACBEBQAAAABFRQAAAABGxQAAAABHBQAAAABIBQAAAABJBQAAAABKBQAAAABL BTUlAABMBQAACABNBQAAAABOBQAAAABPxQAAAABQBQAAAABRBQAAAABSBQEAAABTBQEAAABUBQEA AABVBQEAAABXBQIAAABZBf////9aBf////9bBQAAACBcxQAAAABdBf////9eBf////9fBQAAACBg xQAAAABhBf////9iBf////9/BQYATgCABQAAAACBBQAAAQCCBf///wCDBQAAACCEBQAAAACFRQAA AACGxQAAAACHBQAAAACIBQAAAACJBQAAAACKBQAAAACLBTUlAACMBQAACACNBQAAAACOBQAAAACP xQAAAACQBQAAAACRBQAAAACSBQEAAACTBQEAAACUBQEAAACVBQEAAACXBQIAAACZBf////+aBf// //+bBQAAACCcxQAAAACdBf////+eBf////+fBQAAACCgxQAAAAChBf////+iBf////+/BQYATgDA BQAAAADBBQAAAQDCBf///wDDBQAAACDEBQAAAADFRQAAAADGxQAAAADHBQAAAADIBQAAAADJBQAA AADKBQAAAADLBTUlAADMBQAACADNBQAAAADOBQAAAADPxQAAAADQBQAAAADRBQAAAADSBQEAAADT BQEAAADUBQEAAADVBQEAAADXBQIAAADZBf/////aBf/////bBQAAACDcxQAAAADdBf/////eBf// ///fBQAAACDgxQAAAADhBf/////iBf//////BQYATgAABgAAAAABBgAAAQACBv///wADBgAAACAE BgAAAAAFRgAAAAAGxgAAAAAHBgAAAAAIBgAAAAAJBgAAAAAKBgAAAAALBjUlAAAMBgAACAANBgAA AAAOBgAAAAAPxgAAAAAQBgAAAAARBgAAAAASBgEAAAATBgEAAAAUBgEAAAAVBgEAAAAXBgIAAAAZ Bv////8aBv////8bBgAAACAcxgAAAAAdBv////8eBv////8fBgAAACAgxgAAAAAhBv////8iBv// //8/BgYATgBABgAAAABBBgAAAQBCBv///wBDBgAAACBEBgAAAABFRgAAAABGxgAAAABHBgAAAABI BgAAAABJBgAAAABKBgAAAABLBjUlAABMBgAACABNBgAAAABOBgAAAABPxgAAAABQBgAAAABRBgAA AABSBgEAAABTBgEAAABUBgEAAABVBgEAAABXBgIAAABZBv////9aBv////9bBgAAACBcxgAAAABd Bv////9eBv////9fBgAAACBgxgAAAABhBv////9iBv////9/BgYADgAAABDwCAAAAFgCOgj8E1IJ DwAR8BAAAAAAAMMLCAAAAAIAAAATAYkHDwAE8LAHAACyBArwCAAAAAosGgAgCgAAMwYL8GQCAAAE AAAAAAB/AIQAhQCBAAAAAACCAAAAAACDAAAAAACEAAAAAACFAAAAAACHAAIAAACIAAAAAACJAAAA AAC/AAAADwAEQUkAAAAFwRIAAAAGAQEAAAAIAQAAAQAJAQAAAAAMAfQAABANAQAAACAOAQAAACA/ AQAABgCAAQAAAACBAQQAAAiCAQAAAQCDAQAAAAiEAQAAAQCFAQAAACCGQQAAAACHwQAAAACIAQAA AACJAQAAAACKAQAAAACLAQAAAACMAQAAAACNAQAAAACOAQAAAACPAQAAAACQAQAAAACRAQAAAACS AQAAAACTAQAAAACUAQAAAACVAQAAAACWAQAAAACXwQAAAACYAQAAAACZAQAAAACaAQAAAACbAQAA AACcAQMAAEC/AQwAHwDAAQIAAAjBAQAAAQDDAQAAACDEAQAAAADFQQAAAADGwQAAAADHAQAAAADI AQAAAADJAQAAAADKAQAAAADLATUlAADMAQAACADNAQAAAADOAQAAAADPwQAAAADXAQIAAAD/AQ4A DwAAAgAAAAABAgIAAAgCAsvLywADAgAAACAEAgAAAQAFAjhjAAAGAjhjAAAHAgAAAAAIAgAAAAAJ AgAAAQAKAgAAAAALAgAAAAAMAgAAAQANAgAAAAAOAgAAAAAPAgABAAAQAgAAAAARAgAAAAA/AgAA AwABAzkEAAAEAwEAAABBA6gpAQBCAwAAAABDAwMAAABEA3y+AQBFAwAAAAB/AwAADwCEA3y+AQCF AwAAAACGA3y+AQCHAwAAAACIAwAAAAB1AG4AdABpAHQAbABlAGQAAABjDSLxBAUAABoB/////xsB /////xwB/////x0BAAAAIB7BAAAAAB8B/////z8BAABAAJ4B/////58B/////6ABAAAAIKHBAAAA AKIB/////6MB/////6QBAAAAIKXBAAAAAKYB/////6cB/////78BAABgANkB/////9oB/////9sB AAAAINzBAAAAAN0B/////94B/////98BAAAAIODBAAAAAOEB/////+IB//////8BAADAARIC//// /xMC/////xQCAAAAIBXCAAAAABYC/////xcC/////xgCAAAAIBnCAAAAABoC/////xsC/////48D AAAAAJADAgAAAJEDAAAAAJIDAgAAAL8DAIIAgkAFAAAAAEEFAAABAEIF////AEMFAAAAIEQFAAAA AEVFAAAAAEbFAAAAAEcFAAAAAEgFAAAAAEkFAAAAAEoFAAAAAEsFNSUAAEwFAAAIAE0FAAAAAE4F AAAAAE/FAAAAAFAFAAAAAFEFAAAAAFIFAQAAAFMFAQAAAFQFAQAAAFUFAQAAAFcFAgAAAFkF//// /1oF/////1sFAAAAIFzFAAAAAF0F/////14F/////18FAAAAIGDFAAAAAGEF/////2IF/////38F BgBOAIAFAAAAAIEFAAABAIIF////AIMFAAAAIIQFAAAAAIVFAAAAAIbFAAAAAIcFAAAAAIgFAAAA AIkFAAAAAIoFAAAAAIsFNSUAAIwFAAAIAI0FAAAAAI4FAAAAAI/FAAAAAJAFAAAAAJEFAAAAAJIF AQAAAJMFAQAAAJQFAQAAAJUFAQAAAJcFAgAAAJkF/////5oF/////5sFAAAAIJzFAAAAAJ0F//// /54F/////58FAAAAIKDFAAAAAKEF/////6IF/////78FBgBOAMAFAAAAAMEFAAABAMIF////AMMF AAAAIMQFAAAAAMVFAAAAAMbFAAAAAMcFAAAAAMgFAAAAAMkFAAAAAMoFAAAAAMsFNSUAAMwFAAAI AM0FAAAAAM4FAAAAAM/FAAAAANAFAAAAANEFAAAAANIFAQAAANMFAQAAANQFAQAAANUFAQAAANcF AgAAANkF/////9oF/////9sFAAAAINzFAAAAAN0F/////94F/////98FAAAAIODFAAAAAOEF//// /+IF//////8FBgBOAAAGAAAAAAEGAAABAAIG////AAMGAAAAIAQGAAAAAAVGAAAAAAbGAAAAAAcG AAAAAAgGAAAAAAkGAAAAAAoGAAAAAAsGNSUAAAwGAAAIAA0GAAAAAA4GAAAAAA/GAAAAABAGAAAA ABEGAAAAABIGAQAAABMGAQAAABQGAQAAABUGAQAAABcGAgAAABkG/////xoG/////xsGAAAAIBzG AAAAAB0G/////x4G/////x8GAAAAICDGAAAAACEG/////yIG/////z8GBgBOAEAGAAAAAEEGAAAB AEIG////AEMGAAAAIEQGAAAAAEVGAAAAAEbGAAAAAEcGAAAAAEgGAAAAAEkGAAAAAEoGAAAAAEsG NSUAAEwGAAAIAE0GAAAAAE4GAAAAAE/GAAAAAFAGAAAAAFEGAAAAAFIGAQAAAFMGAQAAAFQGAQAA AFUGAQAAAFcGAgAAAFkG/////1oG/////1sGAAAAIFzGAAAAAF0G/////14G/////18GAAAAIGDG AAAAAGEG/////2IG/////38GBgAOAAAAEPAIAAAAsQlLBwEVJw4PABHwEAAAAAAAwwsIAAAAAQAA ABMBiQcPAATwSAAAABIACvAIAAAAASwaAAAMAACDAAvwMAAAAIEBAAAACIMBBQAACJMBjp+LAJQB 3r1oAL8BEgASAP8BAAAIAAQDCQAAAD8DAQABABAA8AcgAAAA////AAAAAACAgIAAAAAAALvg4wAz M5kAAJmZAJnMAAAPAIgTkQAAAA8AihOJAAAAAAC6DxAAAABfAF8AXwBQAFAAVAAxADAAAACLE2kA AAAAAOsuCAAAAH1qxAFw8YklAAAAKwQAAAAAAAAAHwBE8T0AAAAAACfxIAAAAAAAAAADAAAAAAAA AAAAAAAAAAAAALkTAP////8SAAAADwA98Q0AAABAAULxBQAAAAEJAAAADwACKwAAAAAPAO4DMAIA AAIA7wMYAAAAAQAAAA0OAAAAAAAAAAAAgEgBAAAHABMADwAMBKABAAAPAALwmAEAAJARCPAIAAAA AwAAAAMIGwAPAAPwMAEAAA8ABPAoAAAAAQAJ8BAAAAAAAAAAAAAAAAAAAAAAAAAAAgAK8AgAAAAA CBsABQAAAA8ABPB4AAAAEgAK8AgAAAACCBsAIAIAAGMAC/AkAAAAfwAAAAQAgADsSIkHvwEAAAEA /wEAAAEAAQMlBAAAiAMAAAAAAAAQ8AgAAABuAFABUBVGAg8AEfAQAAAAAADDCwgAAAAAAAAADQCJ Bw8ADfAMAAAAAACeDwQAAAAAAAAADwAE8HgAAAASAArwCAAAAAMIGwAgAgAAYwAL8CQAAAB/AAAA BACAAMBJiQe/AQAAAQD/AQAAAQABAzkEAACIAwAAAAAAABDwCAAAAGUCTQFIFRMPDwAR8BAAAAAA AMMLCAAAAAEAAAAOAIkHDwAN8AwAAAAAAJ4PBAAAAAEAAAAPAATwSAAAABIACvAIAAAAAQgbAAAM AACDAAvwMAAAAIEBAAAACIMBBQAACJMBjp+LAJQB3r1oAL8BEgASAP8BAAAIAAQDCQAAAD8DAQAB ABAA8AcgAAAA////AAAAAACAgIAAAAAAALvg4wAzM5kAAJmZAJnMAAAPAIgTOAAAAA8AihMwAAAA AAC6DxAAAABfAF8AXwBQAFAAVAAxADAAAACLExAAAAAAAOsuCAAAACjFxQGQqloBDwDwAxgCAAAB APEDCAAAAP4CAAAHAAowDwAMBJgBAAAPAALwkAEAAIAOCPAIAAAAAwAAAAMwGgAPAAPwKAEAAA8A BPAoAAAAAQAJ8BAAAAAAAAAAAAAAAAAAAAAAAAAAAgAK8AgAAAAAMBoABQAAAA8ABPBeAAAAEgAK 8AgAAAACMBoAIAIAAFMAC/AeAAAAfwAEAAQAvwEBAAEA/wEBAAEAAQMEEAAAiAMAAAAAAAAQ8AgA AAC3AegCWA5LCg8AEfAQAAAAAADDCwgAAAAAAAAACwCJBw8ABPCKAAAAEgAK8AgAAAADMBoAIAIA AGMAC/AkAAAAfwAAAAQAgAAcRokHvwEBAAEA/wEBAAEAAQMFEAAAiAMAAAAAAAAQ8AgAAADeCroB hg8pFQ8AEfAQAAAAAADDCwgAAAABAAAADACJBw8ADfAeAAAAAACfDwQAAAACAAAAAACqDwoAAAAB AAAAAQAAAAAADwAE8EgAAAASAArwCAAAAAEwGgAADAAAgwAL8DAAAACBAQAAAAiDAQUAAAiTAS4R awCUAd7yjQC/ARIAEgD/AQAACAAEAwkAAAA/AwEAAQAQAPAHIAAAAP///wAAAAAAgICAAAAAAAC7 4OMAMzOZAACZmQCZzAAADwCIEzgAAAAPAIoTMAAAAAAAug8QAAAAXwBfAF8AUABQAFQAMQAwAAAA ixMQAAAAAADrLggAAAApcMUBIBikdw8A8AMYAgAAAQDxAwgAAAAGAwAABwAKMA8ADASYAQAADwAC 8JABAACADwjwCAAAAAMAAAADgBoADwAD8CgBAAAPAATwKAAAAAEACfAQAAAAAAAAAAAAAAAAAAAA AAAAAAIACvAIAAAAAIAaAAUAAAAPAATwXgAAABIACvAIAAAAAoAaACACAABTAAvwHgAAAH8ABAAE AL8BAQABAP8BAQABAAEDBBAAAIgDAAAAAAAAEPAIAAAAtwHoAlgOSwoPABHwEAAAAAAAwwsIAAAA AAAAAAsAiQcPAATwigAAABIACvAIAAAAA4AaACACAABjAAvwJAAAAH8AAAAEAIAAgC6JB78BAQAB AP8BAQABAAEDBRAAAIgDAAAAAAAAEPAIAAAA3gq6AYYPKRUPABHwEAAAAAAAwwsIAAAAAQAAAAwA iQcPAA3wHgAAAAAAnw8EAAAAAgAAAAAAqg8KAAAAAQAAAAEAAAAAAA8ABPBIAAAAEgAK8AgAAAAB gBoAAAwAAIMAC/AwAAAAgQEAAAAIgwEFAAAIkwEuEWsAlAHe8o0AvwESABIA/wEAAAgABAMJAAAA PwMBAAEAEADwByAAAAD///8AAAAAAICAgAAAAAAAu+DjADMzmQAAmZkAmcwAAA8AiBM4AAAADwCK EzAAAAAAALoPEAAAAF8AXwBfAFAAUABUADEAMAAAAIsTEAAAAAAA6y4IAAAAKXDFAUAah3cPAPAD GAIAAAEA8QMIAAAACAMAAAcACjAPAAwEmAEAAA8AAvCQAQAAYBAI8AgAAAADAAAAA7waAA8AA/Ao AQAADwAE8CgAAAABAAnwEAAAAAAAAAAAAAAAAAAAAAAAAAACAArwCAAAAAC8GgAFAAAADwAE8F4A AAASAArwCAAAAAK8GgAgAgAAUwAL8B4AAAB/AAQABAC/AQEAAQD/AQEAAQABAwQQAACIAwAAAAAA ABDwCAAAALcB6AJYDksKDwAR8BAAAAAAAMMLCAAAAAAAAAALAIoHDwAE8IoAAAASAArwCAAAAAO8 GgAgAgAAYwAL8CQAAAB/AAAABACAAEQZiQe/AQEAAQD/AQEAAQABAwUQAACIAwAAAAAAABDwCAAA AN4KugGGDykVDwAR8BAAAAAAAMMLCAAAAAEAAAAMAIoHDwAN8B4AAAAAAJ8PBAAAAAIAAAAAAKoP CgAAAAEAAAABAAAAAAAPAATwSAAAABIACvAIAAAAAbwaAAAMAACDAAvwMAAAAIEBAAAACIMBBQAA CJMBLhFrAJQB3vKNAL8BEgASAP8BAAAIAAQDCQAAAD8DAQABABAA8AcgAAAA////AAAAAACAgIAA AAAAALvg4wAzM5kAAJmZAJnMAAAPAIgTOAAAAA8AihMwAAAAAAC6DxAAAABfAF8AXwBQAFAAVAAx ADAAAACLExAAAAAAAOsuCAAAAClwxQGgk4V3DwDwAyQCAAABAPEDCAAAABIDAAAHAAowDwAMBKQB AAAPAALwnAEAAKARCPAIAAAAAwAAAAMMGwAPAAPwNAEAAA8ABPAoAAAAAQAJ8BAAAAAAAAAAAAAA AAAAAAAAAAAAAgAK8AgAAAAADBsABQAAAA8ABPBkAAAAEgAK8AgAAAACDBsAIAIAAGMAC/AkAAAA BAAAAAAAfwAEAAQAvwEBAAEA/wEBAAEAAQMEEAAAiAMAAAAAAAAQ8AgAAAC3AegCWA5LCg8AEfAQ AAAAAADDCwgAAAAAAAAACwCJBw8ABPCQAAAAEgAK8AgAAAADDBsAIAIAAHMAC/AqAAAABAAAAAAA fwAAAAQAgABAWokHvwEBAAEA/wEBAAEAAQMFEAAAiAMAAAAAAAAQ8AgAAADeCroBhg8pFQ8AEfAQ AAAAAADDCwgAAAABAAAADACJBw8ADfAeAAAAAACfDwQAAAACAAAAAACqDwoAAAABAAAAAQAAAAAA DwAE8EgAAAASAArwCAAAAAEMGwAADAAAgwAL8DAAAACBAQAAAAiDAQUAAAiTAS4RawCUAd7yjQC/ ARIAEgD/AQAACAAEAwkAAAA/AwEAAQAQAPAHIAAAAP///wAAAAAAgICAAAAAAAC74OMAMzOZAACZ mQCZzAAADwCIEzgAAAAPAIoTMAAAAAAAug8QAAAAXwBfAF8AUABQAFQAMQAwAAAAixMQAAAAAADr LggAAADyxcUBUHBuGhAAERCzyAMAAGYEAHic7L0JPFTf/z9+Z7EbI9oV074JISlbUqkkiiJUBoPJ mNHMWCtp36U9kbSrVEorCe1FpZIoaSolJYY2lfifc++dcY3R8n6/P+/v+/d/NB5P9869557ldZ6v 11nmnNctuNNOtOt412eIzMcaoSCNTSqIIuGaAgBZ8kUT+04CaGxqaoKXKACqAGoA6gCnwM2mP5// 9Oc7QOP/dSb+fP7PPlMQHvgTIgxkDMIFRz4SKWsKfvjpCKwAMb5feabxF8P96ud30/+nP/8vp/9P 1j+0/5prF/olON1pt+wNcgg5N+A1MWzyN4deHjGXSLBNicEbFmeEjfiCdENByixE8LvZR7QQMgmm DduiXy3/adAulX2WpM9DwkHKfPSMjcqAgYwG574gT8HgDrzS9qc/nj71N9KnAbydREHPFRAXNJ1g hInKfjxIzx+kzkevCEGOeODKj9OHbTD5N9LvAGBEws4ldQfzL2kLIJTAd2UAFQTT1+8EaIBrdATt AiDtEFgHCKIN0B6PuyNAJ4DOAF0AugLoAHQD6A6gC6AHwADoAdAToBdAb4A+AH0B+qFlQ5ABAAMB BgHoAwwGMAAwhGUAGAJgDGACYAowFMAMYBiAOcBwgBEAFgCWAFYI7NsgiA3ASABbgFEAdgCjAcYA jAWwBxgHMB5gAoADwEQAR4BJAE4I5A6CTEagDiGgFhHEFWAqwDQANwB3gOkAHgCeAF4AMwBmAswC 8AZgAvgA+AL4AbAA/AECAAIB2ACzAYIAOADBAJAPPIAQgDkAfACoOZCnoQBhAOEAEQBQm6MA5gLM A5gPEA2wACAGgfyT5frv8dEcMO937Q9KPQXs3A7VfD6eNgPIT4Bq469+uv6F9LF8/3Of/5ftP9Rt aDugNYI2AFYLNM1E/Sf26aHt+pH+w/hk9f9P//K/+0GQT3QGXnezcta/uAbaJWXkAwX8V/T1DWRy ef7+kAe+4C8QWAAu0H9/1EJJ+AM5Ix0VSj/wCvnBrQeJBjqaG7cqI4P0vxyF9lVB5lohIF4cBeMS tAsrcC7G4RxLwXmZg/PyOs7NApyfxThHRThPX+PcE+Ocrcd5CiOHHFUmYe2TJgnjcmcSxmtlCpbn cirWPsG0nbiDBb58FovLcAnkhTdfH8Vh+gb58Jh8P8Z4ri+W3xtjqegxGs+/BtI8HqbgMiEej9BU 0fwheD7lHXU1sTzDctvy2UwOGqsdL5jty3BhcgUMRxc0fjc2N8APQIDmbjTLnxnKETJGswTsAC7a wDqyffk8Ac9fyHAO5Al5jDF+bCGPzzAxMMIuoC2wM5/nF+orZLiEhoTw+EIGY3xwCJ8XxgpmccFz HCYX1XVXnh8zcgNImsUSgiSXohfteUyOwNDJZzbLV8gOYwlQSeGPM+xCBUJeMIsPsixkC/yZIAiP i/JtTATLN1TIYri6ODKm8DgcXqgQ7T+MZoWxOLwQhh0TCJ/PcGYKAwVopY7nCoRMDodh6+vLC+UK mT5sDlsYicYFKoLPYgpYDBch098f5IzBQPsTMN7BTqFCUFNCFp/L5IDCh/oyYR4YoMQBfGYwGrUj z4/tHyktPLjlyxIIUOk5sCIZziy+P48fzOT6skBMfmwQA48vYPR3cB4/ALVzboGRjPEChmsgWwAF B+JgcoVLGWjfB4g/kMniMOwCQQa5qPAEAmYAi4HW3uRQlgBmR4Coa2Kc1sU5MJbHFQoYUwUsP5Qy FPyWJioiWLkMV1ZwCIcpZKH3SPh9KMIxwT4sPz+WH8Np4hiGC4sfxuILWgSC3HfhsP2A9NlCDksg JS346JMwHYOfkfgz+bhOF+IZKcX1EuqbAq5XkKcMUvM8EWpTbP3G8XynsMLYrHC7SF8Oa/xoaVKz xgQz2RyXUJQ3aGw09IlQYSCPj95Do+osc3E0WwAKHTmJGcxCk4RNzCwsBVDvrjweRwD1lesEKkuq 0zDNNO+Bx3Tx8iDgAV088mA+MzKYx/Ub6SNVbANfXrBU2I5MoTCQFc6YggVDpHGA623ZP3hftHRn 3RenQM3D64Gt65deYoTfUMXvu+Ny8sZlGYNg9b8JwWwatH2wbT2JYM9A2UNbJcIlVYVg9qgeaWm7 oH2TEBnwGjBPol3O6H0Yx0Qmn8lwYvGBUqDXYHoSe4/g12CehpiYSUlFMCO8cBbfmcfmCmEvGHJk 5PS6A+UKGF+8q5dUTY7PJcFzyZgPtZHkP/b8v2bPFwIsAlgMsARgKcAygOUI1havBFgFsBpgDcBa gFiAdQjWRq8H2ACwEeftZoAtAFsBtgHEA2wHSABIBNgBkASwE3IDYBfAboA9AHsB9gHsBziAYFw5 CHAI4DBAKpQzwFGAYwBpAMcBTgCkI5ienAI4DXAG4CzAOYAMgEyA8wBZABcAshGMg7kAFwEuAVwG uAJwFeAagnHzBsBNgDwEs4G3AG4D3EEwzt4FuAdwH8H08wFAEcBDBONyCcAjgMcIZjOfAJQBPEUw jsOJ9+cALwDKAV4CvAKoQDDuVwK8AXiLYPr+DqAaoAbBdKIWoA7gPcAHgI8AnwDg9AbUlS8AXwG+ ATQAfAdoBEAHCkBX4OQBGYACQIW2G9pxaP9JmG6pQHsFoAb1CuoYgAYAnYTpXDsALaiLAO0BOkB9 BOhEwnSxC0BXAB2AbgDdAXQB9EhYW9EDoCdAL4DeAH0A+gL0A+gPMABgIMAgEtYuDQYwADAkYXMY QwCMAUwATAGGApgBDAMwBxgOMALAAsASwArAGsAGYCSALcAoADuA0QBjAMYC2AOMAxgPMAHAAWAi gCPAJAAnAGeAyQBTAFwAXAGmAkwDcANwB5gO4AHgCeAFMANgJsAsAG8AJoAPgC+AHwALwB8gACAQ gA0wGyAIgAMQDMAF4AGEAMwB4AMIAIQAoQBhAOEAEQCRAFEAcwHmAcwHiAZYABADsBBgEcBigCUA SwGWASwHWAGwEmAVwGqANQBrAWIB1gHEAawH2ACwEWATwGaALQBbAbYBxANsB0gASATYAZAEsBMg GWAXwG6APQB7AfYB7Ac4AJACcBDgEMBhgFSAIwBHAY4BpAEcBzgBkA5wktQ8V3UGnJ8FOAeQAZAJ cB4gC+ACQDZADkAuwEWASwCXAa4AXAW4BnAd4AbATYA8gHyAWwC3Ae4AFADcBbgHcB+gEOABQBHA Q4BigBKARwCPAUoBngCUATwFEAE8A3gO8AKgHOAlwCuACoDXAJUAbwDeAlQBvAOoBqgBEAPUAtQB vAf4APAR4BPAZ4B6gC8AXwG+ATQAfIcyAmgCgA0kHXlN8bCBpqCSAufbYkBjKgLt1EjQOIg6Yn05 2CbBNhvqNnwMWg46okKdjXZ7VKnw3lAqjCuffhG9fYuujOABUVyid0akz6Jze/AD5+RgE6eJZNBh X90ZjDDhXDQPgbPRfggbPeeDb8Q7GXTY3jsiLoSrMLQBYoIYgbsj0btwVpkP7gjQ8apQJo6WsZuA Z41ahPjVkmjhHT+v/+dLMhjvzPj9h0tSR4EWwBC5Toc9PCPkHp2Kl4COPFAqR/N/hg5nGWxBHGyE ic6YcpEAdHZ04iktFOZROdT8dC3kJMCHTHUjiVTgtdU3aUaX07VQvmvicdmBtIPRvDNA+eAMiACc OaIzvr8Wl+IoBh6XG/oLQwBaUkm+ficuMqIIGLcXrckYtK8NZ3D2ofIAH2U4M46N3A7SVfFzMtBU 2C/fQ4fztgpI03c4992Tgdd1E35EPyNRPiuh8dagV7BZIi0JbRRgq83ASAN7+2TsCXjuTfGW/KSB xFBjqBiR1Kj13VFCicVw6h9RFIeAzFONqGhPAs58d5PWIfahEo6wp6ws5zrxqC7zXUPmOz7RLI1H FT92wI/XZcIPkPluIPNdNj+dZL5rynwfI/P9Bn5sJMvPv6rMdyWZ78PaCK+HH2XLP+Qn+VeVOUqu z8CPA2Wuq8h8t0SaywF/vZGMdrRkwkmOklGTAuE54vWfhW8rnOTo+JNwkhUtSjLf1/zkueEy4RV/ El4Sv2cb4UJl4pkoc5QNPws/9v7FfEjSV5P5/rN8y9avbDiJ3kjik9RfF/xIkwkneU7S6veSuS75 ro0f2+FHWT2UfJekJ1seZZnvsnyWpCOrH5Ln2orvZ/KQHNfKPP+r/LjfRjjJb+GSeE7gxwn4UcID yQOS56bhx2CZeGV5/7PyEPVpJ+F7x5+El5WfbD1I9HgmRf512Xhkj23ZMdnjrTael63ntuKXzbcs HyR6ZfiTfMByZSPyy3lR5vsVPB9wJkK2XVCS87xsOj/Kx+8cH+DHIvz4ED8WtxH+MX6UzAo/wY9l +PEpfhThx2cyz7/Aj+X48SV+fIUfK9pI9w1+fIsfq/DjO/xYjR+PKZHE9e1hX0hJLNWbFp/WP5z+ TlgfPKyiYtfZfOH+Jvcb+woy7HP3nS9sQr6rNPeyfzfe/0LYKXhYBYUE7fJD5zz5UeMVkb0pWkrj mpA4E6xs31X+O/n9E/ZP2D9h/4T9E/ZP2D9h/4T9E/ZP2D9h/4T9E/ZP2D9h/4T9E/ZP2P8/hG2e czRbPG0UQ/FgQe/JRXeUa2IPNyGTM7DVj2utsLCLETUxXH26kERFEGW41gdRXmYL72STNBFNJAcu A1O+gl5pIikjygiJDJ5XjkG61jLANRP/JuTLmT2If3wT4g/O80F+mtAj/MQjIxHdWvi7J3FnwWcE 0dRDxHRsp817SnsEyxO1uQgxCOHeDMI9En6PjhQomZDhb5vtqd3QOx2oMOxoeqYacnO7xXMq3xwe YfbpyFdKABqmkULBI0G+U+CmMLh5y49wlEzll+M/rUvyowqyPQ/dFKGFhCDfKJJw8CdryXcY60g1 mCVtKvbTJ5aGnww0T2ohc4Q0I7jkQDMqh1BqSRm1QBxNErFQ1Qm3oJj0EOUW8Y/C45UcyXga20Kw NFp/YPxKLeLogT/b41fjQPPYplgt8Ggkx7bEOvFLU1MqECtJVqxqLcWarAxrcYU2pCEdWaWN/eKa QYfMmoX+OYM/V2QIuvNvtTb2iyONisaXgwM5boaub7FBSvBlEY/omPDVESeZazTECiQkpg9BY8Jo WEWoA3fpvP1ONDz2E1EKHcpPdnmtmuzyWk38IQX8ISheF1aIkBXsw+IzjE30GcZGRiaSZOHaRiqe 7FqZZLFPMrpPxxXhAVkzkUikCwNbh8ICf0J8PUlfhiRVEp4q3BMouz2DwfNnyGSfNo4XzghnMcLZ HA6D6RvIZoWxGMJAloDFCECf5jU/3X+4EWM0MxIt5AAa3PiABWTyWQy2ZOuDpFyahHIJ5JYrBa1f 2TzKlgOu/f3hjhKanN0kNDk7SWjyN5HQWm8gof3C3hGa/H0jNBqC7KLD9eWp0nKSpP/J6Cpm7INJ aQCpmXSr2pBS959JQFZkcFkyYxTTN4jDC6DZhfL5gJmcSAZTyBhiZmREgxIfwRjD9YN0cPIV8iAt hxiBO3Z8tpDty5SKiIFtrhDQXHnC5qsChqmZ/EgCmSCLxkYMPvoYy4/WnN1QfhgrUkDIjYlRH4YA LQQbBJQbnWmLIFCwcEG6ilQ0+rjgmpcgYNs7sWvtpNcspNeIVSGJRx8/onFAMVLNpWdoHNDKKFtI z0jSM0kl9iJQfUkblQgXOcghasuqS6ZPIWM78zngbzA4hqKr5aCOs1FdZ6J3IsE1uJKOgZgiZuC/ HbrqTYiuVYMhGIgtum8PPg931wqAwRuFPgV32/pJn3ZCd+DzQI8C7rzVR60K3P0bRLAsDHTlmx+6 Io+P2qBQ9CkGul84BPzBdXvwO7aaj417E5CEZIFrriCsIziGoNcDwH8mEix9AiuTpCzMVjm3xe+7 gLjCwHEIbgG5uP8CGDoMLQELzacPWlIhEoimLT9WBhIOcorF64OGg94AuC1icAYpjkHTMgC5mATu RaDpMdGUmFIp+uP7qAVo6QVoCAaIGZ4LCTVlLjcfQnR3pRAvTzg4wv3WQWieoHwZ0tLBtZHGSB9p jLbIRPAHa9EZ5HMSOBsPcuyCTAXfXECLQEMkf1B14J6jQVJCJks55yG9RlQOityrgwhPw88saahD dKhGxJVU2FrTofgVBekVpvQZTHkGEpRndRvKg/b85OwNlNUeuM56FJAarFk/lHcsnGkT0TM/VEZw XztkoADlaSjBCwXGXgbK6ACU92wkirD7nQFkOQZ9jgk4gtVwIP4UXNkZBgBZj+mgRG+E0lw4gJoa jzOKgeYvEPV9wWpxrzU3Q9EwflKNCUZjFEhzHYLyo3m3PhfVOxoyGtUYFoiJhzJJiN4LALHD3LMI ecS0VvZuACpLPzQGNqodApzvfKk2B6NaiMmH1kL6JkDz4Epe+HwAmlMYJ5QRC+W5JB5nublnADvI koYWSHkM29ZqueyskWHjpFbcU2l1JVaGjcYENsa2wUa4Dkp+X0K2IYZ7nlxYQrhflsEEbVswk8sM gF9YESGgu4N1KECDxwvlM3zxplJAs+cz4SYwhi/slPDxFlhuw483q6CZFoRyhALaGNAJC2fx0Z4o iFYAEmGDdht0HWDvSsDw5/EZPH4Ak8uOQtNG21ToNMNYWrwO0uy7Sa8ZE+61vIMJrTehE7P0B+1f 656WGswAjKK9NGh7PKqeiKw04W6xMRxgBoDMQsC/EJ6Aje6fpQ0BpfUHsgENKqgWLpQezRS7JgCd Wl/Y+fajDTFisGF/DgqUEQL6sFyWHyoSIdy7G85iBdFk+/YCmFGsb+wD+rhcX04o3FvL5hJiEvgG svxCOSwa9oElgmOkRGmJiBxVkHt1j4xA+xBYuKwNgcJVjb+yxxkXcPPkQu82BQy38jnx2YA9Lbu6 djwQPaCUS6QADGIYrnwmmwtF7MbyYUU0f3UKYfHRBwUM+1C4wRjrPdKmgVqA0ZkZDGEQeAzF58ui ObIDJE9BFSHst6YRJAq1fqNc2W2SXj1Eh3uuJd25Zh33lZHuIAJd1/xAx+X38GWFBvfdobuTGbah oGSY5ASBoVAD/YGiQ/KhLKONZfMFQgYLDcv0AVxlhAeCPjkYQ2GqDrreQSwhA3ARSJILe8/wqi+H JwgFAyzsuXC2MFBqKvDOMW4LBKgtoGF5gTtGmULwnIDBBQM8nLnSsriyfAO5bGAcgNS5zGAWzTmQ x4XZ4HAEjDCBAQOLhWbP4fkAVgECQAMDNVY6zkGrBc5J9JWKzV8qFrbcqupLCAc/s2Uqpi+B9svb qBgG8vN9+bLdAmUybAywBtwXbQwlzSlswGEzykIbGDu0UW3d9DAQbQYDvSMkNJlYU8UETRsL7VhH oM2wL9qMShpEAdpxhG51fPAuHNZ1w7qyg0FXtnUeftyVh10ZrGMJw3LQPHLx7jiWrgCkwETzIem0 YB0F2BGIxMvClZMnYigBoZzNHU4/PK/N6bBxOWLdXyHaHYBxtlXu1uEkXS7JECEYHTiw0JIbIvJz 6ksod3MMLLTUsDvGRzsczV024h9kLdwkTcXIoQk7wDhHNSHzPNCNsERWmhNYuV4uK5PpcKuIG0g7 Eu1gCvCuHTYYGA/yLxkkMdE892WoILIchVsLnXGZ8FBeQQnYo12scHSQ0FwjLbt1EvdNGH+5oAsp RLtuGFsl3bMwtNaw2gpHGRYoHV7CAeBsnLtsNGZi/bfsbDan5gg6e05tdFh9cE3Chppcme6tJGYB rjFsvLRYh1KSEwE+6GrZ8ZUMjX42GGUi2MAwGE1DiOtUGN7p9UPlgXV5A9Cusis+XOSgw7sA6WAA k4ZQWm7J4HAUOMKtaxFobkMJsUsGHZKWF/eEhzKt2Sse1kWV9KSaGyutVldCpc9gfBxOaL7i2uAj 7LFh2+7g4BLTJjv0XICWo3kKEdNnrLySJlQyTSuZniVJl8TLsrYrBTpKY+DDmwDckV4AQhyoYDyU cI6Bc5ePSlH+wCkQH8w3M4WDx6KGD+thakHSAXM44QnsfiTKLmGL4Q024AhF7YhkCC9ARqB1z0Il xSVYXQc8dg7KP4wjkkEkpqVQv0PA1ZZMxMoiRHMgSX0cni6UuRvK0CA0Vji1IcS5GYrGqwau9WVI nguXTg0027YQgo1goLnlopaZhzRPwATjmhRGGNIKCUPN5tLTcObz8DuSKRVsOMjCXTNK7AYWExsd oEliaK5vGD8blW5QK9np43UHtbd5Wkmi8YOl7ZVEP0PwO1ip9X8pVcyahaD/sfSw4SVRHvKeY8rU AQOtWxgbB2/bsJacjdc8A5VRoPS82eqESqfpoNQMUAsAXfExCRbAHtMe9HwYek5C9w16oI4tJKGY uIZ3Rl0SIlT4O1F7TOvQcwVsMyDs2Ch3xq6rg3P1bqiLDBI4J6l3lloMbUILFibXYqTQ4dBY6pCo pZofokv81mDfDRExvTOp2SANlkYpDSK9Z0C4R5K5Z0i4R5a5N4Rwjypzz4RwT7axNiXcU5S5N5Rw T0nm3gjCPRWZexaEe6oy9ywJ99Sk52/Q6TM6Uk8xVkFnJiiSHdckspKKMkL8aCHeiFiJgaC/oaJX YmJi0GOm6AViYhKPIPHxSHw+0ircli1b0OO3py5IU7w/km8Cgvq3DieJLz6/CckHMDHJR44FNEnD lX2qbREffG7tVfCsfz7qiqU5vhL0fnh4OB7uM2KSn480OTuD9JvDgQSxtD3cwRHc8PNBgnnXEHTL clNzuBg8LS89BHl6byOa/wuR3ugz93d3aY4PicfiMwFlBEcTmK80mL0mpKmCRAiHxWfiH4+8eAvK BGQ3dpUDGk78sjndwKAZaDhYjrt385C4uEVITFIK0pTvj1SWnpOG8/fH0rW29kKP3tPnor+BQznC PErCTbHui94fzOiAPM1Zi6yZG4Ksm2WI5J8E48ukZBBiD90arX/ZHdikH+zAJuG/qcNBk38jtAt7 6EsQyT5uCtIAeCV52g+dNSmWE4vkl3lUPoCAJxTgQRsTV1MhuqObjHRDYhRgvgrI8HloduB3bYYY 3dlNBrHD75mIpkIMajMYP9xTrttGiSR5Ucfz8rt7yp1Bqq4I3jVC9Qp7FOafhF6B0WLxkaXfsTgp 0u9YvFTpdyxubxC3OtJyv1YIXm/NczZYSpLzzghZet5eOmNOBhpNJZzHyImlMyGW9oRYtAixaBJi 0QS2RJ3qQYU2hSyeQoVsUBYr47FqoNcpYjEFHqni/mg5VMSaSOsPGVFFn4ORw2dheLgX8QQVu64E 41aFXnHUxLDpWog+tQj9vxj9vwT9vxzNdTYWgy30M6tGgvt8oXcdUovVJtkkdcAIbJ1JE0kR0QA2 EMagSC7cBNIjMwSNTcpk96LGJhsyrKcFaCm0kZ618Ef3bApIfBnIE5ZrkGpMR5EmHWknxn7Oz1WD UuqHlwT6W9LCS0iGN1SbV8AsAPlSALURODyH2jJ/JKSdNH9wjhhbAdML5ACmAf3FeMN8oDLD8kED rM3pgFBgPjApX1Jr9rGRQ6UjNDE2+9yykYWdazsO2zeIIeQxWH5sIcORKRCy+AwhdMWHILvpsMw6 eHis3dVBJKyEJYRTrZISUtoooebgXyshQcaEsnlTGCTvDtp02bKRUOljZUsilI2El21Km2VjRcCJ 1EgOS0BzYfnyuH4MOInLobkGsvmS87G8UL4wUPKF7S85hzKB9qQHmgoNTU8dzQk8p6DnVKmsXFrI SkRgg0YbshK5/x1ZBdA3az7osFFTVlYwMWUyJisPgqwwLiTToQJA7wq70HlGXP+V4RkZZzncq15M 4M4hdBVJcx9MYj9gOUcRygmLAoUiAOWEKSxES7WRFLtzNbKJVJYVCPisBUJDL0DKCJUCjaANBVhP YFF+rRcC1+mYI9g6HWyhT9vrdDCZvDWAOYN+AWNuHnsNfcbAFV1wEgNOVMFuNuZ5nYV2sgNAJ5qO VFOsFJp7TqifYqq054RlDJQCWsUjuFXcB47OZMwqwppSfY1ZRTvqb1jF1/KtIvn1X7eK0FPQ/9oq Iki0HKuoRcZK8orADwqcgVCFc+lqYvjDj0QP/OgOClju/65tTFZIIxW0D1GWZxspiIMC1AlX9FvL pVWQe23bRsyASCxkDzw+TOt7IEStf0IoLRUvrazWt9dyUPjrWh+nAmyktogmz0JS8RK6EUooWQfW q60SCkJ95BSyd4tC9m5RyGUEcirj5NwDCgnX/FFtKSjxoGMnecRDpMs+MSOAFdUG7fjJL3CIRppq vnoxXZZggymtDa1KGyKv7/h3RP5jQ4uJ/F82tLCc/2lDS0fElP5KsAS1lGbDqWEEjWaKImY0kxWh AmNGE3bUlTQxo2mu+BtGU7PZaKoTuidkTYwJ94GEJhGYsK0HYALyJYgEbNj3U5Ap8HwJep4NItP7 JRNENH5RSn1I8syNKs6MsB8yQ7I8WVIq7D/k+Zdf4AWC7Ee5VQt6KQ7kPqQ+JAeyAzmEEkLZQt1C hTLRIHbZ2pDJyUH/rEyuqNi0ay0TElrLmEwifiiTtrQFSqX+H5EKHC5KzTQuFV8gld6oVKgkKmk5 GtsC1IJlk9qBEsMF6iqIDZmE3sHKeob0muyu4aAqW1aYYwW0rFSxKaEGFNqoAe8B/2QNlKlmkJbR B3SQzRU0aoo4K4mdaEy+/8VOtBZBdoq47F4A2bkSZLdmQduyk3SJfleCGR2gXj/tKM/iq/xNvf76 jzC4PUEySm1I5vqi/4VkoHa3lgzqjJ38d7X7V9rCn8tmHEJoKWEm1YlbURC0rApoe2nQLgi2l3Vr /8/ayymgvRQtWQ7kdoMegw4W1Kma+KBCGQ4q1JunWhRWUND2Mfl3plrAM5L2sYAgFzK4Lq+n5L7t 13pKv9MCuv+QD3+vBYTlukcoF6WNciUn/m65ftCK/a0+36+2YrBkRYSSUfGSyQ6eeu/6ncHTzywc jEflb9bbr1g4WLpiQukU2ihd3L6/Vjr5Vgq2gH+vx/6rVqqVHYLl+w/boR5el0jOhcd04OTHEXLz 5AdaFtzAgEzFwJ+glNB1Al8oRLsDp8PJDAe0fw/d5UL7BR1ri1Uw+4W+SaSQjNovS9Jv2K9CstR+ RRPkSQbXGeTmERBWIwvQMzDe2+KgkI323ZrQ/yQKnHpYgc9v/3yqgI73U7HxZpK0vmVzQflhLjiL ZXNBbZWLHw3nNeXkgiSPW4XkH3Dr18eE8Cc4yC/ILZRn+fHoz3XwZ7sTJ06g3FqPc2vlT7jFJnDL Z1ouaeQWL/guhUESSeoho2uxXaL90K2eCIIQlv3jn1NaiMQNMB2xqoX9xZGkUbWSn2AgyQZh1VJN 6U0gLSw/TUMaTYwKTlpIzk04OdG1lxoEctZjjWvv3yFnfXPjyidUCBlch7RwARWiSyDE6AxZQqC/ E/zCvD7tB4QkpkxpI+XOma0UgpDyj2bdNX6VhPU/MnD/9xMT42MukWLOlK2BXFn5A64gBK4k41yB bxQQqxG4IsS4YvQ7XBE2cyWCyBUhVmPNw0+sxgqvyuNKS+PxVxlDTJ/SRvop1+QxpmX6GG/i/h5v hP8eb/6K8eo79BIJmWII3Vn/74zXjwhJaoOQaTQCIcv/AiHL2yBkuXxCKD/8lwjZRvqlrdL/HxGy /A8hf0hIahuEdCYSMv8vEDK/DULmyyeE6at/iZBtpK9c8S8RMv8PIX9ISHIbhMwhEvL1XyDk6zYI +Vo+IfZ++ZcI2Ub6EV//JUK+/kPIH443FNoYb4wkjjeUqb8/3gDPyB1vgOvyev0MmrLiXx1vKCv+ 0nijjZRLNWRT/vXxRuuU5ZIQzo7+h8cbjmC8IVYbXfrT8QYi33h5E41XwV8wXgVtGK8C+cZjm548 rvyO8WqbMS2MVxvpcxjyGPM7xusXeVPwx3j9kJCKbbSmIURCFv4FQha2QcjCNgbAg/4lQraRfor+ v0TIwj+E/EsWsoBIyKq/QMiqNghZJZ8QqRb/EiHbSH+N3b9EyKo/hPwhIZXasJAxREIW/wVCFrdB yGL5hCgY9y8Rso30947/lwhZ/IeQFKMfEFKtDUIWEMcb+tTfJ6Q+VT4h9alyCXEy4F8iZBvprwj8 VUL+zbGH/n977DEFjD0Ynw34kDfrfrFl3Y/zBr4lOYfIm/4Yb8x+hzf9qfJ/tO1P/cHPpQXt/yX2 9JfPHv0OP2ePmCJGxH+XPf3/Pfb8FXNWPv8SSdN/Fnxt/f/OnC3/BVq2vcZA1scqglJ4EU5h+OJx hnozhakxWFvc+XcoHNNGWxwjvy3sHPu/I6830rzeHpZFslrVHE1/CbIUodrCewq5cE2OIrrTGeal HZoXFVDRbIKbuSH4q1wlhDZSROg56q1WmMdQfrrCXBd6Ev5b9FyIYPSMREO0Tc/pmDD+V3QUw9+c EMlSdQHammJL1f0oGKW8wFFE7N6JMUp9IP8GpcTNlHInUkqMUcoOiLozWqVU8AeXOEEykVAyoYuU f7LoGH7U8EXHXmSCvRPLXxOQc0d2uliBkEpbi4ghD9TxiWL4xveWi4iT6fCt8jRkMMJA/09FnUlg zgoCUZcHEo/B4bjLh5YuVqCDCz/c8YPEPyUMh7lB8EVj4qLhfKQOZGajLmQwF0m+KMkxFxhEL4ct U5e48pHnAETiR1PiygbLlwB35MDBXWvIz6UP6jIiCHWNE4CnPwp12IA5HWJIPRlCFxGRaAlk/ScS 70AHHBKnFJJyYrFC2Y6TuviQSGIS7tvQCS0pC3cx0+yKybmFB1QspvFyPKbaoZIIw11uMNEySjyU 8lF/pK3aNPF/e3nbONAjQh647YS6Dn1VSHR9FUHX1+DNB3SiKybq+gdM17v9TvPxoQ1d//DP6/oS QvyUD/J1PeQ51HViKr+r69i+eqKuy3rmaMWJD/99Tnj3d6yAnNhPsP+rCZzoi9t/XXDUJPaKGzBO nP4d+9/QBica/klOwG4EVaxLtP8N8jlxUlG2y/LrnMA6K2fl2H+46HNUKwdckVLnR/64xZfYSuho iNXC1gWibnb4eKsgcUIkbOGYiS91GPT7fmIFqI3FnpXvfAx7MgB1AcTBLbw8z7eSNNry2NuXYYCX DnMdxEHvSxxFsWV8NgfhrqNCcHdmTFxeWBqSNoYj9dPMQ+04p4WUoCNAzEFfs2s6ieQDUEmEom6j 5Fjwhv+2tjoAbdVkBaK9NUtqs7YuIWjreVxbT4KjEVFbqdgYduJv+aigytdWKvUft+AnidpKlf+L auK7X+2tubbSVpjKCm1LXOqmuNQ1ZKQ+HJU59p71VLqGRBzSD9R4VXJrjS9CNf5X/LtLfIa35RU9 GHfQKHHkF4w7PINhw6Vaj8Uu0Ye2vLtL+kY+UjdkLXs5zX1OojsuLLbmniOmnaNBWaBX80lId4ar 1A5IHJthmvezsjU7KWy2dBIXgZiDOSxPmOtAiStQPsIi+KxudmPX0uGgAarR0L0bCyG6piPaTFkn idBSQDmEEOwiUSKw5HAjBOQ49nKSjSifBiPNLytpZUOoP5rZ+L+3IROBDSnQzwqGNkRZodmGxBJs yAoqZkPgZixnog1Rx2xIZ+pv2BD1NmyI+j9pQ7AWH47XpTZEXb4NOdv577b4XSmt9V8RXBuO+lrH RjK+UmeVLTVVwmrIM8yZK+aQVfI2BWw0iL3lAHP7F9LCFSgWBtOZYEIa3BZPSu6HSh0qSvhtgI52 hNI2V+JukIWehQLbESjVgNlSSwQdVGLOIoWoVcCe7cZg464P5TlD7c6Q9CG6MSQuFyWtcfMYDBs9 dmfQEBXEHlgYW9R+QAe58hx7NvvxhyGIbiyJDmmJei5xwiqxKNhVLBfY+yACpa4hoTNIiZd8WdkK pKlh42rMZSUH7201OzSUzYnkqrxapQFbNQ5/b0TrcG3Xoawdw9zqjsGd3IajuWzOP5TsYNR+w7YD SovTwopy0HkESaiWo97mULw2RtMtWxy5fSr1/7Y9nATsYVr2uHxoD7cTRkDLCPawK96n0gJHb6I9 1MTs4aHfGQFptmEPNf95e6hF7FNpyreH5pZ/1x7CrW6y9tCPhOCzTq1HK8JWvGn5FpbmsCzUjmIO cvko57H37si+J4boCFzCfAO0h4C5uW5phbFeRescyPYOmGjKmD8kYl+p2WmyP6qZmONuoutjPqrh fDwtLq4xsm6dZdOD+eHgLlubncbCFJtHjpjL5+4MAd7fkbgxno/XvAYimY3Qw680uzEmTqe30FDN /7aGOgENjbv0sgZq6F7CqGc5QUN74z2WblToLIegoe0xDT35O6Oe9m1oaPt/XkO7EXss7eVrqPOM X9XQ1qMemMo/M+rhyxn1wJEQ7G93YWDtcwCu3djbl3iE/k/rGY9mfW9rBtoPbWOwGejm/nxgi359 JNI8gpDYDSE+q9HsIri53xCMWghsNCbReaHUZb1Es5vnvOW/16dZh6EHNcwKYK2jb4s5d6ZMbwRz Bs7FnX0z8RxgozyetI/DwyUoQF8DIEQwZ9tEF9vyHcJL+mXYHIoBOhpqfv8S0RF3a4ffv/buI8k8 jKw9wt6nJBkpYV5/m0dKzV6AMVv1opVl6tTqioR8rWxV+/+2rZoMbJVzVj87aKvaE+bY1xJsFXE1 fDLRVjH+wmp4Rhu2ivHPz9CsIcRPYci3Va65f/f3NOwVJS2d8sCfL12ZnCD8pS3DjdCXB7XiBuO/ zQ0XwA1Rv6DRsr+/uJPk//6SRuRGb+rv//7Suw1u9P7nudHi95fe8rkRc/r/4PeX3v99TqTZZaKc 6EYYfawncCKRjHFiEziKiJwwwjih/zujD6NmTswkcsJIts7kc6LlYo5f6eHAeSUpM4zkrzraFCav h9MyrX+rn1PWimMpdOjmypEZxGKg74EKZzHg+93gG5/G+IXaMUMFLAY4nwTfQIy+NFUYaMBgYK8a xV8vh77fDNos9F1Q6NvMgmF8vjyuP4vPgq9QCg71DWQE8/gwEV/4gif/UI4B+oonuPQE8/fe3KZK 3gOJ5VAZ0UUmSEuBvUJE8qo4iYxI0vdMttIRo/++juRo9TbURNppLpwEktdQRyISq7LUvDw/fm+a dXV46vUe6hvMVpo7p/gVTtjafhyZX8nMf2TWR1+7Z6HxzXaVfbT2lk6h3D598G7fWV4ujx+FBV0J +8BdP9tw9+vZW1dtjZ10ZFrJhScXyi68ufC24R7vbXj156gFk1K2Bj99Gp19ranJvXFdU+T6ihsV Xnwt0cfInZ8rNpR/OHwj+8mc128W7PgwtIPTqh0fvsx63u/KfLZnzxXx7l+K9o5/uiJ1QePW7AaW j4lSxMh13/puU3/Onqt/erG52NGoy+XF2f2/Hnhzh2E2rVEvWnd6k2dv0YL+oy2TyeNPKPTts7h9 smJXI4WJCh7JlKiQoeMUHsbwFpvGaRxVeLhQPU5l/8K3th2NYmpiOEbdSxH/GB1bjW0qF9TW5FD9 F3rFKdUt7OIe06F9zKgQ7f4+ZUmmB6mbFpWMpLJEc5O7zdMrVX8V45njZUTPVzJLAyK3SKHaIBpi u5BBKeQHOSpcytDkjvrUM4vHJGs0KBcuvpJMGifSKFCupjp6q7irbln4Mkehmnwrh+aR8yS5QyoS nNxdGDOpQMHSu89ZpQjbYa9Jn088LFuzs0P9rE0vzg8KMYi6bHP0YMo77Zm7I5xn0/qse5m9/fyu iHshC9iflGZZFzV+29eF9n6Zrw+7j9Y4H/FWr9vRb5ssZgyt1Bky69N7m6/mt/aurDC8VFNz8ekJ ctPyfU3X7uxcVHFg1tLnZTZfG4TzPPd6LauYgVRsSt/3ounVl37fdzY2ui2stalLbYgsbzKb3NTh e5PDkDpWw6BDp6j0prc1X04pjSiz6hD9uWLBhLkf1/WLLj0n2nHmwLz8M5bRnq/rjwUsczScF+V4 O3v+1/HqidpzN1d9P/Zw/qrK031o4cPOmA07eraorPD87i+P+Owbq15lHtux+f2ToHcOXaedfDJf KTOxuBvnzPmtMwKPcm7ED610eTsyb+ssEV2vIfCThcmbY09FWZW8Lo2PX63b2RB2/AL7nee3I53s ZtQs+BD/bu2Ax9yazL41WTn9lh8dEMq96WWRlr4nIvLQ5z2xvk8thEVnTqf4Bdw1cdp8ISLcNs/K 6XTDy0y7Z0par9ZGz806/PHIhjO6NVFNm3dsjc0e/uLj4AVRNjYvbn+z+VoS5DRrweM1O6892Pnt SY/gN/bD72SLvdwurdab4fZ6/qv7iZFOmdWNLw+/DJhlXNX9aUPwtcx3jbEZbknnGk+H2sxO+iio Lii+tnqEj03dw8Zr+45X8Boc39Ct66vvrrMJnF/9xmbJJJvQijy9pgD7K8cFQfut69krax42RX18 tv+zR/XZmnz+1NdP7tvMrS99F9yg41TteVrU/W36PrWyBpewt3eUZg15WD70Sr2WbtkFcd1pIFjt hBM2jVce78wSnhkeerm4Pi3jxafUo5H0T6Vp77ZvLhIUBelaa7vHCRo+rV3glRnxKokS/vJ75wXH vuUMTOuaSrJO61hKbxCRxAx3JTJDuVHhw6LlOU45UZpknZxL3r2KqWaL7XM6pnXgUGwUbCiPczXE /V9T1i3c4d2pfvhrpcxc3bROVZRvuaQQTUsNjYUkMbUzdXnuRtGAEGo3hWs5c8Smncl3YgJyjSI0 LOnRpEkxnXLGix00FQ/krPamnqfOVDwW45bLFg8yUr0dM2vxw5y3IlpIx/MqZeSKnMei7kaK0ZRo tf611vRopWh6I+28WhmlhpIRE63c2H0e1VpxZ4xNTBOygNopZ2fOAZFNrvlZ5UY1L/LW3ABRdu7O 3IqYBzqu0RkR8ymXyRpihsY87YmKtaKBcQg1TtmVoTJPrfc/ZzrIV5L/ZcOxSG/x/zt12NghUSmb kq3UpFimULPwc66SyE5cI+olHpIzJvyeXs6CGJtFaiInkYt4p3c3L2qTgsHCPJGJ+KnojkgwslN0 Rt21GF6Mew5J9/JC3qIbDF0vBa0YRGuhau+FvIV+ceTCkZT9MQdHqglH0o8qHhR1FQfHKd7LPSUa EUcyzjUNsbpOVhR3j6PtX6yTox7S6zrJJDd8YbttOfpxanUjrY0oammLyM7KXPKY5M6bYqYY6axI Vp9H37S4ZnFCbrcQtW1qrxZ+yVHsGKPqrbRZpJRDilbmKkxN7mqeG5ysWLhoqSgsTblwod7CqLTO pohKKalr7o5kFX2SQ65xWrezOTOSu5y1VTurc3JRh2TaycUaBSoZMUqp1M+I4WtFK9FMsW+InrvC tMVDc5SKFn1bqGeJ6FLfjkSoudkxM8Wa9Sru9FHelIjOHGpCjr9YuZh8elGw6IAowNuimKSrMF80 JE27imyj9N17WDHl06L53jbmiMaia7k9jJAkZLHIKELLUiE2Zo+os7lGkqKdqItYv7PinYUVuYY5 KmKyuUq0ykVR+4h2a2K25uSJOogHmtOiFcbmdhEHibtGdD9Pur1oWK6nqFuEznnK1RxeDi83e9F7 Ubjos+hpTqbISmxdj8z7VT0c+rVA88DV+mGN6xv1uvWKGQ1abpEno8teZGhBzADvgQXk7gWLD9sO PKs4T2fvQmHI4LMafjETjWhe9BMxpHlKfosrRYpGlFJlfs5E8Qxval8jtfJFlnH0/BxyajLSflHC yHb9Ffskt89X7Nmf8pTyUvRN5G+kVEp+tSjS2zptoUIyudi2Tz0pJEZvkadthxTFSSE6KaRT3j3O dtcnh4rsk3X1FWkjyeExY0P6BZIdcqakqesrGYR0ClTkFpCrFY94KwRS3iVThIsMRKRBuVY5ahm2 9LNbGz+HDLnCOjurz+dxR7LfL3t/IOzI0R21YuP7JhYeTtWfzr+/uCfo0Md1Ye3VqTzPM8Uh1V+C 79RUPSryCGk4MDizOpP1KvyozVfx81l6dKvP6aw9y/WqZmWXd1pnsIDlfWuQk2V9vsbWWSeqP041 u934KbMiqWpW+LXoBSzRpLvvF1dR6EXdVEsz3l6o+/TloV7jjXd7nFLnbD9QXVsSyz07/8vnYxYC S3HBvYSdpSf9sp+GVd4P3zm30OqDycOO4WXHb4Vbnnpmf4webP3p+oZO0WWfGm53uMPxPBFwazDr 4TW96Nenhy0fZVjFnutzaUP4WN25c5rW0S3rL9lkzf10Y3lNin7D7dMGx+/MzVu36kNmTUJ6xYWa YM/hNeUX9Go8pg7/cL07z/rb9bzlw5Z4XAifzXuoxEu0FKVb1RaA4nOGn771YGbw/Nnvu1PoTy6k Z857bBW786hHSH2/j4N4SZZfy+2cgt2FRuJL4qTqC1OHXjszOPJdp139og6HPe2lG5VWd/foPfua AQu+5Byyz0pXip7S9Dy65u2davPPQu/AvA1P11bbfG649GzGoJmlT8I4gu83dgy+tO50tqko+Nz0 bzdtnyZ9e5c9n/m4V/A+3+xHgsaX/cLLXKLO8z46WXBH1K14u/TCq/BJtNhu87wZ7pHXbZqGGVZb nKq4Zqj32vpCJLNp/mna4GHBgTsErxfqXYjI+Xz1fcK+c1fPzHq9wNI9/MOz/e+enKmuOTJ/zoKH h+3Jnrru0TnheUePbgg482SOufvHy8ssyqLmPD4evHbdl+5PNg84EBZaHTioi9WbuQ27rlpdeLN4 4U3arXN2685GV8+qD3T7UlIRzuVmvnRTcntX25Q2b+y9gldf+5npl1V+KXv2MdyyQ8a7y2WhmZkV qZ6bwjwrP2z9LNxhngYyKZg5/PSbzd9nXBv14AC91Nfk0M6nobz6gkP9KJsNLTN8mg59ObbTPG3u nm8PL+UODn/JeXMy63xF0n1KWVIGe/7nx0mPv4gW6SxJt9ct7Z7y6GTd3HXHTmXX5tknfWHPjzhW M3Pu8/UzrwnW6XdVHhzFv3/xePqxT2VT35yoyK7dW1PxuaPN8cbTTzWWx37/YL+YPs319sRPZTP5 9bl6upWh0fUJLwxrsnhTZzxbbVEzw+ybZ8C6T9XzC6LD/K5V9vK8uLwh2+Z7vm7TrcGfgu7EVjWu LtX5ZMOuLL3/KvGLkkbp5k2Fjx8nbNox0zyYy3w2I09V7emCBWXfarJtjqRZWAwYYJV1ZpiFhcVQ q0x9a6tTFplGVukHUzKNsvTTd+lnpR7skT4gc9fBHqf0ra2tTUwuBEZZdozvP3Wo37QHRf6sKw/7 9quwXW1hkZ58JfLkls2bExKX7pi6Or2OL7AIr3pd5ZX4sGT6cfNh9Lfnbtyo2330nOWZLyvGH5sS nzgp1kVF9/ahY0dPixOvzDZ9uc2xb2w6P3F975WWNaIjHZUMJyzqLT47XX/a4QdTZsyYMuXIMI+9 MXkd4kZv7T88QnfdMI/IyeUKSZ1C0nrXFl/PjDxsHxcxAFnpsXiaesZJD8vLLz/OnqFlqNh7QMyO npNe3pttOuJIkc499vkRTe7Xa67oHuusuvTqqF0j+wunV2Sn3n/wLbT/+oZoG433b9+4CN2vTxif O8ptXZbw2B7+hCyu5801Xx0+bq2Lr3K+uW+exeY6F4MHFf2K32trVal82tSwqaGh4/WkBSt3qF87 qV4+K6PQuOCeVqczQ7jeMYNDOnXaGjfyMKXYpMA4bU4v7t6FK8zuHXk55WWfR41fMkIpOg/v+rzI +FbteYbb68hooZ5Z6YKm7zufLrCZVp3tVDZSbfrJOU9Gs59U6NQE0M81RWfM/1QSIFSqPkCpDlB4 FP00zzB7XlPeyY8mDSN3DrlBTx76RfFZu53fxSYZzNrQG57Wg56Y9ptzK3HvS7WNGzaoHshqaniv 5pbVZP0k+XOF/50Z5oMtdMKWPWXHu27LCvFgMp/lX2QvLSkR3GhcWmKiFnBbP3+SoafHssf3Jna2 yjQamqVvNXfBYk7dofoTJ+rzT+w/NHFKB6/Ekrguek/jksqe7JjZceep+obnqbtTD+0/9GL1YYbl so7lvHPWhdtuXdh+oatAgx1w6/bVHWuHrl07/OX8+S9fdUu/z7mX0JWkdGfY9ltr/bUrTIc+P7vD P3Wo2fYwM7Pq0pLA2ZxCnY+JD2YvafrYN/X5woHaU1U23qGGex6Jyro7u/Scy7EzqppOuwfmOqzf LapN657/rWNZj1VpI+4oOZOcnTjFb67uR46cFQXpWB59Pzu0/7KG8ulPOsd72I/WP5rQ/+LNk+vi PSnrS27UlNfP26HxaulcdoeOTut5rtzxKxxinrFeXDoZMuKLdQ+D3eN6kHZ/zy+g+L3eRhroHNrZ u0/76e/idlwwWPaGmj7/cg2l6vrKESMNmhKnbcuzOXBldJ9dFxFPzppu2gcNqiJ79QvcRWt341il Fttb9HJQwi6H9Vn9Z+xeFbGyutxqa53hy7wE9sqhU17uq5hWE9o1r9rxZl8bw/NqzMiy81PFxove l9/Y6OaYkBnybFS9uZWVzsIRmUYHh83tO33EAAudpNtJCaa06pkZQv+vFL/C/fvtX2zd7zKg+915 lfcuxrMqaTQW62DJkxOC+5nt7t/XeX6jvDZ+zPT4ykrW1DFGvKmTJ7u4TH9V+0LPdWqfACZFf9bm h+fsdiQkbt3sNjP9fqXpw8K44R+/7rAIL0rm8Mnm967nro8KM+F3U19Jzj+4oGLHggXLP3Ve++BB 1PRi46lOx70+pU9+Gmj8bkmJY5TVjs7Lu7Y79bFJY/055rxtpYvTPSJVXz0Yu1qB1bGOdFSr45nH z+L6X3yvNU8/IWm6zuktHLPTU4XsMTM/LBslPmgg+hircPFZzM6976cwPl88L05XtN6StbbX27cB cet6TXu4zyjg4YH2B9p32njs3RUxfwindKzuUpfV8bemU5fvnJPTweJx/C5tj6rBYXO7pZtyB6to 6wb4fHJKvhnTfUi67/PnPtNSL5HSfX2em502quH6fXvuXbRwi/noms7+opUFWXN88zPWzgnxWnP+ 0b0TQ5ZZ6tvw7UaVPlbREasO652f9N29dBntS/1Kh+t3no6cML5E8wzpm/vUK9ZTbp4OHqBj5r3+ TuzuQ56R55Ie+HfTeBK/8wTT86VZxtlnnZ4yagoezJodyf3YfmqT7eUZZ00t5j46Gekgqrix8Zl/ 3fsZageehHZqWBPocLxLl/ED11iaWKy8aKx2U5gw3ORbkZK34zYB+9W9E/nGExxHluTH02rTBP5f F1Uvq/8gVL3Gmhr/hMY3HrUrs0e68vrOtedUB0yc+uD5ixV3N2107cBivQx9NTXFcxD//QZBuNmI qX6O2gru9ZqNvR4a03u9i3tPWzIt44zx52lul64+eCBmrBnWwX7s6emH4ie3Ex5ftNw1oW/+0QNK OSl977uO2NKdNZSsWtCx29pF+y4/W3Z6RLc+7sfNT3PHtNNZVC26udn2jO/huYPCxNddFnGHGc5Q zskzaBe5qvxez4mXzhocK3obqnDeo+9NN6/ttXNunQ7e3sXEdHuXx6bm41Yn+s4bO2dC1jJWbxOx r2Hf3EsTg1W0w4Pz1wWbh1ku1dq4RLdk15AhQ6xUrOZYtbt/M3zOEM4AXvytKl272tJJN5Tfn3li 3e6hr4+/b7/YR+YxG3M3D+Er5MSuNY9UdwgYWd6bUmw8MvqA/dXLuV9TEBVK1eW03lO76JcoLJmh VG66yoo9gWX9YDM1LHJ88tvYLIW3H5IXLlyyxWGAUPPK64av7cN0p4W+nLVy0kanfmvT8x4e2XTz gfU6UeWb/Em7t1m8+/65ouNRD0XD9E0UlQ8nl4Y72vU0HpZgrDEicDi5rpQ9XvmxWsWkhGnmJlbz 2WGf7n3YZ+KSrpae+Sx8m1lC6ozT1tELwvynNTw7kZo6cW+neFbx9pKCTSWOY2/H7BsQO8xx+ZwB ZwwGjkqsXhLn5Ga5dO05izDXqm2HkjJOJ+9GZqZv0Hv2YsfXgw/a8wev2IeAVrTjqkNjVXefVAnb eWjYlg9q38nvRvodMSt6fSNvno2xgpL2vQA142Ub3lzV8jCePmFChFLVuEhzp4Qb6R17l2/i+FYU HenTZ9BizxtXPG8U9BnkVpdmVMVxHx8WZlE6yO2e4tawfbaZ94aap8znNaSODTJS1+iqfmDUgUls /8Drl7vWJNvuKdl/d/btpAeBtzt2usO4y39sVrov0LTdi5sa/p/GkC5cVfXjBfnqaE9ZpW324UNv 7w5vrfx8Ik4rXZwwatSdqm3HDi3vTjl8L3jMmiqrkvziXhW9B7iRT1cFBDJirQb6VHQ+1zHN/sQp 87FrEh9dP9WP6yNYPd+3dOyW6eqc8+t8LF6Wv1Us1ycfDFUfZZlnp1mm9Fo1zsibx5zTfcDqBiTD 7zJDxCsd90zvWaNWkInzo0WjL2nsvG9ddfJaSWjGzQcDJznXegZVT/A6zfm8YWnelsHngxyfV944 4HRnRJb/rfL76X2v3fYwiSw5tGd5mN6Ik/O+JL4c5jTzlN+DE3bgY3/m2PYzAyvFixTU+q95mrhk yeiixL0KWYIpLnNd0jdGuZikLci9UFXmWrj04kXP9I0ZefdMPrGENYtfmuiNcTU4dPixq9vn3Fp6 /4ELnNs//VD4fPeVU2kR/GnTjLfHTg8cOqmmqkE0r6KmbkT68xfpG9Ztqni1XUeQp6ZqVjGNYx1R MC/tVDISKQgK4gZwg3x9uQEzuRVbSqeFLp1+ZFp3y5SHFkGzX2ueurnmkqPSAKbZHP2lZsN6rr5b s+SJmmrcvpBpW8blPA5SU12jP9U259h+j0uegRZdE9e7dj0e9XLC3vaBUzLOb7J5P84ojkU934nc 6XxxxJv2S0Uuce/aez4afaT6xLtNk+ZOOLnj3uu0ncYv8zKCH4/qGbvv8iItelFEaV8Hg7hbb9ud c1k1eVzJVf5smvG64ECdV58Z+zt0WtfrfdrGpsp7awcZ8VfNO6nyomyLFXvniid8nfV+9sL0z2lC i4VhYza0S52ct/HLqX5ah49d5oStXn12hMGJop5uW852DCsYYdy45NbL2TGlvTRUVNTevw1Z7qcQ vWS4b38n20+jEl6HPoudtPCIjm+xtUfapmXbt/Y/4bpcK75kk4ihcMCFnnPHtcJMw6uOl3n+0TWV ROHNOea1Hyrdt0XcY2utjbBbma6lHbB+l7b2w967zSNvnLhxeAuTVVfOyoubaZh43r+keuphZ22t 46dVh1XZJxlHfjO+eX5ATsCdGYucL1iyqy++VOt0ovf5hFN92tXdeXJzSUTZjpln9d5drI4vWVrZ ybDnDPskR1LWrjX3Np9Q9HtVSZtKo01tf/9FUNAA0rGlFS+C0p8Pe9B98efx516eok29kUIpTOGk OB5dfexxopeb51bPpPCko6TII+eu3cx7f/PtTUFenkBNlf8+ttuu2C2Pnn6vDt+xI1Wt77H9ipv7 1Mzj2nL5XIU3IxdmJLcL3Xd3b9Hhgx0nG/gYH3zwdXbW/elrJ1LPxbL8Lgcax3Y+0qvXu17CeNHZ dhOuRL7h2vKDj08ZtEGbSr+T7pXw1WV0ea+exsHtzGz63FhpdmPshgidw8ruNn3uHXXxOJY3Zrzq qgOmc1+XxQgTpmyr7dL10vS1asdnVowJHdlh25DJndyDxx0McLz59Wtt7Zyiy6lON7YGLTmqG6m6 oasXNW7u/sCU1WNmFuatYxa/W78s5Yn1+p3pBp22XLPfvutTwzg3dZZKHenLpqv90hJjeoaPSvw+ ZdSa0hFXRk0Sv6syeDYhc/OVsLkXR0/r/XCFeclzI170KIdVVj34x1eMTzbqHqnvcSVQr9Ct6IDl mQzXl5OXBs+zL9sbMO7p5XcJZ5m2GbOnVO09zHjz5BJ56cpT2fdMNh5dVer01VPp8tXnYd5FpBVr x1++PSExlLHFbIf1fOQhyXUHJaioW07R9JVBydOPC19vH5q3xXBxtcfp2cNXhQ/2Ostham34+lKw IWruxpDcnDG9VI4UVhUWFl4aF7nhRF7G3c7btmz6fu9c2a6yrePcaxwH9+rTZ9f4VXv7zR8QlLn/ wNFZq1Snbou/8OHuxKLvxYVL6igO9/X6797uMm21a9Kb21Gpltvjh8+PurtnnfXAratTdm1fXqqn 1J7VgdXnBd/Y6svByukvCz1YDw7v3u1zTeNNhN+pwed6djm1xED/XIfUJO/06VZT124YP6PAY/Ld Q31PnT7kqDDb1LFkAjfy8MHk5M0GHfpyzMLWCrus7dWr6iaTte/o0aOnovZ+HmvftGK93rPUTcuP hw1ySEmdZvt6a3l1F9vOXdrpp/IUQ0dn3Ju6Mmj1yA6xLxYHUgr8C03vjplvuntwe9WVPWdv6Dzy keHsUykmHjvG7dhQXHHlQtyk1XMzPiVnLB3leiXFwZ7bvUBhxYg5zvamXYuC7W7NpM3gpJTkPbpQ qFpUuO7tqOKaj88to88dX9O9eMmU/vdIl28feP+i/eYR5zYqD1t7Ve/iiQtlNmbTDtrNKzus5fos z+yhSL9kaYj+PMuVqZaVam8vRhyvaszZO6hof9bxul7lpJzxbscXT1rw4PqsbQndBuuZr3z15bi9 V4fhDUKO3zALE1W3+e8TUkMYYdP05+p+0uwbNbbUqnf2luLpSv5WHwr0xc49Zzhr0XsfHR4TtX7F 8ptOnR02K3mYDJoTr/5uZrrF+hnzneevmLt1cHaXLkVdM7QckxIjDGff2TXczi6PfpfpmlvUW3fG sr2cLkfHH55GGzz9wrwvBV4Tji2LNYi3MD3p9+y9+yjDHZmnwqvv7jp3J9vVPJz76ch4uxTnrBT3 g4YfL5zUPTXAauhHrzcO5qoJUx5eO3bHfd0h88+lXz9WFNVcuvPsUm3tcpOUpSRmu51TVx92Nj5q UpGekrg0aqPb8ldjIuv8+/Oiij5Unio8HO9WVprolbTVa1KleyQ/wOCo/RF/QfWrulv++xPrbiXc ennu+k3+wT3Xl+w/tnGx+6sxw7QHrpx8xyN3mu/eB/pGHz9/vlSrGxta7p170JJ8WEV7x/ZUpZ0H knSL8i6NeK+gHzjMYJJw5fHxfMPs0ZnHe+W8iVuuu7xXpceVvArfrQMfDUjrtytve+cNbzvM3qaW F/fU5tVnF8fd52NnlJN9nw2ZkfW0yfS5SYU2x9fgVnnxhw9LBW6Oe2JXx5tUfK/KVdJLXOlfem9f 5dJKh3a7itI1H+64YG01NN0sXX/o0Aspu/QFeVvqB8dXPln+Yt2wzZuHXr42zHToDM7X5Mr6D7v3 73/aeHrARh+3yXc/VBbHLX3+4cr01emz2+VveF9Avnw0/+PU1QmrYgO631l17c3z3QNLp/aoe/By qN7hIS8O7XS4NOjsp/tNPYZ3WV16e/v295FHXnk1bKvNnr13tPvahC4DTox/ssLS/UmgQeASfpCq ar75iQ72PZ3Mjhe4xWxzT55Wkz/Gryr/m/cQC5tCZaVEmwXRc8qeX1k92biiyHx+ga0JJ25iR+ae UYHZfffcWHWiy3QH/kzHfjMHzjTQmrvkjWJdj/xt28vi4id7JkxOGPO98lT5rQ+KfpNpYIhXsvRJ p8z09MzMz7OqqseqRelt75paaxvM6c0aL5g7d/kr9R6zHDzMTUe/qz6Xt+75wJNG7MAeb8YbTu3a bccTC6GwpHqPnZrbsyFqFXHLOvad3K/9US+1Tp965lqYFlos/+R8rb0Z/ZnQTqDRfcQSx7yKgo2D Z7mfnRcZ9Slxb2+vyyFZb29Vzyhe/WZYeLVX1KNzS5eerR5cvHxrccKEEYlz6kPGXr0wP1Brch/H MXOeJjxZntc1rpd/gKFHWrLOt5C31vPqQ6aHD5tT+3xM6t5PGjt8A0buGfjNJ2zYI5fKrIO0Lk8O VtzO2hTV+cIqQ4dZO79O+fr141sTY7PgR8Kz33ryHT+FZ0QcV/e3OJPUuKJLcfGTLG+9mVTPrBVZ 3z597EvrM/QwuX36zuh9rvvqIjk96r8I/YM/OYxfWmKSsH2LwfyQvmvWBBnFm2b1P6zalGpspjgq 69qNc/pTXAtsIuZ07Dbhe9BUv0t+GdU+tRZTZgZwr8RO6nYiwt5WgbX37PMpwv7LO+QfOXfEb2P5 +dJFljkG52fzt8958+hU4TD/dt24SpmBJ4o6zRo1g1nYJAoR9zmZJi6MfOVv5c8NLxij4DVkse3K EQufVG/e/ZhlFEhTXDwoZd+7owzhqzXP1nxT/zhupGd3jWtFm02p4765HRXyaEcvP7lpMsjpiJ9V u663SuasHXt46PkDQ+ImJXXWtW5nGWkcYZwyNPDUILeu6oNoJ8osfI1EpbkiUfIzddPACPqwyKdd HjXpct2v7bmTuEsnOCcpNzd3Yz+n5ycLQpQ6nix6Wna3zPbMqaDHk6s8LE51Vxs67evjx4/tRzx6 GBZ6ymXCiY7bHy2dH3TgxFSj0OCHHn51s0MVjLcs/tBpX/bge1322hzpkDDg88HDdmvs83aZHeth PezcuaNhLkX7UzMcE2Yf1Jyls7NLdvT886mOXWoTNrw1fv75+Oqrz+Z3Sbh+xe9A4Xyef84zNdHD agW1jrd2LWu6oCDoONi758Mah1uT3i27NrnqyRnDUFvDw2HjBRviDG7Hp6+I3a+6LDhLzfkK19r0 QPjtXV/UOubH2zS9+pJXoT8r2mTJu2F34hesWPW+wnDnuuDPZXNfF2TZ1N9o+MJ7omZVezkr81jG oaL+3yJDD657seR4Xln6Y9+8WP2sUP+v+R/yP1y8ePFcSeWZvpMd33BHvk1NiFrfiZGzad+9FbrR 6RFdqTcOrVp3h5MyyjV4nI3XtKU2zsGWbzSN7y47RA/k7DU5tmpt/eRNGywGpSxfNDSrrn+Zj85b v0lHU7xn3gkec3qFmfselaPD5uwfq/126x6m1oSuRwpvTZwv4JxcPEPry/VT6wNOB8y4WuiUW9S/ R3n33ORL3f3mCwN3P7N+fdq8W8flntxjwxcFxOhYzGE8UPOPOlJ0ZL7T2zHPV4Rtcxg99a5PuoOO ZWRfc8tVJs/Xm39YU3UvvYa2wYV522pZutG76Sezrt5JyvpW9STcpZKrFbxrc+1zH4959cwh0clJ ZnN1Bs0rnuZlufjri1UHmxyr41enHDigVJCUpHL3Kn2Or8VcH5+eCb5R5TSrIetvBRcueHg1aYVV f5JnsSCtMSfpunbx6sfF2t7TLZPuFV2KQkq01mb5WOjONmwcVbU1cJDuzto3O45dWGXn3M3Q+vBw nS+n7sx+83LK9+mq5K6bTDm9F3SrPBaRG5o711a9h3a/laZKz+47GXqdFT2YMuUZvWRv4+SVdKPx Uxjig70/Lg9+liaq7Wyf+p05YcGj9cha5V6jsle52PZ6s/T4rV7j7K7fsdbbsOt4nFu6/72E2/p+ 4Vklpu7GtMhrXnUmSzJnelkGZlx9JizY4TF286nUNV/j5ihcic2vHzi7U25+l/gVr027LfqklVls bPew55qAlw9OcNJOH9rFrlU6FVmn0C3Wv1IvdcegMzvqNngOsLheGx/4+o7fiWkuO41pKzuXpCgN Phhwqz893Pnw8rHv1vS/YXAmLTfQjPEuuVZT7Qp/RP6oF3fbZ/S5aBufaLchpQO1l0N18vWqiSYm Ba/uzlYfV3Qy5L1Cx2Kl2orwHiL6lK7DUlhlD3Mu6K96MULzcmgOK1mXZSaqGBNoH3IgSYEWahZk yq8gXc7Y+HLIkXnfFOdGW3/sv6bTgfJLVu6OzO684q0+Z9Lb5dJ4nznFBVu8n4rDLj6uy7mmaNo0 uV1UlK5DcZpttfq2wZ+Tr1y+YlX03oxjkTDtqNDYPkrBP09UXJIeYGM218ckc3ViTMdBPj7R3dJ9 rqg+6pgeO2FQ0XHu223f3J+SJ62x63nt+upBuxe7ldo7ZfXkd56reTtTI2D6tf+PBasMaPr7+j8D kZbu7u6GIdLdMVJA2AjpTgXpbskhXQMpASnpZnRLw0hphFHP8P+84s3l7txzPnW+2J0yc1peIh5B BMwX37ncPDkORgskXRx4wBvZrv3UlITEczI6BocChtP0XjT5+9g7XCzUiX13lw9zGZDuFCcGs/sm /sZSr7E3aoDMm9VQJSU3jJYp1t4CgFXUd6CedTh5OQui60dDg/UeR0Ef5eQ7nzfkS4lSNnTplezV FfefuoRjnwut1YBnaOIrGSHHqx0dZd+U/1jaRI1oDg3L6CelZ6UuLxroTIHHXFwFTNSmuN7P2ZHJ 1+jXSROIYuq4E32Ay0uoYqeFVL0QjnSsJ2+JOanvfo4RDS6i52gqtablRTHhUKKtm4y15AuOUld4 4cPFx0PBubRsn3cnI0PPYKjpHhYPy9eKk5yei9H5iTkyyjXbOsfDrtMdmIXNGRgrPe2YVaOmQDnE bzOS0NLDUh9bVyxFaDj/gffPobdL2ys/Tfo3GDpg5qMirT+Wuv8R0bDmEpXUNzD6Gzo88tB+w6Li 5nrg+UzHeelbw5LzC53n3mqkHL9TQjqu78zi7E3M71w+9d/TaFuZTbkDJMqA2PoehvmFMro/j10g FmiWWjHIiiN+1DHa2Gs1oLYFyWmmVnXs+OYzmoXxN+TFVKtCZjElMRnegNnzVherd8s9U/4NP8Z5 p1kVZY4P/hg3Butl+QLgo8GJzqXtK48XBwBChcArMjzmo/OM5M1Ev5JV34MQHKLanf/UlnfH1J1Y ormjuIcLb4gUGedZhDbqltu/1bzlaGEltfC0Gfrkx0pAD7D6LFtoR/cGbk0p9dB5ukmQu0Dxs1WC gYQQmmIGFyw3HgXPkY76joFdJ1l+zOQ7TU+NU27jzQicxKQ1zQzJQ6CJxmgw44WfqRmZjLP4xcUk agWfJaDv2d/VqbQPJUJsf2ni7b0GTF7FEbz5alopOZrAcaGpdEFWym5IxYyLO236+ippmPD1uIuR Fp2MnwxttT7mK42aZ3hHrMKB73feSA7Y4Fv4zx719Gm/rg6LJbXzWHIGFq+pz+y1/X3vFPKHw7QH Fgf7Rdky0Dj6VWuE6w7Uvx3dnp3uD27clFfnTmNHSUn49QrPYgrniPpKk+DYopspJWj8ZfFL0cQa 4mEXKlIFXj4MMocUhZHNgYuRI470ROoZfvGdGpGesVyRNFgCZA5qKJwV+71n4hMDuUaizPmSZJ2f DfP3hCGHr7/2X5PHKX3y89swNLUqI/RTc1f3+Z7Uh7rZ3lTV0ytrk4k5YCWAxnojYNns8kleyzAC B60ofCZ4q1qjzB9xqb1Fk1uT0PlGnJW+3+A9H8gdRpkpfHyvV7EzauxhcDVi6+WhM/lZ5Ldkuhq5 XBZNQ0tljLw0GV90FMv6p/S/sOxm6tHb7rIGn4bKos40oAfH2aw2qg4XYZmBkNepZT2BuLg4u2de 5ztJYuj0umaeUMZFrMNzXJXIWN80FnoO8pLJL7T45EM8NdKS+EXUMyleu6w+V865dm2ZBT4UTMyg mJf2zcORXt/1voDZVSBQeRsz8iw6kHXd/ve6zCI2V7Ox/VdFK8/2jS2J/4u6kkgSS1xWd9t/77Nv nB+T5RszMGWWqEdZTeJsy1Jb10y+ovNNR8CGRWPmLVak+5DdFsqIhk+EjUkBisCdpHqv5OamQxol +X4eiVRuklQuX1WGdAb6KIb15pqAVYpoZrHk+H+oXQHko6q1zLJM6uMRr+pkTD745piaTaaED6gy iZO/jCyYwPUpXKIiHY9IRsVkfiWxpebiwslZu+Si75edTakak+QvKP7V+03OxRDgDC7blGpu9Y6B XjkhnJo5TNOynURUI4LANl8pxn+2aaAi2lj406oRnPLjqMi81E41hUJXjbCCXOAsnxS1LvloA3Ey EVfrwb3eMUwGL+eLrlgOKZGPnFhmhfU0fajH1+by8rKy8td7rmIxvy9+PbwiMx4YshyVdBUk/fqO Z9RKfYyz9JMbBng6L4+/2k2Bq7U1BGUHfT9yeFgwnTkrp09eB0sQJaCSFcyXdelANqme2fhNeChJ UuNHCadv7bc3ffnDXdp2DLNUzaGKQMEDPFpxcYrgCauG72iT8uwHz635Y2M+BAmRvpQb4+PNjQX/ CYN0J3Jkb899/o98sgBtujJZD/MlS7XnhIMWLjBGpdCRgPhuRP58oJvAFzSSoIBX74CHd8dWEdhq xq8ey4De4DoJtTiSa9YoMitJ7OaWJGMNz6kaHeCMOrcdibMkG/0U9m3hFyVjSoqh9nNtCQtJojB8 uvaY5eG6uPk7bdF9OZvly+83b3VRmKgoiTOgLtY5jMS8LgZ4cV/8RWXiI2+V2Tq1owcKDjm4zAfX t5MrI5QiLJLzwPuJJr9ZSiI/HNcOdng/EDrQEczkptw1cZupB+f0vcK3HIBdrmCgkO4EdkCKlwHp BRsitAR8mGOZF03K1mfXdnEpRSDmwXM4eh2Iy1SZ3tpaTU0tw6EdwP/R319vdqMyP7+c7sxdxkZP ZwL1lpyIGSIF8WKId42o3KrcijJpbktXuSdu9qlttl2uTC6+8mJi9pr8ROrmx6embGTi6JlpawRW M4+b2hops63cKyDNn0HkMImKHLAa1S3kMfkoU5zzm0lxO9stJH3QxkExsqMzouAoScsKl7Be4ZDi NQL/QAl1LpBzFKmdsB0yoPsdhC3sJH3O87Y5nH6SleRCWQAYUmxPA3sdkfJjnEpZB8yhdoCeO5GL NjkSNNSC2pCiTD4wNDIvVq1/bj3T3TQQ37+dCE6z/dU/wNkHnDTRYCpmMdEIJ6IXi6+7yneQ3w9g SQtPZxVIps0wLSsJlhjhW+N+FUdPP4Q2wnt1N0DRGgl1f8lILDnC7FoY25LUYaaUzqqUtmSPPyvj 5nLVEyUxuhn1txrTQEPWdKhnu43X4YrCT+XdFt+nVCx8Dx5avmPHrlUX3kT77h4Gg0yLLqZfk72F jBAyWtoe0JmbdVvcGVaq8on57M83EL0mI7gIZzMQi5hbyHSk3dtlb7KIHyQ07t5MJ7u5SK+QKVxz bcIEm3JShFW+mzTRn9Gd/SRkpnV3Qw9vdJBeMTEghqTL4XPaWdwb7cNljXlyfc83BptzTpyI7F4e VA+LYXsZfLD2UIcN21byituPxAq4rJqszA0Uh2mvaE0puqUuxGgN5cbWdpQFvA7ZoKMOY14C5v7X oU1mkcq8gcHyXupdvQQog5EYm12D9AVlXj7Dl2YjR+GkR5+htjIM7oG+xq1AgEQ0y5VKinpyUaJF xDRky/P7zdh0eQ8a0JyavOed/NEMST0ZVKWgSNoy59D+CLjzcYs0RcKc9EXxq/enwMVC1rRGGlP1 z8k6pYwDi8GKfAm+371Kx90jNxQNyFRtG4eTYw8JSoFSWQ6TERi+A71oBjsEiWhbeGr+0aqMRdCI 8SsqUam2JBfZZZF17Z19jwMbhagU4cqWpI+yrs+zOwOLqGRteHrl8h0ZtoZIMVUC6Ag/ZXqnqPAw B2mhAD/GZCm+m/dZW/sS6c4SV2xiWt4qe9O3g2JDK3AlMBk756ZLFf9pVlkzDsYWNedjHXq+M3p7 PGcD8D6AARC7OCqwHGOcHPHlT/JrFvU3Q2PWqz9TmD6bqZa4LLqppD88k1LRinHvqtPi82klCoyL X3WvdNQxdaXcM/xdM5rlNlz2lfnW5/R0rCQ3E3BfViJm7zlprHzhXAeDu5VXtuo51QhllscO5IoS mpG0YcnlLrPCnG3qMjlnRs6ZKNZqjNRM0GrX7TCwqjfGLMt2EtmNL/f3ywTaMlbs6V5PopRBNhom Ch2djrWrj/ZrReheNLX+CnNmwTt/lhtm7pNpohAov0NRODjGAU9geV03kkmUtBzBAImeJEnCwfL4 DG7LPyBAB78k20oBkk/iul5VWgfO2trEzNWtSGAtIlyPqYO9PsSxXH6SZUJNtNCJsv0RCBjG9z30 9KT9ocC0rcAX3qRYF6kWkrZ5/OoMCCOe4Gf6owJ8W3ijcCrxJ3r4Pn0ypvr2XMUUq666kOnMwjzq 0NVpQJalUcGGqkaNY1re1b+5U9jvKpVCTPsvnUXGTGakrZKILQbGmAC1H32WuJF55EGWl4DXamfg xM7cPAugG1biXFN4PQLUKwJ0WomtSn7Exppj4FRWNqoHz1XNeR4ZXSxWoUQTcSD/5neHry432M9l jdv/buo3A8/1ziV9j4qdD+4mZWkb/OGwUIuiSVrECYdBSlp22vxgkOMK0cm5OdTHtLT2d8fFbJJJ Bm4P/j5YW/y0ezwZCNcRRclsdXP1uKkMnVy3woXDLx05murq5hCNojPRHMPv96WobISzawH7tl7y RCJE4+T/Xej7dtM6VOf/Bbro45Ale2NmJunH557nWSs5oZcSaZ6Uzn9B+byZkFBQ7DxyoJ+5Qe88 H95Brt5Xgz8h8ALv41Yoj0fWd7zhOkYhT5m6HYd5vHyvKk3ShWaCYqVigQJsezCHnVYkwwT7oglt 1qjK8VTwpcuxNb47l3n7iM3x90byWi+KIScJVQudxzLrlK5J+xu1SLH9rrTVvK/vYuWae4qXtuFT fljAFu0/KNUaiau/GDuKEgW5dOiSd50tr8a4xMX5oQ7vz/fmJdr80yLr9sNahnwzY9LfWYv7pWNm DSho9GDXlkyXyMalr2IN7uzWKPm6Nidhx40sWuE0p3QRXabOM3bcMnVoGwAjBQqsf/d9bkobDmwN Q1ge7U5fh9xre6u6oR9JEz5Y/EjwdB79bAOBRVzHPObVuHSOPnr+viwkr3rk30OQO17zG3eEEwW1 r4cdODXBc8n/NK9HVT2WV0WfyH3+U93i+Bw414FR1fEHdkExFyC3mgdZMnzWuNQu/VO9vSbHQLbF seVIo3Ew/C4SjR2yBhfySRXahCezo5qoVbhbVazhe/bHWYXLBzI5mlcOotyknFVFoqpmi5+hM7lf Ggy7tyDsb6tsjOfVU+ZxVc/uGxIbKqrbrpTXKxAVWOa7fZG35E6ttSkYqq4+lkvEOJYtVRSnqd0L 7ez9Q73kHXcE5j49qWrC6hTEC2yQ7T7yDs/D1Ab7jrvyqtZabrP76kl9g8Wjy0Cf55UWurF3QHRU AaPrhb31pu9gnkPAeKUrmWgqauBOb8Bc2+kpt1TgZlTuh+Esx64jp4irZYbjwM3Y+G/C7VyL99tn amed5qL95Bff463v8RqFV663+/ERY4S/z3I6JjkTtzlVm6Id2rcrUIP8t3eN6X7uDP/8nCCo9TYg Z969aD9QK7pDN6ujHk715b+rkC6suTo6z//YhnE3HqVN/xowouMn3h5UPdK5m/xNpTR3iHJorTXg Mg+yPp+DHEc7XxgwIxD8gUe2VS1nW2cLj30TcxrZW0PHPdg3k5tM2HeRcLwWkYmlVw3dzRhCxglw W3Xa1V8oi1ZTdpgtVsLrXehSqM6nKXEBd9DHv5dbje2XKs0X98ePeFKPxpIqligEHbDA3AD9FbLm x4c6fFQ1h3sEaTvMUz37YKF6bz2cOi39MWEl4Pq312rRbfXujyVH+jwNx9ssSwX/vTWv1fsKGcDN S+FiqYCzQWLGn+uurtC787lnN9Fg4shP5rGfg1TMRQ+r4+4XwyB38SUIamqEVEdU0O537vu4DiPJ sOyKpOfuUZ81zDS5vGW4oAy3wO+2WKD4sWBIooDv2o7zblxW+6UGgkRPLurhry/XoYLf5+3b3sWH UYwhSbB7028hodznUvYwKjWHYn2sOwqiL+P0URBCuZrcc/MogUhBfsx7VH6heMUfCb18TPE4tdet LRRQN70yZXS/L+PVjj/3IPdJhKyIlsWvScfpUnrK/I7feaTCTeQPSLbJqeLVSnycvDZ4GWC52qlv A9vvsXphUfkGf/u3zWf1ajWUprzpTxfs62OgaecgLXtF1RGtGwkLwvBrinb/W6/AG1jgYBTBvSlU ZaC6cu4GiNNqX/8eAnwdwbXSeXeIsZTgfBj4mpG28uz6Re5Jmbhj8/b/14KQoDVHlYrvniRzGq9f Wysh7sHAFh4W1p0sS7hq88OF5AT3w9GUcp2v48irbkAdH5CdqTI6M3Y/NDXZgk+EYAgF7WO98g48 9MisthAvwiLzZN5xzl7z6bXCwHh+598tdcvIrn3hpecz+Gduf1/w8tdMkHNnDW4sC9B76QCQaQ7C UOrs8VMx8PvizDoq9wlSrXVXyeKrB8w4xplIgfvmzB6INDmdl4iVrXZtuMXhPDNyZVhZguNe83h4 abZ/uwZqEWAEth/+Da+6XrgrM0Ck3I3sSC3VV3X+jgxgw+8/0tP6ud5sOihMgJzRLNb0VBZ3GYbR 0mpmpsNEaJ/3DihOZ8F9sbOnx4qNsGRxeOKa5m/EBkhOq/Jk+7NvzpyKU2zpnKErDnO89/2Dxs34 gV8AW6fVVBIkKyB7BhhFkbkpUiRZypLZkLlRJ/zyTszUT9q/GSVwh1Hq7vDi5IeOQK521QZHLoX6 CY06e6A+wSi6uaOSdHsnwFx3U7Mfful3f/lsaf7AD/jAQYZZhzcsykD2eu65kGR+PSoSVPoHG9q7 fr3uZDnm/Ebfbes+qZIFmrXNRYIPZ23HGJh2yl6mVusyKmZHtZie1uWzzO4Pu1zgMip+8xBzehzY CYHQabcYBuUob7sfWwR6urKZxymvSVIVBclo6dpfGr5jNAo+hKauaKzDMV5PE1/XlLjpqqfWbaXY 229wXGeskO+vSwbnXTixRNmU5TqWXejEU/aCLLa+2mnC/2K0Bnmox0XpdML+AGvgOdn98E2Ji87d JybU6Q4I3/1MeIW7eExZdE1xduC98vgTtrelyhgmreDgAJ0Cb2Vnp8JF4pFdnuCYOXjBepYeH/aO S3pAdJ7bzsNs4tEdm662XbaVxx/xtpm/pG9r2o0oTqdPh0CuwQzXSHsf6Dd+wCiVxcmVo56yBs+m GBtY4sqOiIVqUYpauroi7PBLtBdDovKBRRXnCyaBiHnWI5RBByoXW49ngAt3c2y6M+Wjtch5JQUR Haxbd+sSZWTnSmfZyz8rd4xVnNu1BWptuGEbmdB2DNwOwrJz57BfafQ7bsREjDCt7OuUpfjLaAlU TIdf5UkR4LX9xHimxCL81+8+MH03qE2gf2/amHEusmceMzUK3x8greny1JAGM59eM2p0n70XG6ZV eTXLd6yuOB1j1CtJVnyig7A6S+Ey1xGTONjm6YnyYxiylJTJL77VBvh4ZRhiu6yry8dIMu/fVTvt uSHeQLgx+9XppPz8KW711a0BHfngWQJzkyh5nWNCD7HrBcN24MnBvozYb0NzdXXsm+YXgVc3qs8D UqEKJyzniQRydXSB2J2w/N0fswkQD9qg7YNRUdGAAWGui/4+x7PtBMhCP8k/jGaeKXc1qRfgvhBz +uRlOIqcp1iWOfFKyubFzFeGGrLAsdM9n7gwHdXlozmTx/9XHbVT2qBZsEyS+nD0n0SrnUAnRaup vTcQtR1XfO5ESAAgAA20BdVPNsvgLmfJDL3Ksxmp8FAiyxklpBD90bxaIfdwSG0/5rJzkUGRFHpX OYkxo5/bzrdv8E9b30B03M3S2d+PR1RNJO5YEfFSvEs+8Tg7x61j4JOiFzH+Con9h7w3kKNL2nT9 QoqfQYWObkFvv9/cX663nbjFmm1x1qBm7rEXKXMwEjEC2KNcO2G9F6N7SfrMUfT7O1b3XFlcBGcd uZs6GTlUZR3sV9+utSElsg8PTPFJUuxRNmoLWQnax3MoXbSiAJAzcV+rWY5UpfYEcRxawVENKh9C 9/ktEYCD4OloUWoX7Jsmjb80Ph6qwgHftFVgtcGmOdS1XCQOruHZA9Cdha/7kMdiow/dIhneMEm1 qlmN5iPzrFr9YJ+6bJSk+T+pW1yIaPwM60lnXDjeOsh4ngi7eyL7iS2V9eJ4SC2IuwFSHK3qiuOR 0EtV67sEr21dY3Tb4/Eroyx95RwJ7w7mo1bS0j0oacHbzYrrdWb5kBx873G6/1+A5+cgwQCD6iE7 t5wvkID1mhpe8vj/jrQAyOMC7B8N3lm39TGecZ2dKx75NthnyWNq+Y1vriv3dOLjSOoOh3av82bF 4oGfLAlo23LGftDApTW5/44rXIzebDS89bNmxBkWDij1VbgVTo/b+sz6dwbvL86GGfGFLJmpnqht QePbSe5inAEdM76CQQvbk9eiCIBh5xEfJnWTsAphWHKilFXyJJUuwaiyH/+fJPUKLCWjan0MKVDM iZjTL5XThU00+4bM93RnIHaPWSWLsQJ/QFJ+qf7ipsulgHnKHPhjCPN0A6ndyjZeT80MYIucyljR ikYKg+halObXxj90FHMoNxVO7ZokMfW0KMzNHomzvERI0u5XnztTZb2Wqi7TcdGP/6XzHNqDVH9o vdxVim+1CrOdjJBCSw1X90C0dsdcx2J3mW62mgAmn5SbovCbXBQlpHaAZ1PkOKfvK3HlOP0rx4ZI cNtCkrBPF+g1/ZmknN75E4FfhZ/5xETlmyB7tg6C6qP7fNRG3eC/O9xpELsGvns45MMcU17uASY6 vZbAkWL/x1MkKr6rbc697DKrZgByKPDJM6R3syEMbiXyFazP6QDHjjsv2bNM4esvlB+RBegvUpIL rGiyUFz99B7U0q6z/YJzQsVav8isSGX+9a718Gs/upSKokjhJz4A0qlSf4BDmL7MU4wnQigFI2D5 IZsfK/YOGP0tTtveb9S6qn/3fg8yS0q5A2rpYpwC2Sf7pQ5aCSDDrKvOfteahqE7EG4Hv+MPh38A Z/yTWIN97PceUflGA5AGKzMyPHfaoB87Wu24BAxBIgprKKl6fDF9f7j+vib6zHRx3nrms4M8atuC ty9jFKtfQZiopih6asc7zh16Z0F9N9IJY7bhXOIw3D3SF9qv00GGAGSt7FUrTuO2HmI9IKWLI/6W 1hHYgPDLMUs/nEAhjIuxTp7n9T3skP5/z2Lh6o3frZyK0KZ5MzA4z+HLffJZcx5+6jyGp+VGJ1Sz bNXwOhireCf15qngEzdAgEiH/Cb6S+9v9eqjLVyvn81SbWUTKbnZzP4B4FxKqRyey6WeEjyRTg7t hix9tmLGWy4SLtxPvdXwDEZyhpXr5Ui1DspWMvlKP7+lwX4SUwp/Es/e/CuabfJn80B3FH9SVLnj Uhoz7Nuu4Gp5yq8uNrNn2tJfshjRjmSm8JXbv7FEpV7ZZN/deJzUDTPe2M3gkYXRnWGZORPFRCyN MXAd48tGkkU/F9bOQ4YcgWiEsDuXrA2Ufc31tF2s4eX5ooNFav+mAwWu+4CwsmTlcUZ7fLvWP0DK ttPSyUc/W2ncy2OIQ8fbqOu3c/X90smfHI7QbZ2RIQ1PdRszQPY3KvWHvUyb+oWv6cX99y2QILfp G2/j+U1ckdT3pBLJTTmj1QWvvk2AtZFhBfn7d4cKO4fv/D1RXl4D814uMnmLqDvheXdn/FbI0nve tqp8QsKpX9Shjjy5Tf56LOXjSwZa5geaeIFMHKRIZU+xKoYlV+wIVXAQfU5/bxuuF/lPR5zyJRU9 5d2J1uExoxcPf5y/hkDU1DttROoClOqiQIFXhj7b5zdPOrki+1B5qb5FLnobh0YA+RgBY1N32sYK STagXB+AXezlE0WfPTxNi9VppWxiX6AS1Yh8zW3IldMIyhJFBUE/bc6klpAJ/GHozfrrfEa/4p+c thkv1ucbFFz6ymXy2cUZiJuAceJ8/J87CQB9Yi3Oym12QJFw0YonUZpRXnIF9cC4oJ2MN3xDN3n6 G90XAb8BkBnPWR6fW58xS2vzlY8blUN3/1Ta1GvfhHZI+M03OVbm9l9QDyV/GkypLC/XVhseFz/O uxGV4F9ZIn8SyVOOw/UI2pT9kjfqZglf04y+fcgu2jF1zOxYPzfMifVdcWZycYWWL4LXUSpCN3WV /fWfxLFVDd/V1vZtLznJtv3+tPzKEZFcD6iqpubLipPgTetQaeOJfsHT66rq5ST5TbhCDA5m9mXD iyTsoaE4ZwPCrrrZg7obQu4ji2ZjwDcQzggY1fb99ydeOjXkEK6DXjS8Zgxv1h+Nlq6g8VEOYLsW BYMhDfev7xy2fagC9dul5LR02Y+gBljY6Wk29N8od8GVeuLB2GZ0UllrIKjFUSWjoP4ZP51AiX9Q VP6u/mK+ECe1QIRZukGBx0ksUD58aUjFQq8ugz8r1rH7ZIsRSFWwaPfNv3tD8x/fr2ZzXkUG181V YP2kjD1FaR3m5VB6J4+tcE8e0p3c2F8hf3FSFyLMtonMd8a20WaCEa2FovbOzctxSTkN0FbPlOP0 rgDR7L2IQzimXnouvy/Y/7sRKTXSVN75jf9SabVZdpZOucZz86+QOzymbghVGVUHqQlKzSc2SebW 7cbqvwSNlcfgsEXZFY068StyTeTxRuRvsQyOghsU77sLkkpES2Ampl04Xqpmegc1ZJLBazWuRE9+ iNQ/wfzhbUFv04tnnjvXJoDdhMJP416FfZWNhoviaZXl2+UKItK7cOgQfI41ypF2dVzRcbDi1Hcd RIsEyGf3xW0spzLeua8cfWWmyczdMKJnVF4kjFmTHd+ehK3UEO6qwsVAwSVrbd66CPWIrkr4XlRc U6zllLnI67OAe53RXh0rrEz7P2eOXtxvk54I/Y/zNN+dx+xoPOrEram5b3pXIGvW08Fcb7Os+BvB iuUW47/TWyCDcUJnW1MJ6jWcWaITo3nxrb0DftJLeaug26t0Vap4lIkMYongp4UICuGym1Lmwg1M e9lpyQv6IRYsHT48LPjXJbsskfxoHjA3UlZ5cUWA0HT7txClCnWobb5VGd9GV0zqthiqdH75u5XF Ncs1JnsQTEmZK1EP3OaPOsTveApNyIbMvxCPvjglfxZeQNPeVTuzntDj7IbdT1oBLWBuxKEFGJu0 KjytcG1roFhjdHCb5dsNlArRuq6NeWVKiiJRdYbxw/ODESr2421RhKz8v5HYtixiJtH4mGqLjBhD Ba2h2P36qLNurtlUFbnC2V8gomN0E+leBVqlT9qKNDrm04sJGE/FjNuHAGlx6hRv3rVzl+AZkkAn ZzR7HHQqHKdtxqfAjUwc+ZaxW1e+bc86N76TCEOdKNdRGVnXaJFRowfOCMuSLMc949/S+reBIBEa CjHlul5Y34GOwrGxzcfPTtxs4xTWykM7149g1LJ+mm928d0YrR/Cni42JoCY0uFhf0yo+/pXL+ZV QwRsva0o+JdoYef6oAxTalT8NXCvWgepRX7soWdYWpgn2NEztaKC1ffBKsg4J5o9w9oczJzG6JJd 86K5IZTYO+t/mbHRBsw4QYn5M5HSCzrKPtzQNEF1J+Dg6aqP4yTuZmNRrWStb1wp307Na3T6L0zk fzSStXgd+Id67LfBWkKwWfXBVJtNtPHr81dn/Aaav1yye0MwZfdWNZ/ESKUAt8FREY/y6MinDIqt 5e4j8w6yYHc5vxzCnA47dWFqmAG700j8LyPYRttkuypiXy90nR8dDZLahe8SmVrl2tRNfaiJDOlW CPenErxTpbar2iJHkvukbkAlRQrjxE3BsW+aRk395xuuyzIR+8gPJCuAaTs7aOkPy46Zcv/cmPxS osUQs8FvHifYK0fO9qNlqAo3Wlej+OoVqVabrDI2IFeumwXLdbl/cNcxU5lA+aH9cOjcPd2vzY7w QdA5acQCzT9yJAowp1Ny/tX7fu3Q0GT6v7zYql+JHyIdTr/rTP+fcMmPq3OJu5EZAbKKCkohGefb 8S+QikTL46ecEiW43SAUuwuQmSAN3MnSmbm/136bIrFdbGfVsCTk7Qq2qG1u/bWJ+7Kit/wCyX+7 idsWbhqaFpNWq/lOeBGROym0lQFt26ZgZUClil8pfMNtWPSMnw9c8f/z62vLp/9PSjwsPPw2GaZX ecQ32ViXKkwW24cXOJ7gDm5bGNFarUuFc/6renLHYaoZ/JbnPymvC+YSA/cGg3NspQHpdov61yHH nFK6uu+FTpPW1jme3OR3Jp95Qcubi6h8e/emggJ64Ya8tt8k02dsZ24eke+9ndSdXO0LEgFVn+qM CJE0tdNqp23eO4DKA9sTM5dntI6cVXIpxiwFPV+HJauYlYMFSDmJViwFXIe8o57gbM8v295zhP1z aUkcIc6mXbfYaMRB1LkpYCSqQ+wkUhPA4lRihkTco8brQOxTxlb63R8XXheN8KpqsBePVJaE/Fj9 bD7lSkDpj755xgQIlOofS4juDlMHYJ1x6+tXV1sKJZ4ev8aDh0oUfizTNmk4SGUugz+cLtidspwi 0ytyo6mR2oDHxXn2gBpqrNidvjV2G0n0YUdfbf0paGYSXd2tZbkJy98livVqUaEYEF5MdHLfKtZ3 1zPQabcQojN3bPypfmiWtFTaeIadO/lm+xypPw3Fh7569KcFBQWdV54MFINlhEcD7N5KzpnlFTPy 8e6WfzVBsWW/j9agROFqN8gwoMV57RPvlzK9usIrkZQed/U+PBTHOzu2z+5SV31/HpDSUvf+S+NZ mp0ZumTV05cs+6Eq0leNft71HR1tFW0dyMwn5t0D0oAs5Av/wLC8/fMtqk+e3qlek1/riYAzmWeL FX4Ud7vOj7s8mSFH0AOvei9DCseVut6RrJij1vkaP5bG4uVdIbJBWO7S0wgt1RY84FTC27AQZoVB WHz5kniltNaJANyQIwJWdfXbrQS+/c1lAFgBzcZ7+nJRTMEq1ERZwJzo7O7uDh0dZXE+yf30UurW e2W+s2URHw5ITS9RQIyQipac/UvVRQFedri5t+FlovOApNY87M4MYhE9bNQXOMYfpNKn/nqRXzKV TD5WspRfDq0IQXs/7y5rbIbsW5Uh8a9UC1FDYEeLtDr8udgiI+Ood2VK/XdUb3GueHuCiuJP/2gp F0zT2CeSWKIdUJLIbyQRwpwGG1Ue+yhAB2C/QWrXHHtArxGqlO/ZhyC/dC3JSd8mD93Cv/lb16r6 9HBeLOzVO21Xn2ZSNIWCmsUy7afA0dBYPfpLXB5V4+qvF5STp+GPPWXqtL2CPPaOc2tqXaa6J4fU X13XqkG7mswceYjOk/yOZk7O/QhHCL9SuG2JgaI0l0Hp3x1ELLqN29Ybcj73yr/fWckX+2ITrVfd 85TCWG0/hr0/2dodnODaVLxd3FrRn4qoyRH3HgfVk3EGX364HeW2ntH6qfWxcvafTBrreDbY/u6c WJ+YwPW4PVF0tatYLHBUaP92RgP4axx8NDyVHD/9tZxzxpe9nxW5byCTqd6ha0qMp2Ew5T7umVvv wICin/i52+VAqZX17dmfLbK6QTBvJgeYhu3peuTm/ufip0pwq+CuZvXR7uKyMWhDfrFllurCh0N+ s9SP/S7bYKo0/lq08skX2Y8Et8iNQ7CHZz0vFftf31VSkQLFa4lOM6qFrsQpCCCjTG1UgVU/zoT+ P3qYzZwyGjf+pKRHBumtMdMYlo8mS0XF/t2unTUNVqWVdcUThY275E9A9Jz425Dq4HFiTDnTV1WV GNU8VaJfTUlKK+UXkybt5eytDpSLjbxzqDVE+WfmW6D+WWhr94S1QzjEKcBuf7EqsSqwgcbwMg2a dNAzukdo07YS5bDI9rL+nwgGImYxTX+ddsz7Uc/LV92upPOwVobNT7yXoP2YWVY88T1ZPOb4DEtU J4nf6WccczBB1VyIPC2jYnIpzcc0ldpFTqYZiIfKwMxm7XybSykPiv6pVOSP/aKj1PKsRo2KmaLv v3vaGgYdUvVZE8abTyE7ndFkTql+p98j7YmPvUovO55Lux3bJ0q7AJLCutepbYmpH04kQWPZIfr2 9movkiA2Nlw8UNsdgWsJ33r433adD3uVw8TkuN8kVh/RDvn7xi5CYH/jJYQmp/Cz2nn4P17butgY OYxCIQB/xC84bVocoscwHucm5oC/b/Yi6Gas5fiY1AdcCPJ1ROzXTxcb14gqUmhFwNbcDjuCQIrC DJDd89De673cx7CAvvmMB+7Hzt84Ob6VzLNu3yYzMwqW+gRe7mGklh44O7gLrJwLG5TMg81bCYn7 u8D5bk/luAfExZo0OVtUCUq6fb4id6tpnlW1/+0hFjer2iymo18QUJJhOLL97qDkPYTXs/hxuOMy NtymKhgGVbZHlK8LGxWYFdEFw8Zf++9+y0Avi2tWZ68hIXMKRxZDPgBbvd5ndW+bEUjZPmYJLKDr MrC/F7imUFDpSwvlNahoWXHhWAmp1uicJyuFBblLRZGD5TMyKtLM8Xqbo7w7UXxkKI4QywDXvt6e TUsKtfdPl5KmQI4hzf99tnL09fWNu5qKEZGM9ceOR7Dx1+jwtwmyD/FslO6GNE2cj2oEnhncM1vx dLzZOjewoqevmXevCN7nN40c1WODtgPmwF/LejrhY9rT2vIKcrxU8f3tN6TIhrRfBD16dZzOJOpo +oC4VM3b2PRu9B3IYoMA+Fc3rVOnuc0rW++na2UnmN9tRQShzYFiYvceH5wCNmlPfLZ050AFo9Gn zRkZGAcKfbXtexmGGqGHsjBD5b/+URi3MTXC96uPB04SBAeiHvvTIxcopbBAYIzBTjH3Rc6pXEGq 7UlzIz7luW+vs7cAV1TBPCgmZ+9x3el+4l5SM5c6y3Z0VFXG77vgKI/bFJR+HTnRWfzzdyvOsb69 YP0Y6bC+e3IS8anHX9T+mw869JKS8Wr8UAw3lcBArh3rYj9s6sGw7pqM7inCWkqPyPYT71lhMupQ RAyyq+lPuAnyA38oZPZk089o5/moi3aygAGIl+sGuEwTBklOklLjt627uAvHIU+TDZCvNj3uliXO D5gc7I/UbzDLTtS2WpoLZF5+4/o5R6+05XbhSvRcYfmvZDaEV6j48fMqok9GMkFYvbcHw6AESgaL SIBsVtU4i5AT+VlWH/8osLIwJzJ1ExSLQt6eiaxl1gCHOoDl1Q0w+2GsXje5V4v77EbREDO8t+k6 iX4B3Vh1nlB+eKLf+fFV39jblesKKoHAzS6BaThRzmv16Jj8ekSffwGdkTz/7m49IgFmRXdFauWF CPJG3sJ2LRHgYTOmCHYjDLXoISIA8ZqISmweHXHE+rSB8jUhfic3BDFtnxH+QRpegQ8YnNc/8Izk PrRaVuD4U11GlmyqOjH79okLC726bGb+g2D6s/prnqQUZn7ks+FU9S7Upsd2QrGYPd+wrH5WrhQW Ixy4fqnILNGn27UObmx5AUFCnRSMA3C/JtCFV0y94WPTDg9DYPpYSR5GhxIyCdXiKcl3Y9YR6JFM pI8G4jxh63Prqab/y67z0NmLehajwHa8ah5NSL/8JkAu8vHvnFeyipUpRE5rBBBye8Dj+Wo79nqi griY2+Rr83+XGXRG9PzQ5lmxzPxf/T3Uxi6eAXFGaXhE3Zs4a4iYGt4BeLdC4phmAdxIO5VYjls2 rug7jNkGbhk0eOiZHxAz97xroXO4CWB1iHmN7EYjQMOAzY3zJ1u0RUVXZfXf5jzJ0giIWeSushCH Td3Cye7+Nbl5P8DKAfNaAo98b28vsoHktKteQpUnJrTq2LP5LWj4cmAovx0PBVJA4yHSEvVPrlD/ xPZq5JCRRqpFj4Ta/kQDsJsJPMr762p9vWa1MkvPB/CKfcUC1VW0HwdQIenDveamcTdtRS9Zk0HE L8kp+DeDqAfkUsZNZUXCfZaRWgswJxi1bff1uTNG1u2gOgfP/XP5ndOF7OycgV6fpKbBnYGDLWwd 4W694vTlm0C8dbeFMxnk+F8hufEt494TibgnwJQKTQipTVUDwVUsgoHxKlI5xHTUaJakHnUi/+P/ M/JcwXTXdz43Yw8drKqWZ93KrZtWu7HLNkrRXqG91gWEkMh3Q6xqSHI1XlmBEB0ex6ynJ6+vKSoi ptzc+WfwoLP1IqREbe162ycl7LGZ3OxjN79ABrCydPOe88H3DiM657D4Hq1FkshvD2KRZO9la/wA veL7Oq2nUuUObyoW9mx1IRqrQXMljxTxCl3zXx+oA/MVZPGnpANyW8Q49VC/Nu+hF3BIG13F+m16 jQreVQC0ZEel5+4h1y+RPAAh4FqBcRrmJM2+Fr6vzl5pkWZk2EdOeOsTFKxcl3TCv3OPxHyeas/t DzyGSZ2Td+xLkYbchNJAAoiNwI6Fe3sVUxNsnTFRUFFeNsTPTYiUpMH7ADr6sHWuzOrH9dVfSLhg nAFl2RtGVaOnDLhJAs0G2SxVTIKDD2UABuiCkHjcOjDa8byFhJQU0t+qJV11HdRgox4Bf3KPr3jB raW7582tK9f0qiFyN6LkWAVf7/WeTEqi4epsQqt4stykjeaHTZ6kIotFkwEQNWAzxsA/hrXg6j0G 1Jsifv0SynNVHIS7z7+f3yIGjTAApbB93vHVT7mkB4JR6CBKtFE2Sbi9uYnedyz/OkEMkeLyLSG1 eXUj8ZFBLK2LR9/dloOcCtlpHdUMMsxoMy0CK3rNbzUwpKp2XEd2c9nEaVWZ/QeBx9gLCty+qmtn iHLRspCnrkhBUaKgvLzxr9GRPBX5d/VcLipELjEjDCExlZ8l2GvJRiOQqVHcFQHJzR3iCQBXMZg7 vPzSh+zWiI79KgAQVsyiuUOwE6yYRSlXNhLJaSBEfuVDK2WA/jMYka/QO1+WSJUtzPNjZ73BrxOe VqRrZGltlEIrxe+W52k+D8dQ0b9+vEjjZrXgfSX/lwZy6s9HIn4+vXjeH7CSZqlm/tVRrXHLZukN e35tO7YYiNHq0In9vCi1kpvqStrvZFrxTmX+ycbMWw6aBnRJKlw94p5BGstVUSz7bE98BB1IrUpa jYMpiAIWvDE9nCO8AwORJDBvPWiKto1UtpfXlQ1btQuBgQMLHYQOdDBPnfSHAsXIiPr9XQSoC3Bg /RE1/KWAeN6pfJGAz7hyoerOqtZxuMYHCrX5JPo9/a3WAShqDn9kOLu6ubKfIkbQ0fYmoJjuR7FV Sa9tmNOxMeGrM7dVQ29dTP6Sx0ljm9hDEvRxgDmHJxkcScbPiDvX7GfF1OSRjbM39h4FemURqhh3 lDrI/zZz2g3DI+rlIOt0ueapeprh5cKnKI4+X0vo5WCPGkZmeH4EQrivbkoy6Mb3s6G0ThZIazfi UiLmnL+vL++OIo1EQM+0smQmU8CJDdMfWh2dz10x0kvl1/aLFGyax0M2QS0eV40UD9IBmKSVslwk G7Sb2AhaJDtqSdL7HKLQ399techtMKQUYpsTd9uVzy2BeP2nuns+IxBe4tdHUi0w0KTeaBSgMpjJ qE+jXh2P6Osn5X0gmcparjep0oJw/zmPjXvKXDso8GFJOiuS2ex5u2ZE2iIlhvufHfhhuUaMTOAf EuVhxnf2b/zj1m+eerd644cTGWOQKFs8Y2QujCcYcpp/qVPbPqFXsyHWy+EW443IA0QDWs3IkdyT CfD81kr7XPmrY/6pImHxNpm5aRsmIAh+yYexV8D96ob0uftdlncgAxIYXssz9L4GmNO9nSwxJruf xqJq21OwQP1tbhsjB8MPQN7KtwHy+EQ9HV+Qmk6iC+klJOClEWo0utDvP9H/uXmDVLrV7AO0Ex9/ 3XrLfA2K2Mue78hxbLrcmcXb61gQqGj1oMsw2+nbV214QEF1m5sA3rv0au65roVSPKQGqLxWoP51 Q2plhchJEMYM4wXb5mjl++dX6WpC2/kAgPb9c4S8mfmO/zrHi0vRmB2S3iPpJ3z63XwfFg+vreut TxncUSvSzsjCn+uvW3AuwqMCAm0CCjDxiQOAJ2K3kkhiCRWv+jyuf8+ngcwR2kSCZyuHKIZgVusO 3mPkD8bcC8BL3o1dlpdgcxEEJ1KO+i6qf69u1hJUW5JoyUXi2fS/72me3bvkNRcwsuhRCJzOMh9l SxUxiqF6jgqABNfw39uXYEfHpPNiytVwhAqJE+nYRkIBW+fZXu5bCqF3++WTwXeH5KF3MUshTzrj OSeTb8FrSjChOD3ujoJ5vTxKXqBRKTA/M1NJQk3YbSnAvnFFg1wjxKVcgrzlLNjMWId4UOGo7JYV De0f5Aro8KUagAPQGIWWmwXhHXyXlV/zpKUwyXXC4WGeNJTV2oXECRSDkrn0lF287h6Fdv0x3gW9 E9L9Bo0epGNikT1yOJLFWOZNsaL/vhgeoWAAzxFiNKBqxDuku5mZC2FKAeu3/rlIAmwEfUpS6jXW u2bTUATHWINJyJpbdCT177DWbx++cTahby+k9yLlTfVxYzic1D6UFzMM2EjQvFCcil4OU4lijLT0 Z/BeArmLMWbHbjxgIYl85+8d0PseczFqUtvdclhDJqAq4kBA9yA1leS68ttlS4CZbk6dVVPQCyuQ RKkkmMUstAZTzmL3nbgaf6ooGJsvrWeEMmeB2/4NdKLMkaCg3xn58IyHhluclp85MM1vhEyGxcFR xGpgR5awdWv5bwB8gUw21uzQl7FIzGY9NKyKZ1v/+lDdOxXVmT4qwN8fkR+dBkbzb0do0zJay0Fg 5GajNnVaElRoViDNQCodzBNgRgIhmv9ObLMyYyvXRO3hZRzgVFtYqoBUvrv98Br336YnLjWxKa4I w+ejty3MEGqdmhqnKvTZOp+Yi/qCSzXs2/b+zs6TMP5JEx4aNO70qAtBwwkRSvaRzGqRWvpfLxkj cxPgrQVu1V9JpzueaZxWxYEMOuL+qdMDHBCNNCfb96736KulZDFeoVqzhChndV4CV9pa6TROv/i/ zpw+WSfSY9vuDLhUeCsJbd9P/nwnUF6PchoCBJHIlCP75We7n5RCGYKoZNmsaD8kRrKSHGl0Wy7p FoYnHoGTUXiJbFDvjKimMRa+o0sqSYSgDiqkwKzaWukpXqk/Lib3axQ00QKTBULGSlSVh6IMTIQJ pqkpyX0+srmNU30pUUwLvf2fpq9sBqAXKNbydvKjr86jG43g0V+xEnGz6jtspQY7up/XyaqEfVg7 fVpfOq7G1j36hge+qJ7EFAkKve627DkhlUlkjN7z2Whgffcsh1ZKZa3uSWpIp6ko6khCc/NulGSY yMhvE4qh9CACleJUZdhI+6BfHZChXpb8FVL5jZGPOnMxQAnm1zjHb23tWC7EyoyjErUCtjrwnGbM jdQLx/iH/cLVI/APfPMUkCB37AZFG4IfMmg+RK7YnSfXF36BjeOpDevfRd6HkrMDTkgXQzY3Laj/ FyKOj8aYX+x5f0rYvjhruM+z5qmif9/wwRu52XAW6tduAuV5f8E5cpHAtR+/1OcKEWIwo6LBVKLH v2P6sF1D7G3E97U5cWhJR1g/xUH/M0ESJUZ4R+iTkMbfXq9/t1C8eAk7D+uR+/ELFIq2yjyVVshz Os8eGoIYIUkioCL8l02OAVRS+SxpdIP1Iypk16r8RGdAPhqXL+zVKc00Ai/bzPqGwqwKRKSQbOy4 /datRRZV/ewSCP9LjjZYqjhxyV7PMMzOXrDSiHErcEb6vJ6AKjLgnh/yqPc4SDLCXfiYqxPeHxxF OyUdaL55ULwawTeCQCRxnOKzj+wus2MsDYD6kgrB3lu7c1KRT6tk4N+yXB5OYD3F1g0N9KPeHmPR jCunGsnFl84eG7ODHaxo3g+sEkTkN1TI7lnRIHfhlRRCAuHgW/c3/mkkNds/44XBgUUHbgE6UTak SkIpp1pPKPZelsQJxVrg+WA2hb3P/wUDdxtkJNRaw2zGNh3yqsBQ4CO0KkrE6b1DbH/A3fV8sepU nbtR8bYJbWIxVjQwSLqWwbfXz30n1WyLn+yTQnVVmEsQJfLS7HC/Pm9gGLqkuLj9CUpyCadtwH3U MwD7SkFqyfBlXiFL1Muh6rDTOw8S4/NgqxHBPhmPFQGhTvhacNnEhbb7PQDtco63oAA+0MqkUJBG q+QUF15g3n//j0V/R+bndzh0QRHkAtBvCA7jAxXuvAOLVMKaLGHNgLDnkrc7+yLtK+hIAP0OCNAK Kcaiz1lZLhRNgTBaB+xF5eed/y6oaRxcLq7PDC0ZTypUfBpfDKo/AE/1XAKiDJsUaHxfPDGZeaAS xdfU473pNtiQTRsrg3j7jl3gX9YJ0ljdOxSqtpXYwhQb4CTwliP7oL4KAibjdUdMzc1qZ21uln6R wTUAm/zLDS7Xzt7J6ud5Fa22YAy5FZ6qypa0/LT6rcs+UFziEnvFgnNjSHfttdP6w1NQ7IBPu5xk pFmbpdmGCL8Y56KIqTJP5JArH+m1QnPN0qpFJ4NpqPT98wmJP7fHMMch10yNifq0McGyegklGb/x KKOo1wAI+6GTcsiuJeE0IOX05smzvdqX3UQVYZP+ZIS2UNERmc0Es0yT4J5nR50ZjRPehacs+78T SKo//9sc/XyxcXYiFtyj4FN1AjV605O2wFyJDgYgkU5kbDb9gQCBzVZdkTfn/3T4F4iz7V2JQKwC AMd+DyiTz0w4/DzISiOvVVohw9GpvpPkqbuY5bAEYSFbMxnpF/47tr5ykbkGBLaR+j3MZrTNQB+K 0dVqnordOxrkq8zHvR9OaTTIs1wz1VEbOJMhv5c/VCbXN8hOKXvvEPKBYszjfOEERqehBi5PMhUv Pps8o13PmxXG9vFQeAQxJ2Tb6ysvX8fNt+YmikSjDTuhzFjUCgcVLL6G/6+oyalLrAKlp3Rm8UEs FCF0KKvx7sDZM1Tahz7dRn7CH6XPTkg87gD5Lu9lwNzNkTvZBj815plwJ5zi5V5n8tLS3hGhy0Wk wZDwJHBVpMdWZbCqagO57/NT/SWd26aZBjEIdJizf4JJf3TdKxzReOvG85BjMBAtYRQbaKLdtbm5 wG0B4RXqcwvX5bVBU6RIEH6d/8PhrFVCutr8WTejSoxMwNgp0NyLd/Tw+nr/xdPicLosw87Ot18+ FZxF1snJfSLto20UJF1svfhGAbTCtawYLzM+0IWD7JubhGN0sQ9d7GJIloQ5N0E9DafKBDET+E0m rhV8gCL2A5U5VgHiKX6PXazyj6bbSINi1/ZGR30LvnMPC1z7oxGCewXd4lQnNktFqm26K5okI2qE 7/9g3IXUaeYw71/SXC+3oBx1SbP6hr7FnwduDDS7colgoJDJgZs6kVEkpp8y+aL622CiwPQzU2YM jyZ+MGUiY2RxHV096vlSXZTTsjgZ4CuM4uk7A5WXxEgH1fSPkLtAnvlLn1v7lxBJvmc1SC9KbFTa cvNeJjaWO6C0QnKnbxPAUWxujuZoL/ic7kLN9VsVio+o35c1n4WTvkSYOX/hjN7xbrmTh//TvfwJ wrIPRWuecRW4rUQjXgFhV2s0n7l+1fZ0BED9Pd30qWAIfyD100clinh6QJovqyGxofomGvSVD32T qEo8TvEU/h3Hpt8GUwZfPuyDQl0FnZHrhrE3wC0m9hkk4E7lVrgiJ65vLiIrVl6SZPqDrWswfIrd zOWnDF6Se4/wT7E/OhxynZuJPMiqqS6LzJY6MhRnt/P65hrJBD+S55/foAE4+QlPfHLz+gsszEXE HZU0IUiDId90afG/A0zDPXOYRQI7Dtwy4cw37mT757smWQwxu9f75bstHBP1X87/YbKdZyvWqE7t 5Fbw6AfM1lc7bYrvWiKHQZBeTESkPVOOeMC34+/g40nFQzLvV/OIfkoquFlFwV2rhj3ZEPnS0l3x s8sbrMXhiDV+YoF8sC+DrZw2CTKhIyt2tr6ZE1AbmLN7+flMHkTt/2OsZIrV7PRHcXzispBkBFe7 tj5mZN+/Qa9j4Ffbigblbto9kM3RiN8aRZWgTtZz8K9cX0TyZVLbJqRx9H0VTHvaQs6DxSnGWkdn LilS4HFjSYlk15WnL+44OPlVvREvgav1+VrDfIXAkE4fpH8jOuHTS5l9ncQ4iSExy8vV53uRxNal MHSrUcFhj0DPKxqnDwF0T9MjjTfGHOZGaRDrPJVWX3IaYz5YkoDhjCfJFiCWGRpGFwQI7Ot3v3DH /U8dKLY7Qfn6S3BRyw4lphBzlRJm2DBYLPDkhmyQvM5pTPlNXidc65+QtdRZnbXLvzGJHbeTbXs7 exUyTiQh1akxnmaplyv018fWM403D2CMNMJDrGkQdUDyp/+OqnEF45bAy5UoU3dbWy813gZ46i1i qYUh40NrkWx31fH6qSIJuRvET3AoBNa6A0IrhRnHXo3SvNw9bx0hV5WrpKAXlAm0mk1iYlBBv3V+ kt6DP3opwt657+1NIYOelGd9WzdKGWkka7IZ6Sv+m2piatUkIRbLVD3zmQdxMyfkmvF/DwSDq2f2 MT7wJacxkvmn2Y4vtGjuCK/6vzA9PNJjQD5sJQ8hkVtBfeE0XX9fBbNFoNejagUQsTMPpAjc7lxz 5JjxIieVtely67/p8W7TTtASstYCWF2znTZnnmJnj/ESfTe+mcfPqTL5nujvvxDAu++XXIGbkIO2 AbnhCIGVAqZcM3NDn6uprJP8MyVsg1VyMvO/Bc9N5/aHP8A5YFN3bzORpviK3yt4y0Bo4sN4Hdj0 nT8Axcq+SlxeI/5cwgBa46M2tc889K2uU+BaFYb3xYJHlXuQ/P9YusqoNtslWNzdCsWtOC3u7g7F oVCgEKxAcXcpri1Fg7u7u1twdwvuFvRCv/s3J8n7yO7szOye82IKfsfUjcuiPPF5vUrQorkAMers I+ywxaLzky6FG1dBbi2UzsksIDtRIRPp+LtOem7u+af0l7c1jE20HR21wQuBHeoP2UcvA8esWloU GRmHv1s6OM/+DUJVVE4X8L+E7xvLgHD3uYldzj26C+av6NOC0lYk2PfyMpxk2sfGqWXfV1uI+41g Te/99Hx6lYWus1FREw+6FcXs/T8/xCoJygzHg5tRiqzHJiPhRfPXOHBljVEV2yL+Bd5WQXiZVYuU nX7acOa508o5CPxFQBEhoGWC/LAG9Voni5lK0fCZzwbD2Bp1GqDlaDjlL8oC+rn4rJn5Z64OEuqH yzpVLaqrY4OZcnXEIH55YaZL1HPYbXyEerGwKG1VK7o4kA1B5jHmL1VEHddFRpeTszUi+5rivyu1 uP1RebPFr5I9vfYvij1cx1wjkZbwhMgO4QV8mlyuBa+lhLttFkSKBglbWvc1oa0jwR9DHmhjO1ry sGA70/ZG22tKMw+bJ0rgUsJE/xxWqwDRZOMCWgLnQnrniUC6IAvC5AAiXTOxrcOPQ2COd7UIXwrX aU2ubma5d372Zpm6x5MRP+KXveFaY35+bcLhH4A60JZFfHXc1RzjIvAPMkPBS9JSDkJ2sAQjPKvh 8yrgNfoeNnX4l6UdiFU/cjjKWueLzhryyZvHxzeqJ//lYCpMLIHb4W7S8phqYRL2fePuIMHsQ090 6CvYTii36liB4vOLbYgCiyCFvFE4dSi5IOPwN0c+ZmC/25uaPbn7AWwUSJyyDxqoVQkDSghd4tTg clF+j0z/LWKergyahDHsePPVi0COLPmiXmVWnip65tSsuyJ7lxUbaFRMsd8jE9dyaHThgbmyb2xu l74AZB8VcI+qKOa/PiIDto5K3L/sPOaw/Zz1yqRqHmmbdIMSv7C9CV9CkKD0HJIiyiRO/BW1cCEN 5Y/ty203PmYqIF5Vid8wnY1CDtLmdr2dB6aJicBJ+nVoKm1AsXkwtJAobWNC3yUMTouAkc6hwuk4 bANqqag7tNig27JhSCX70y2xYPfppUXkOFKFszGV/bGk//h3Y998N6nKlgGADKiGRvGMw4tw7s1N d+np337iUByG1d34S3dEC0/7zfad5x9CmqMfqOc132VraHBE3TFfayenCvBhz4tZUF45g2ujo8/G wXcgh/MrfCSe/HfKAiFx/z+IxvFAHojTG/S8aqe99yQKl1VSZyqZof6XPQEwNEkIQDddnfPQ1++O r3MKSw/Hf2x/dvvX8VvbStm5JCaT2OLmaNOc/0FtU9nT45YEjPn9u6KBk4NiMC6W9pHe/eKC3bWF rm9MYOcGjlNzDT3PXiJtzhINXOX+uft8nZ2i/L3QdrUpXZgkDpsgPcZ/psY9ccmh7qe0QyWIhl6U vvzqJo/xu8ka6/dtjWaqXEySSNFA4sD3XoRvTub+2iXcZUlZbv0UEYIQ8Je+PKK72bqkfwjXegnP CjEpR4ZQCAIrhv+8dMU/eg8qiB3+aY4o3Gnh6cVrT5mEUGlYgvVYgn0dmSyuJaH6HVUnr1YHBdTu V8lJyo2jkBuw6PyJYEjcIyaCY2mdXXh8o6Ym665lNDMeX1cxPlGVG+HNmyR6TQB9XXGhajcxE1lw 6DZjDBD0kKkrPzHzu3RDtEagRFRhQFQ3/c3ljwCUY4/kcjAngi9UEp9ycA6qx2bhH4lf4JlL3SmE 9cJMZRIRz5KEov+LMgO+3p/6rekE2lF7HKlzZU7adTeU8uYWyQbXyXnWdBMFHJ9Epx6pX7HZSsV7 LLdBILEw+7A0LudSN64UYoVxTyGBELA1dAGtLN2fNTQZJ5nvKvBPwN30jKoXGYAdWbRA+wz71nOW 3j6lujNfPO2mVPCRYYX/RjL8MYXjXH6JqORWPv4sRbSDFmV6SBR7RBNfS8Q4/YiBzUaCKjcSaixH SkYWMmAEF4r0r3B510vagi/orLcbiROPImusnJQwC+QFFK2WgmsFeuUnzn9OhMm1CJ39p98EbGj+ Dom6jc0Z6QW0xBYEjQVPZ5Wdt3AVv2/9HhwVhcGAL9i5/9ZGiwSwtoROwieAPb8OUzuThOYMBWcI 4bxK9kMF20A0oolOuhp49qoIMGPHfHL+8ta+QAr4YMmJq3xnEQvQHH9bbHmNvQ1YUGFii5MWYpUd AAi8wPetut70TaWOzbDzzttYyeazT5jptPOlUnAk1XXBLxT/kAv4iNAJxgVhrL+hrfKx6ZQ3c/+O PZ2to1fZvU5aaVaxxmTcAAf+DTfNPdsFRDG5760BpSh8N2Kp2zpWxdePHGoAEPv25K+yEzteA1ri z4WzcBeDB5o29P4LAeWsxtS8nwOANDhg+euZKjm5+gPJzXIrygV+T27L+nOZpycikP2Hch4bGejX SVsZGgMHob+qFwpXjmqK1896jixdg5gc86u3JmCzL8hJ38I1XXCNCYVv7rDp4HYucHUFJy1lUCmf YWIPuqtCTOknLOtlzzu/2ZA3l7cUCqg1fzIZ4C33zQEStGLqU5p2xPFxHDeCUSg4dWhnO1fWkZfi LQKJQasNG2AVL7PiEoMvqt4n1Es/HPzBtuPys8g6s0huSMzve4a1lAzu7z++HJbfK/d986ZYd1AB XLcAp+A053QmkXobpyxsc6YKcVtxv1IMjvRs/5bl6KTzMr14/GeaBdxzj39TrRsrsk43kZW+1P+4 YGE7YfHctx1XM0nn0NPzW9YgnZz2Y+7w3eNbjb7RBHBGbs0Tb6M1WPAot9hXo7mJy13anmnl4FX9 beT47JYOfE9OWy6TeO5p+J4fxi1AKhsSxIfgRtXNwq/c4rUE5og+cLD1G8CMx7Ew/uafnxv/T78O gczt0oDiAHU269OTUE8SCNMlm632BFms6Rlv6TkvS9qfnFDbf+KuGmDtXF676cgFLAbXOysHXoRa HVOiXS+oVAkfMB/yieYHFCrcK+oKRf+TmTe44lMLTcEsDUNzjTixOIPf+ZO0Y1xJD6o3j9PmQnFj kfO0jxXd7N+9cq8jhZd0UQd9krQj/MdagWZiC+BoPU4o7KhVi+n31u8U2YAax0/9u+bJb43iSEC0 EsCe6EIHb77Fd5fR9UF3U1dMycKiL64l9oImbX1KoN++uvq/zFGWurS102dhVRHLgxH6eDFHbpeD SJmrPRTt/IFTML451h837Q+C8uZ51nv+rQU9Nlf/KacTs/yVNh3D+ePU0Y/Yx7sitPFqfzR9cOnn tAXj5UT3GmJJ/3VbI8HogzKZZyOrLUmwwPrU43A3B4qJEUwi6alJs5xlo0aFsG8Uji1uhCDWsErO GG4zBwKrpvRCp8XRsVF6cK3KHtE0WJ1vVNEg1huX4omG+Tcli8Wj83+sBcDqROUSOzrnUKvrUew1 FcEhDnF+SB68LMRl/sDY/D1EcUXG1FGo9Dxx7T9AZcVZZkGyTm+GODcnleARo1g+61IaYbf0IdQD tFJ3dKWUV96//5vh5m286fHmg5tkCJUPNMUIpwjfXtV+z5861D7ZXhqV6Cof9DyzKmYcWyVKaT7v 66BJ3629xPl/4NH6B7KYd45PgcdqOwG39kLR98AnWBDC2iPWFrXOGa8k6niVFOarpi/1ux9xWG6s bhxvdABjHzuXb0kIAa3rcWCBkw6GeqbOssL5hgqKqGdsIKzXKvpvbsYXJOo/ECIGcegfca6qPnI9 3H9cAsd9BX4pZiw/jWPKdzDnQtfZUrNdP3d6z+/gdRqpWJqzq3NDnLOrhHZQbXhKXUwL3ETkZWht 09utSf2zG4pbvvOaWx4OK14mfwqKINUA1aE9xzzn6H1r2QL0S/3Q+H6AoT3Ln1eB/IWeg5b+kmcM 9JYsVIp7mTEZdUvH36tMpNJndTTwChSkQGeJO4nE1MXgDkCksm0AyFUAu29MXxrSiItc6cYhL5pv dkLKuI9LowIran7x4ULeJs6UF30SPhpf4u0mR69bI/r2LfeOFpQ+QIjnBXfBdEV8JYe8z32RC+tK EgAdLvEzAaAJu+1bv66vOpGCZd+/Y9fqWCLra3OdR9ai35+NT4kb9oUfrvL41cT4cArV+frzWLYe 30wZF6nmnkpIdaM7QuBJql3q3vTi6M2nzMOeSO4p0f7kDjNykUv6tnTZjVcA55y7dfQPuvn2zJSs zuFWXeHRFR0nHS+efbe2zk2CNd2eeV4lZZekl+jt/4+CGoRePogfLRBrLx8dcRMPrzvkL1LzRDX/ pIK7Thq10yXadED2v6HR/7fkfCuE68YpJc2lWtP+UF20uJCFUhB3TSKxUtoWh65SPuQH8zXMW3d2 995ArhlOKGSchqGk3QH6QooZKPMXuidCH9nTgIrnj+LEvrolf+I91JsFCXNNaFyJOQQeQ6aYNeSv bF4+ocY5lkAylgpeWnUpyVVrQvejgnODqUf4fNNX7cLoUJwTPO8pRH+3oAtz4MAW2/BnPJMPoNbp davLgADFB7fNk8r96aZvq+03Vgc4hrxArFRzafHriWMUDfZoXPqkPbc/qx+IuDj7GSCU2P1fue3+ I6dOB8QozCTS01t9PTh+pNed/3S3FHOIIUAy9pU5p6eMl38TwHowQmA4ciBAp07TpBOslL+ixOFk 6f2XhiWfGMtP8EwH3DCyZXgn8Gb9CXgwpXxbwJwk3BNZFQF/KVJ0XhVMoIBHqo9nwIKBofcnb4iI enhr1fPdlVRlYhaBvDtPhSuXzOf4Bp1rJX7L0RjbdbX+QcKGwZGQnWNLQn3jPGWnv6clhHCNdUQL ilSAJDHccSoZ8iV51S24sECIfCJiawKF9huv5k0XFM1VmceE5aSocHP0Hl9TUk/xThtvvJozWNOh UuMrBvBAozV0z7mYWKPdMal415VVD/ZUSrAtHGp7T7CqFyekb3AKJi6u6VCLWMuA6AdAPR/+DbTc j1RhAuMHrebiBk377ZdOQ45Ev7sKxQ+1zl4njSOKyfuBGtrRTawEPGgoOjM7Yq0N5dMPHctPg/8Y aYA7No6XR0nyvVWAtbgpVG/TU6XnR5VNuuVg3rKptlmhRGqXP/yc01zTCLSIxpQONoBj7GlTfxN2 GoqQ12O62b0nHabRaQeWBsX5t2seOrEeumtgBpO1UF/i2B/8JgHQx2/wiIH0sdkSX7FAz2Fl1L7o QOspVYSmA1y1JTGojHR0Fp74C0mH1mDpJ2KBB9XvjZq4f135DwMgSGAGSiotbAFDcSIJSq7aKxDI w+wxId+GmZTmVBfUR60Hjbztv7SxDSyNMrF2s2DI2OAhTyiaG0xGvB4aGjrNGCVJIlctlUHzkc1V QLhvVd9F3At9HzoFR+EXobnQJYKOX9Y34HAuGai1qlqT8m4wNCHP9ILgrcTW7TY9IJCwD/q3IsUT mT19dFaueZqxdGroOViOVDipTavVI4bqDKCSOyrVo/H04u4bE/H4BHwHzBQsUJNs93FzaVwUBMZt 8LD8lm2tq3b9zG6X/s7xZrP01Gfj8mXu/wxl7tbGycuMV4Zw3aF7Qg8us1hDTD63jgw040JJcC1v XlFgMGTY4rqPAux5zYZhp/oxmkUVoJNoRrDVugPMJDynQMTBZaT6SYnHMX4RiAg4wZ6pJ9zxxtXK Tk0bTJBmWSsyY77dF6MhJPEMgMivIlNv6lJwAxEyZf+KVd+h0LwxZcIE7uQfs6CqtO/Q/lLl2fWl xbicTHvE9WnDaUsUZDkF2AhCh9YymP/ZRh5iF9rpJjrt7SvWdfzD6FXH5WoJ9CJeq0p+INM6fj+S 2EZYPOI3/+YVbi0vJNp2Afzrl3a1aMeddYalar3Y/aZ1ttbApaT26TTWxIG9Pcpu4PoNeV+f/hrj T7O467krpfyvJbQoUQbCRCx8IwdMBCM76asUE467xLGU2jfWtAGv8eYM71nGHb/yqG+VMjNW1ewX TFs4gz18QKSlfIK6zzS8kyFkOLR12PyZC3xvoGpOO45KbEmpivdIvQ3QLNUshkYc3WlM4f9eyE8c GnA/8odl4/zxjXB8kKNVFwVV+8shMaFA3BoYCmaMBOMHRby8PQBonmO5jg2G/ZfCJtZj18poNNFO 4+psEExJyIJ/ivUDfRg0kJel335Q/LKpzKFH5Pb+pP/8LYca27in/R49PxlB9USYmmPc008Rn9RB P+nb5+szINGUeXSlDO+9+d/sc7e7QXB4iqboUESeJyv7P7RCRs1U5+T5+mf4+S/p9K0aUYdXN+cR 3vqEMJCkZGwbkMFHdZzYtBWRWguuEHnzBdEzyLinkrQdIUX2w7kr9dujtTQVoRTKNOEyZTRk+20o Jqy56puEDiHbmZJlPQdMd0egPX+yf7OMAx8s33me3Mzj0Ru5hTChp+iNMn8lkLNuSxeo0cTWjpqa cF9NQgjxIXl4GzcEcAYqJe2ViGg8DZ+swm5HlqINgHJTbxanQmSgPMdEImd5Nydvffz7L02sIwC2 QgtK91YlQLxpht/kLu783kNM6CR3+sLOSwBNZQvYn4egNxkMI/SQoiGcrAqvG4A7Y8ddBA0nlngV 17EzRsqvziJ6JnIZnmfJ94qwtmVUwCX/NdY7jbAizUSXP08a6kC4OurvDdXKpwqVuWqhNGwxslcj GG//6eBlO9A+c6PVuVckqxEEfeDDgh+y2yw056B8iuvoKBZEfhVRBiDt/8fYTqFe4O+Obh8KKXOz niPNfkNnFg+A9ZUE1dsQrwmdbDE5Nd+ILto0+EYzJeieScQLv4j6jimjRVRUY5ZVbJVuTS1IjzeK +SdEbR87vfydCaADUPsN2V8ltyhPVnVbKeeA1fmQXW8odWbsOIEV2RLRcXYDPEnz5ku+JqlioZmY JLunKHuFnKQz5WAZaO8x48+i9z2m22fHQ+My9U01pvClgPceMNc6MtQ64zp4RRo+tXpAegfzWGYN +UKFk33xHb3MGLvPvZX06Bfwb8aoyirPxGzxACCMoZaKv1kjk0edeFJenb4/TdC5IKYZ0UicyjEK J0Pw1yV8X5/joYOYJA7uHRzieKz4GFq1PksChVBiw7JVP/pvcejiQz49ypoT9+RXgPU6Pxr9Mo4K Gw8nSsKSvI1+16JChytHzjG82wkQHQ+FusGW376SX+u/JnzbVmxCkm8fua5DhTbHBxsw/Iy+iFDA GEUdv7f4R0S6CVgtvGfUt07KXKYQAixUEXsurQLyDHiDC9c8gVub5QX5Qod5n5AlG4fomvyfo4Gx DfbVLdYU3Q945gN8rqxQIdehKATzQwLOZdylptj0lXLl/g2VjF8HjBoJ820woxIUa9j3i+In6wWh aZ5VW1cFeAbvqfrDGzHkF71VC9GtwyLfdngkd/OGBTue4dFdKaN5kD1xisQ1oXpeEbkTSznyW8gB OsAMNfBkJVUaPk6IiwHogM5lBlwib9Fv8QeNJiHofXOV7lLKRTTob3speFmA/U3miTU6pIwWAPqy OzsLT/83r6MoDSdkIK7jgLhz/1mCLnvrbezHEfwgp17c/VzEq8+B08qP/gv0IcjNL+vRjavdriAi L3kC6WmS5veowK8338Wx7UGbMuY9fpGeSiIOWn31OBMH8qV3DazR85FegdDrPXPF44oxjH14w7CH TEvaEYkZoLkNXrLiWSPUuVs2FLZ4IDoJPy7WdFFHeite03u1NS+Ct/WmCzL4jKRmqdctcnAnI9n3 L9Dh1tXJ8ECLUjkeNbo5btTb4Vujw67i/ZvyWmDnR+KIIWMGGnNRCK+VgXBzg+XE+gUkstw6AjE9 W3PV/ICezz7/nzboqeaekaXGV9+I8y0j45iAdBYG2WdjZRSoyHxLCcGfyGX0z1htyhUL6nuLFQEP 8cxAHXMUmiEmfPozt3oVFlxktHg128rnFrcCfTUNrugD9gs3rLeSgnqH+jObwJMrXFx89weQgGj7 k8aMzs1uVybExuPsD/kycgFu0JvWJQcSjARRF2uh9GZSSvqDggzirAVEBHkyqq+DwMicfthX4Zg8 0x3q6yivgvv1T0v8QSpA+d4sWVEPu/pPGuSycURlVRLHZpvjmPKFbgMfxPa0v5kjvjJc5zw9IAHy 9CdJvOCwbo1X6qZPJz3b8SNzt5wTQ1JdDq0QSkOGmD3/zWi1UvHiIiBSDGOLBY0iXjSq0A5mMSCW ANknXL3lFAvG3wvkwdt5980nl4F2pfyxCwoLjX+HEdvjFthTiyVrnOkgMgtoaRbSM+CqaUClav58 m5B3vdnFMcuyUKOZSSUKbvk5oMoxiLgNkJMUIuPHRfI9y1ShxEKGmw7/p4l8QZZZjaoS1VSKeM1C KZJx+nSa8rga2GMkS6F/oU2zNkeESovq3+414PV+cCTj2UZNUHZKaRurrZzBa+9ZMglR+VBCKBOI EAPHMybyYaAE2v4RR2GF5N0YnVz8VV06gpHVtBX7Sn2W+F7LWmrqy+EQGbzFAMiJe8oubtC/KfYD B6HYDN+goCAxo2yXftlXCITFhPI8EZRAHsdHTUMRLCVF+cvwr4/jsfO9OtSMgLMTHAk9DQ64+abh m5zGM4fiJq6Syex6viJC6QtyeZMCtp8rx5nUEpJ5zPBReg1Cpjhk4/SzYZHt+xa6Mu1FJI879eph azqGyk2An7ngSzGaVZiyOjLVxMUlJzc+jSIuNByzL3kUYGIX+GYgU0AlB9Ast/v9K704cDiTUpXm +CFhvb+WeE2lKNEmDZnVSmIMeSTU/CTofBgDkWveGgLJAde0CkXaEmJf1Hs26LI3ZHIMXxddjVLg I44XqEcgnomZfopi4tAB3u7yG0EQau4Ew28DRNP8B7AOvFj8lRxQZHZb5PZdBckj0vxuvlXpZIyH VfRmQoym9qNSzePGOCtcGcipL1BAsXtNuBRkcrDq6sC3yb/3A6C0UjEsZqTmzxyBB9XVlSJSs7Mx IIqN2iDxnZiiZEvSA4d39gj/Na88xNNKLzAZQL2ZkZZ4F1I5+izSqaGBhIiF1wYFICTOiVZ3TOza qP+oXHgaLVLQQk4wN1ew6gu8Dl28ldJQavJQMYDCtgDptxoc5zf4jKA3DEqyWX0H1AgTW3H6kNO9 8A5ItV5NOPAlBjhMQYGFOa/yrQjVD+YfpLRCLDN9x/JRbVHRMDB4XYip94h1cMZpNKdLV8niM1XE TC/djCw7FQL/YQpk2tjJKoABPyRc74OeXtDXbYceQorLcUTcgvAdsnhoPt6BXXG/oKB3pNGBb32D Jb3IjY0Du5/Z7ySciceJAu+P8hUyncMPj3cBFPQiv72tOnNOOt9aLESgds52VZLVT9xEQVIwkNfS gxGwdV9KDNlCDJq9HQOL406D371F3rg7jl5kJCUHXD0RVlWFx8BXg3dAEvFu2l4DhWshAiRYMX+i pvfJujx/Ol6BymrcXWRUyqRY25oLJTwyeKp1aYmcyirKLV4uMENIfBVz3BruNBja9qv8OkTyVTnc r1LWanwaLWV2sAoIbNkIplTkSx3LLJIrrB+T6gDEY4thZsH0RyW91SIoYPH6pSYOczI01OK+cxza 5L6jZnERkhA/kBEBmWEpTQ/39Wz551RfpIxgPKWKa/BkwBQId6jHnQyScGL1PP3RsnhpJ5owB9Nd UxQbc2+t/qkfGPhcMSN61EiUaxu+LRsRPBN2fKKuvefEFkpJKhmKRcmYj29e0qzIKuYIpLS0C7+p oFk/qiFN3HSbHS8DenCMcQw84Ev4Lv4J+jdmIPY/VuHxWstRIuGb6ODkqpcWRMAIc3RDxGr83C6Z Qi6MnIfSxUrfXiUTPERA3TrDqmmY+mCxoXuCzheEHqY243nx48zNMgxbbN1eo/f1jqIApyEY+NxE o5bZUKWiVcS809cL+8ExmcFxbupARY44GEXNDGPg5xv40X5tJusfPzhVTqUCA2++ZR858hCbveNA 36ECSZLLBoDUO0rUcN+am2jbkcaZLSp7zKwiq9qp0kIEIoB8OUU4sczHRQdqOAOUUFg8lWJc0lf9 zTl3O9skRLCeop9iG8M/lsm2d4RbUAhbHJza/uXkvqTIknIDIO/6CP8Go0H2nYEVqiwJg32bJ1FU 2KJCxX70nKwiXlEFtNQWopjTRcDeudeHj4p6Se0QEgVEuk26DZCE8nQChmCBC9WxYHxVb/RMZDSl rUOEz3V9AZ60wzE8Q1hx+gJnhAfV3RwTRfQrjwpITMO0IyKUfm9Kuu9ylQgu1y27cWYvXe0n6eIC HJDExqEIE1MMMOfdgih0mFENwZ+2eJumE6i9je/AXJg35+oE9xnDHlSbzG048wQrsGN+O3y9PYYi EDQeIqzdC3vfrutqM6CBp6aysnbi2CuKZ4VfJdX2QaESMJfOiDJTdCD9ys3eZAhn+u0yhjo38ge9 oEj4BXKC1zSfehVuhYUnpgHNITLt6wANCiwVGEuk11pYt1vY6hFc3PuaEb4X8Ljmt2MnRJYY/iAz 6Ou5WJV0DbnccegB12e+iFa3g1YPOmRPFuvMWXLEY2d+qpMy0BczEZ6547VP4QnJItk8sJ6CTG99 oJvgYO4mIdYsqGylbfYikDgcjtxF44BDDPfIxgkiupwGWc8/wnB6PIoxGjAGZ89ctevI57Ic9dVR qJdjgihFFuxgVfJNM5MHoSBQbuP6dZHwF32bm4+Lmg4mE/sRTCxlmffL17yYImC4NJBk0a7KBFPW CT+772u9et3O7c3sUJBM93IYz5yMPdr1HO/EHZqDJXIg+rGYNwu+YpgcLLRt0gHzPwOtUHlF9C0q Zmc3Fxc3dak3hbadia9sfV9V4cWywF3J/UIMkSsj+fp51nu9qVLQTp+mQzH/MbysP+iVJUYOOYig SaYzfpEMK8pC4lnlo12HcP9bwfIl3HRr5Qw5AcXPkuOMS/qTgBZRVQpwtKw5Pv5ooAUpSuDbda4K XBe29ooF6kt88SqNDccCj0U9kAsT5CkwxDo+KkmgZZSZ41zhF71N975mBaTw4vHxcVwgJ/JXdyWC W3clvs6X/PF3EzmX/VYJOnSw2FDsohr0r2rksrzr5aa9i/W8TbnVpR9jNNP4pyXiZrDDxL5d9v2R Ix+5LfW0xNI5vxVUdYQzvUYB+hdhCMY8YOTF51nL8fmElYJjGtxbeBGjw/xayn59KOB9LyqE8Tuf rraIz+ejGB6yGfQMmIEz4pB91zAI5HXiowsGffU5MPRey199mF5UcfMeYBJzNQi491wC23iocOI0 gyTzhvJkRbM/YSGqvDK1Z427ZQJblKe2eSD//Km314kDQgrI6w7xdXfCz/ZCrPAycUwEu5mCr48N GLVSQtD1+eTnaQAD1Niuvsd3jfTqe7Q6u325a3yRbXPdfYHQHF4ixUXEmE7up35MiyJRT52bzRAK 6AwN3OpX4lhLFEnyM1lnLwP99cF7fm42fFxWjs1tH1hdWsIge9l6NpwEAPyYJCgHwIh3LeBfErOU WNvsNNRlvOkwQBRJBtHMyxUoI9KHCIjW+mn7Q7/hY7+PxJrhI+VyBvNmeL1oNLHAFdTa8cs069Zl /mpzfoTmEYs0fprVpdLr9QcfVBP59ljXkQgHPwqo56gzfAry9F5nf7leeyYLh7iA1l4em3+tITyz Lz+DT58HXYS3ldFPngb77yBfXm5ZNy6vX36GZL+zgPEMht+gPCg7hEeXhu6CG/owTkqdqe7iJYT/ rVD5qa/9SRj/8jS9/QUCehlee1pZeyLr8Nm/IPgVwHy2dPbkAHv0dGP70gvyebn1eSZoV1+9ayZ7 jvYg/xFjHkESehH8YQaQP4X1NxkZ8eAz9zQ4sws3N+s8G+lLRhvni+1LdO9jMxiYLvAEXvO86yUw 9DzbIHh53BD2uduw9b5MMZ9agUwmtoU6tyNxY/ggnXjuy2MIP559WXuInnvZufUCg07sbk/4qFYa kfEHOfsppF3uqh3Mh1AF0nh279LsMwR+i6B11UNT8+Jpa/N4XMVKt0W6XiyteT9DbNd2b1ZbfSL3 bE4F518OMdBX2l6wvOubIXTlzvU+i61u1zNLLhMGLvUP3x3vZk6+GHpdzwAMvYAAYBDMSjPo+WgB Bj2q/V51fQ+U/kR4tgDyvlnQmiAVOAZEC90vACZWAWSCrtsAoBcu1zuBs4UTr3fOZHBNyiK34+LR 3gNa6HWGblcTPs5njHZn4t7HVM2nl7EeZPzPFMJPBCc+R2fKPvdTAcedYw8P9cDzKWDbi8rt/Otn Gzi2p49XBGfPX15/074zJ/SoQeZhcLsn/TIW/dQr/HBzfg587CN73nh5CCFDIGkaRfAAQrpBHc8A ocuQUzfvS2HB+06fsU6fqeOX0gC0R0Phh4ut26PYZnQArOVVlgMWGsFX/vesRIh/Ge4iLhzqhVJs Y8cu1NdL89tveqjqg57BAi/PGAMrT+7Pqx6nXqRt6IHStzYPXqc/xnFOvV7OLr+CjS4fQ8iCo88e +09WvPPXJIPJWg4CTAbuA0ZDbO3PDldf7lraBRsgdwgHMwGnWrY+ZkI3vA9n8dfPrQDhuwYBjzOv jgeycIDh0/o4oBlYEdC/PgEUvF8IUO4BYKTfV58AYGyEL0R5ea6eRx+WlshSA/SuIPvexDY+5uur 5V47jPVk7i/dQaReV9lkNUvKTwPSxwFbZJ5tTc1kT3deR5fuZ1YvED1vu+0Aw9t+shdXn52bXZfo 53dVxyS/XgW23dpWQz9aCPrxys899FsSG+4mGOk0YZ1UQ/3Ul665ds/7tLXHhddDVCbzf6YylEw5 SfO5J3y09Wk+7eT8OA2omiBXHbNbq9yS2IpdPtCD0hC5dvtRgFqbnMwm2/9aZVEhZGS3EM/sc1Wg ciBZjY8Hu/vVnmoNzg0JMXwT997fvYcQjTVhx2gvxOXI3ombm+hbsvGUjqjTPbpl0qDjTniSk7ab m8ylHuMzhxo2osuxSPfW1RMMAeKUFF4+bj4XR5bgVapZr4mJW0MumA4UE3blDsVbZmMHh8rGedQW 6HR2LT9wRKr7ZmjsR6U0vpkp9ouegQEc6Wih8x6cvd+V2VQIp/4nLtxnDgc70gakvNcDw6ztnnNf K3idiG1O3SFlJ17z7e3NDwPD0QL+XBUYve8EnW+Hv540HUKaNyAgYQxhl8w027Vrz1u6Joe5FWUh yPbH9JaH9Z+Op6v8p0Gj8S7CoTcbnc1rbuBB/lNP7ONOUGv7A/WyeH8zhrPPScsl9waSy6obGNhF 9c76VMJjRVq4b+X1N6v7Y2tCrvQtmOf5Ls+7wK4b7hfcOpdVyNye4MmRkDv4gdUDwfv66x7G3vOB B4b3y7BL++UF/+ny0/EJzupLwLjhJfW9OzgtnTRxeMaJLrU2S+6qjUq6775LXms2sWT4Y25nfLx0 VIvdztDvh7GI6+s0XjbnPif3pxFCrce7863olkeo/rW11esL1YanPv5+D8+to4sTmxzVeXLR7/kP 4yTkteybKvl56jOeRKW2cJAFJmqYqItKuOpPj9+c3mfQIUM7dzE5hzylfFF/l4NwPEqmpLq3Ld/B oViw61foD/nTiJkxvk/o2IfFyTShLm/u6PQtrAgZV0PsNjrzfOa0qEJjTWMtCFBIsaG5h7+87C9u Tufs4k1bR53w6O0TairPV5xlQbl0LCGGmDpcLEY3ncaphkYTnxa1GIzQNNxWcNrmcb7iovNnVL/F 9bP6wfJrga7VnTTkTxHOJ22GLxisNxycu5BtH1eqwxlkoNm7z8WWrygx9AXMWnIqgezcMsoMJ3Wi thzThrECpSqgh+3pxaauoAQTN9neZR4S+q9/ge1QTge2CHzmFf2OmP5RrRCVT0bhDKcQKT3RjTJ+ c+cDm2L++l8mZUw2ZnlUqkE7xJOp4JrvhPgm9HYSRkwmFhZeFvRDJdJJmuGVJRWMAviC2CR6GN0U VtbWXoLEzqHG+ri9FV2fKKmCuzeuK4ZpbtKCWRMPr/anQjD6MciEju2duMumyj5rNYA4nbcHkqh+ AU74HWBb+OxpBWa5nbdH5ue1G2xLThFbGk5rDisOFYDFGKs9Mwjt6yNJn++ChSk8+dBPcYPBXU8n ekETl1ERgOqztK9fR/1jTM5mpccihGH07uAAUan7h4cB9QHgTuCMy/YI4V3rR0EQceNpUD9w/5k5 4COw0fPicXCQMR5s6LrxCIl//eC0LZdRHtRy3vchOhojHdhQxfETcjE4/LFcn5eXF2lx6iNZO5Nh I/SLoHRWWMuePiPucLiSOhBD1GO8sm43rwnmHuj82IBKi6+ySL7GNhok5vS3yN/XblzfnBbfHWUY hdy+EzVBFYVtPG333T6q8r7gz6MeMaON+UqT0MDkvSg+jY1es6wFa5aOrV116EdJaehQKxlhTvLX QiaQx9Aiooh85tjuSyxpGwov8RuW4/YvQ4dqXTMqOxzGw6X1L7wLt9a+mXEx/ZIoR4JvBJiBMZhN rvKgvYwUAwZIp+KVEd0+ALSKPZ0PpTEANJW30ydYPDuQ1/AJxiNlMpU7W7rC1mCodOMCZRqmhHCP X2NP4u+n+vFn0Geew955BpiwdnZCPU3mYs9p/E1EYAUKuGE7uzZwfxY9W2eKvmlqA/xCcuNKU+oO YENEj5Zl+6HD1oBapTzJgZ1ioIYbkMf8KYG05g+1/HdcSah9mnCj91ZIztkV+dp7BcY6YdpYjHss VAyauCe3fk7kimTq3HOENVvQXh1yqhHo/rwT5u+F8DOyGUnJxB8yCoYRgLAxkPUPuFBR5DP90cSi thykX4Ngzg7ofoUZTLl0JJ30Q8sdJz2cHHqLZE0A0gl9dgew7pR5MPKELrtQblduu7ykX4MNXpCw DmAjjzbUzZ+lPM1+drWHRQeLc7Y2NHUBeYlurYeKzpKbCgaND9Km5X75gAXlETzpqJyq9rFV9uNr 9vnWtK44kyP+paUNUiX65MiNRORDLqdck9+NSIkHYyO23S8RSJtDYcwhHB+RxeOLlW2GGxkW3o36 fFTEXy1Fkvp0AlZHuH5abXW+WVqwetgq+ug1Byr8MpNW9LB8neqQzqcBxcdtysXpN19Rd3DgrHs8 mqNOfZqtqL0411OaRSTsqFSSOQan9mEg3+hGu6TTrjLEIKUq23w9J63ASpFzHvLp2YjmPa5Mwv6O zacvlpbkmIWb6ujqkUnSFe4ldLAVdu8DNWWa3H6R9ugFIbp3kVOh+ZJ7qOMlMBIy0fNSEyBVLYjT LuBKdqHqwIYaKMmvHM8bBn0S5xw1i4X/4U8sz9Uu7lhTlijR3uOmkCKpoldzxllNx8cnJe0VNK6O 5XkDeQyiw8RuQGkkPT67FGTyTkGs06OuVEsYmTe7CkWXNqKIMxcmRloLZjOphoiZfZ7eCRCJD91V IWDzn8ooyqViLP4UPvV7wMCcGomFNcTT3ELHMy2BB0VMwWpnlUbHgNkHX8vmjIgaPq0WhH0kk0Or CwZs7+zwpo2FmeVX1/sjRsNsa8Xw/Na61YyJ4wQbGRhs9IThiGnEJyL4K79j502Zkj8fHGNxqOOV 1eJ8Tvjjb68ys0xcVgF3re3XoQxMZ/9BVOhBHxOvNw4fPAqNFNolITIuaOGuZDN2ZTE4lf9RNEm+ c0BNyZwPubKmjSNl22soYWc4vsY+Nqo7IW8L3W8psM97zEJBpgbAe06izlW1tJis+6u4FS8pgx7A GNhU2FJYWJ9FIBbZBSW6y4SQcqtKWsEb/6UtscCLvFrMsfeA6AjT3NKnboneF8a9SOYiqSblSI76 G9r7PfpudU/92F+MxmESB3tB2rFpfiLkeDOSBY1qcO4Bw1jUWLHF0KlDkhIWLOU5K9BJ+Yaq0Box rr0wcvJmQmxiPsK/PwQdfqLWrZSrKaAM0NkMU+RTpBL3V12mDtkzbDf4opTyw8s0tCeexDsGLXB3 uS/QA6GvS+5s0oheX41eU+ybOH44qKot20RwfMO21HobgkzSJodATJTVlni3x8zU0795fV9ZTsZL tKH0K6NcEjdSCmGAGNsvBgTdW6t93yIVwhqPMwW4wvaLTOrresznlB0bGSKvS5ySkwqeaKY2uc6+ vGjFg7Ti9SnISTqHfE6nQulK+x0E2nn7hqS3gYGUaDpOQunAsHjhu0zZSVX9oeFhD/Zw9s5tgxje 8ox3nnlukThDBuxUiXvwXLngOIPdLhi6d6O/nP+C/9jjx8bMEpiHDXkh3tHVfru+yiEeT7n8XGiw xV5o6aVTj/NgTJAQQBxDajBwR21PwUFVD8+CyMWMAKze77j7c1T3J+9GJ7WH6Dx0Ul1uMYV88Xjc FPAh1IGL+v2LaPyUzjH114+23Ul+gSMXefZjYNqzxuTL1EtXsr0SIzIV1YgdKRfxgEGl0bFt4Sl/ KINKjRtfEPwmXQHqD/ScvEk9bsUyhgq+DrRUjYHh9egAB5p8Ejz70I2vBCQMajy5+5A/Re8e7SSx /UnvyLbdtU2tzwaK1rFkEsLH1DXgKiUsUQ2TPFGDJPTjfyZpo89pqsmGiGoN2vp9hPojGrGxWBby PZ48nrGLcM1yI6IO1yzOQcViooBBDn8C4FduVemo3hdpPqfdCIv73HH4dZNTN0LCLKRXTWcvl1Jl HoGtfvMGwV6HScWo/LWIb9rszajPaCMizGvPa5lTr4w5fidqXgeIO/807u2TEgaJC3x024VOi60M dMA/gYXFT5AgwkrAaU4Fl/fMbaUI7x0Og6OkV1vc3DhHz5jWxaa/i5ReqpKvgk6dbnZnrviskFNH x3aTiaZLzLY5CXg80txG8VpH8RRbieQTA+JMm53xEjqbUJx/OyX+xs6VxdqQ9V3M6fnb6feuvtph gwQQD2QjaQnGD5ivldCipMi7NjXtEUDHVKDiBdC/BwlaEMdPry5o7pac2GxFyXL+/sDSX21W68Sf 9oOce15BP3hteVZzRVHamqrPrJ73/PQqrnwlzw1rJwYw3tgSREzA0kvOc7ecoJP5OWWSrV/mq761 c/PBHvNV8M9mhKO8cMLeOXr/78xy/Ba+wqLnchzbvHk9pu68cK1A6KuyTerg/M6lq67v+qYWEZ+U Ow42uvn6rAI0sMJ+YheN+RYyEFvCtcljsiC2kqT2zHfP6GHOkJ+g1iTJKFd6VfV3G6KTZ01+LO5F n27MCIsxxwt0cuyE6yAim+UOpNfHNW6tx/4tbTe3CaPcMr6pKsuIpEbz1wKLWcUCiFjK6a8kpfal AWWVxjHx9o9HdQRlaFNuRUVFFXZL7VmyflBsGz9j9bBMEqcyD9Cj+e+OaYe4FGnqXFmZwlaL59mc cU1EMLGjNMduIoALK6XaV+AisbaIIledx+rCvZrBywAYPcz0lRTlKRodt1zOxNvIxCj386E9EHTo 5Sgm6aBo4OKycMF2IcLGkJwCmL7aVfy7AZsP2B4NoM72/tsG1MKXDUjsDt/FG3xyW1kXcXNxciPl aDMT1mEXiYKaAU3WIm9e0PN+sY+/yT8N8adV7cVaHGa28LyY3F48H5S2nGp8NkZwpW+83vYQBxeO 4/p26HeL6iDaO7vUTumsKhIJhAcmDiiUsRHKwc9Czgu5dAw7bLHtQpqaVXE90mrYUHrfkTbGyzs6 8fOufWlEWBUqLmxtykr2IDpWXHufc98hNIp+lDJllxwsvYjmZWYRIVWLI1eCvPTj12QKHaVfAT12 FGzXt7Ji5NoWO99LXrEqFMk+ictPXVBjYPJfsszvNWKMsI8YiKLho379TpeqQRbIILIfoSrObLn6 hDrI2oo9RjlUJcNq7TdyWa8/sK1iJRQ8ahsQEJ7SJnFE8zE5J/mScMw/cRnRnsmz4EInBqUQ3RCf Zz+o3DpAE2Cqo5JW7crKWsIUqAVlY+ZmlIE/M9yyzExzKWYPwVchnkTXdW/sIvLi4fur7RdBhwTR KajFKhTdQ22z5SXWP4HpaM64CYvwLE9sbnLjdMObgUDm43TShTHKpKWEfibxo0kV5QPSdC/8CJ4D qvtkWdjc5qUMNZ+xbWl516bxxTzHrIJVMo1PmawC5vwfbOFy5kMDbm+6LHaFOIsgraO5ul/Ro2Bm sHjdVJOsx0KC+RmHGDdlH+JpW/7CfHTHtx0hl0r0H23kZW1rACgzTzc6l9T9GUvhWn+IIgNGKLPR blltmMX7B0RPj8eh7YAPFHrJW4XqyelDD5KHHSzWdGZiDIx5iwK+udy78hE/GWXiG8rWwxc4cEck mlF+KhmVVSSpsdXj0kZlsRrjolsxWFEac+K0r1MXn0lpsFVbGR5UHkg18WXCyEHtUbCwYEITwHkk JXyW6rHJ4iPTTrOsyk+GbqH9G+b+jceT9rfHiIamEFEh6po4hVedXFWWG3kGS+1kJoM0mwGN669e DQCucXNXCk9NESXdYewodCgjL4E/se2ub7toenC/ZVBNMg1G7ZBfC3atw92v9ek4vyYSl98b0tpM Zz9IzihErJbLW6fHpbhtbM5IWyQ0gHuM1CHZcdMESpZkA4qRuDrLJnClmSCDBFTWlUvmBKwPl4Py A7pV1FTFMdq2VxeLZMxqXpFaIDa2hpd1x4v7D5yaI8MpWiJtogarAjx1cONTjw5x6Z3F3hyDWfD5 BqOlHZFcGG22BlLpdSRR8IHAup3RjK2Rv6rrJe82hquGDwbpaT4G8HydCLeVMhIl7MQYMN+KRJGI ZVNHQ2FwV00qsYsj2yxJ8mMwZW/BfSQeYU9ubt7IMLbSEe28IJxOgCrPfUfmGcpuoAFTWLBv7IMN odk2yv8iKyrIZoFMjE3pqGbTaf+e93NuS7o0c6ipTErcsJ5gDX6ctSUouw8DfbXDT8edJZQdInmW kbbNkZ2qWR8DI8pEw2UStxIhhnEr9/AtN5Fg2Ww7Az4BmYeUbii5W9H4q42jwwtvr5JJhIFC9ud7 l6P3DRa/2ueXvtfn5y0OdnxHNpRDQ/jNbmSZvqXwO/AXk64sMDRjXJOHtmWGat0ey9B0szKLl/Qs XvZX6JTGvMwJVx2jhNkMM7B2stmcpkTFoUqCeYIrhemvZHVSNBIvHx+yXPR9RoLM5+4vQfDZurN4 YsxjKPf+8/MyTnxqOjJF9eWnMBcSiR2dtb6/ziirkAv/mA9m/VmzV7phIRt4x929Kaix6r8zovIr DB42KXm7ho9w8FAgbsX+DsPu84Ulec2Muob4U0kqHWLYFR+KilNxIVQQO1uHEqU56a9NpoE0VRiK GSJ+hqqCQX/z6KLViCc4CbJNewf287IMQie3VVe/HPqCbqy5PIW/n4z6mjit7M1ERPO3FcgMU9IT +E2kxmDHyaqiWMvIS7nNeNkvmpYO3A4l9fRYvaH0FS0BflpfVFfV/YDzqXOHElj7vYJZoQ+QbQ+1 2MBq9dgJhR0EvvRY5d68jJJmbpCOwVd4b4L1PpWYuYgs3zVdlT+jXtb2/L+Wh8+L7b7QDShmMZBx SgdMDhduzn9d6SuO/TFWZQshvtbNllcrnPVU9NyV6FspTSYqWmJowJnoKvy6clIyULIuxKYieuLA OYAqV19r0m/wg5C7/KCSKzbvxF5rpENNrUCvNwY/cPhbfPi8Ij3MsvmIt8Lk3lfcCDTCYBUrYiIi toWQTaboibNnGbIqqplARXGZ90Rs7++cp+rz5pWC/NsxfMMQuHFWYNW+ZG9UCHrSphKh5+fZ2wq0 sLdA+7TkpCJZKdIC7sRce5POksQxnYMyUivxB2loJCXtY6XZkz6MuhzF7FAu1AWUJ2ZcuB799eke GIB/6e+vUFOjtp3/lh2E/TIw8IssLuIA2N7zct7/QWi1wqQ7OHpOT8iihiPK07jyG1llDt4HaRW0 2hr8C2yx2XsLo+LK2rOpLs8DeLqjQ/FY+haBVV8Eelbql0z/xYTCprkBW7g+ptKkspj6MQ11zMbz wvXFbojCCguhm6lpcZqp25jNLx841o+YZ4SNMZIF5ENq8Eg+7JDJHnHv7IGPvU5qH35+WFPxE5M5 MFgP9Fk9HnHZVWX/pgmJe7S39YZzcWvgNoSyBGTBd3xo379ReedT15wcNZCCy666IllZPgD2SNAS Z1CtDsjiO1dUssH75sk1xHGitqKeL/LTKX1IWGPlWMCp6FFdCLeu9YcwQ8i8k6ZtNTtQl6K5MInU fNDawoIejBd+8nhiea947m5gtpvyddcr6euusUNl2EF6Yyy3mfkRV9Rn7WJsfIJLtF2WasyI3GOl zz3mj+BvFUUHJTOW7eC808X2XtHq+I+QR2odT6L60xLgNLYN0XDej/s+5/ycnG9/usA1HL5IXmrw NQm4Qtl4YkMdg7ZxhQUTHG13kRP8kQW4eb1zXzYLYVoEJhk54bWXXXczKQwUPnNHeFWM4IQEu1IQ hxFIHUvVsqc2TeGyhvO7lM0nNbHPBAZNK7kA8qtwUBjvXUj5ptuN4Ywk3/OeIRyeGk5MTU0p463b vWQ+P4uHwD8gYFwT823HPnrzqBcw/tVwMjShKkskFJr71avFu6g6Pz8fFl6Q1eXbLvX+hP+sMAJI JGwxwgEw4wzDl7P9wRFu1ysnN1K0oKBVi4LLwTdibJK9VxGo4najyppHNRWiF1ferYUEbGlpQXIh t67ytKzx/bjeL3T5izpze1IZybnpJ5PDYAa2ikBAAI1aQXjyNklvXFFYZBFmlpzrZ9qB7KhvCJ1b WOoHexeu8LLmFWEP1nSBEjy/vlI0cSIU+s0en5yCUza+MDTkozBoPJxLpnsry4ZK+4l/QHW8UflR Ih0qUemP/J5W8ClNVehRqKS6OkSpfGll66Q/6fRo+8Tu20e48GSFiYKNSVwDsu9FmEipQSXHPTMB CXnouXno58Vy0Na+Vcl2rZkVeQ1SH45iEX/kV5rzEMyrRFCKNpxjWRrfzGNGHnUa/+1pSOgPvtPs 1h6j+GH26+OHGlQLCWF3Rawo9p4aPQkiZWWqrrxercZI+Sk1CxMiGQVHWgMMu7H8XpfxuMmxz08p Xb72n9Hjf6prOp/SpvaEEJAy2JhwxbClsgmkduVzzCkwxiwHn0t246qxC9gQgzg0r9TggxH6bt7v tqcllm1sQD3boqtATT8beWsRjz+rMhNMKcEKTUNLFn/2Nkuqk+rWreTwZoDwjbFxdqrl/UXiXnn/ 1f89zWZTL12nEhKagMUR5UQBHi2O4WxUzk74gsWPgQ7WbAp8YdRr9QzrKeMIwGdzjwlqKQL24+Ug wi3/r812Fuco/W1Jm2Sku9AJXazYiVSplT/pF2mIZfhdbn4aOcM8OnqbbMH3lY3a2Dy6ox7l+ap6 1mfAUmruRLycbbS1KYas8T+u3t+unmbv3K71Xz3dPqwKP5JyrY/pLtw+0+ZYuwNwjp4UT7eUkiu/ D+bReOLxkzNTmaxOFa+5gdOiSdM+mRj0tXx9ew8vIsLi1YQ0WWkfqbZua5P1dV50jCnBiUhx7PMY f/HawvVedvPu8dCDOQ6bUNpnjH7t1sOJmb8lY4aRjiXbpUKedxeKd4Qh3F/Tf0+0tPPaGiiu7iTa 3uf7LDrefXq66gbi3/wQ69oJ4f5hybxcs3+Rz3p6+FBTcTZVoszqc29HwxAYlOij2/hsZ2i6k19j TF9T0xVq80OSU+VKq+x2aZskDnyks6Sz9GtBQIx5JUvxSu8xEj18InZhzxw31mYVoZINxYbivcjx eoRTVEYyScM5HoF4k3rnsWagL8rvXfZp0hx1Sf3pasuws7osGZJdFnVZaCMZlF3M6LSceywcMiMh 7I6PmwdIsFmCmEV2NexyQPP8QfWQITcOIkSxPwd3S3h7vz3m1zCpWj+rBvM947e9l42jHwqBzP5p AAOyWHvk0gpFh23DJPgP7WrMObpwKGm9tUuhc71QF5HBPwOjxCR2lTl+GvS7QivWTvYwp48lfnBd rTQ2//bzptqhd9ZOKWOTJrVgZJMtZ7TvZIr8oYMnsnurADNC/kNIoF9NA9FEBK5fNAjDB+ZlNGli LWLROpukrjqbJLuuOo6DYbBq9Dav+zwPpr4EPfxz9fi8ZG3eH/zTQgwGFEZ+KWapA606dU0+NuXO 4axdhoZfQVL2QE0wkK92O6H+cTouAoPD4yXgj/0pvW34nF4U0dNBywxE/kKr3efgaab48iKR3PDZ cvMyz0XT5PRLseqaoSLwcSaDg8voj0Zbsr44A1UBx1cOqN94OYmZ1CMpn01Wy5AIFP9CTSto15t1 BYZX+Cd7GEBZauLMfg28CmcZ0uE26krmNxyh0Ks+yWqe3V52myt2yVqtPSlrPtEPWGjidDmBUD33 nS6wkxKy6LqA01xOFqoxuS47Ecj0JVFQTt3NNt7eC/t46VImm87/vKeFUZbquHDq47MQH09bqg9Z nwwqJtWpPehEAHra7SyisLbY7ViVG9XLxsdssTEZOBMKJabNe/gf3VYMG+jxu10EETxfOcz/qD8W /LlkWk4B/lGfxvPzw1E3hu3DWR3Q+25D2faBGElgvw7j9G5fWZhs2O4Dc+o6obC0VDKw4eh2fr/O QY9eUW/aOdr27pONcPf5GAmK3nn1zcnT/7j6qqC4mq5rYHAPQRKcIMEhQHB3dwjuwd1lcAseCBLc 3d1hCMFlAsEGHdzdBv/J871Xf9Wp6nNxqrv33muvXn1z1tPX3gSStRDj0d5wblt9Vj88hqbz36dO /YFumanfwF9fj7NGwbtfP9KyoY0f2fwufDiyoonq1jmOlIfE+I+a5/dmum6GLxMUxyCNXD6LTeEY X4Tufv3qTK3Rux6mxmE1cHtTQ6MVb2dLmcDpLGVk0MSKorUlhGHczeRjOOluUEw0v005FPOWrsot twQvia5NdLegUUurQeYs2TsktAF9vkbyQlVyQNgtLVTgqyWngRCv0o505MKsNeunTBSUp+c3UVzj Kv5fzwAkcXHUmisF2BwxuYvTojc94ppF6PNeVadl4x9eJtnuyQRj8xv+qBQX1CUsLgMNRDHUvo5e dEOmLkim1tSiHvpKhEfVdRe+6Oj6VHRta7a+9SjRoOhKiNbQNv1KOKro46Pr5RWgq6sbkN74gM+o oWnOIKHX+sN3uCONCH9LGdJsN+pqSymF5YfeLE47qwxO5whvFU3ZUR5J53DwZZXap9neUXV1nIZt CXWh8HRztXo+Xu3z8ZXNqeRyk3E73Ddt2YxUkqe3WN/naNWeQDj9biraG63YlJSNMhTP0f8mEbEC vTY7Tx2N+P1ok3gmjTruKmu5nVYVFRrnHY0E/DYX5ewYLs4ra+MnaQV83U+WvSW3lgszrWqzhXQx JrpMllL06He1iMZzBfd/ZYr0BhVwNQep6S1z+1xsOXwxurtI+aIuuLs1wtPP2nW3M2FM1Z9ClGRK 5mPNvb+300wUELAenmvs3LdLtDwe5/mh86DCwfj8TIOl6Eqe/L3vetFE5q7j6uvMGHcn7MBrrSXH nju3o7u7XR5zB4zjqidcchD/XaXcD7bfV3tq6FHZXZ7b0+cKPJPZwJfBxXOSL6zbL9vL7Y08tStt +IEkaeQQb4tHWLECj0oOl8/0UfvISKU2LcX7QIsTddtDYQ4vR1d1X/WLRGq3hBm6bXU3H39PT/9p d1sC4+i/WeOd3mWVVoI4vfLyxIGSh6gd9cGIIu9iByoQtFiJmtkudQSYnMx+7HeLOu83I/Pk66jG lEPGmctmfktnfxw4e4qZ/U5tgR28NSBen+AriEi19VaiAKJIlTtz+xXbZoVyxl2RgMKNrjmO73v+ GLMeKRXKACKfNMPJkOwscUwoD5e54/hFdBc4zBGAn6IL60MJpycLN7JlP2MdAc+beZdJMefeullY z/pEx5ZBWVC6t7eV2+guLzKyCZDe0ttjaV1iWnEPG0HtCwfrl7eROCnhkL4i6ej1AH1Okg2iayBI lpesYaQZyvDHREq5LdZTHURuc9WFsjkWH7yO8fEeaA7s86ATpMo+H4QJsOxlEE7fK6iMphcQRFh8 w2V7r6OUw+dPV61YSEP6yYeKm02owMMiVkQ8oiH4UMSPmyA+hZ6AiQe8Cnx5yuQBI5PQ2/sed2by 9D6cjKYo2IAtqlHCRrUvRiE/nZbbEtGX1I8Ebbbtq2gT1mTDVQ7pdDs0x+ILjVoI3/8YYsvudNmm eazOUjKOAhTSm31lcXG+MTjiy5F5H0fR68Jws9jmIujBRcdmGNMQ032HI/uh++enwrx2ExEnncKe LARWKnZ+tnbZn2dm/N4ZCv4cXUQoDHxvQfOLevcumz8GNV4wWKaUR9xr9qCwC4vFEGDXeicXj5AX AllAIHyPzdyM7rUS8oYbWeFQjxIXWpt3mRp7GaLhTH31GeqeCe7bFPH8FbHWQcdgX8QVx9k4hwFL OfT0qBt1WS0tcvqPcgN48kHytEElVOj7YuFCM58qCE8LU1TrRTMl5VDVfFBdDg8OOC6RUKTudbxJ OD1yVb+9uV7ky9vCnhLPnp6BDD0wNZXlPFahK29iklOIGb4nUF7VXprRnBD4m4U0MfH58/sJ5VVh lSeNr793QxiQkL5SCqiPoo8uNpSTpepUI53TbKuDvzj67l8YdrqKzTOMfdyC3kjn288QZuoHLY8p KKRpFNraCC4n/QKWxbFEyhQNAKjkfdTx5FFTsBcj+Ob9HPkEyb+hizqwuNDYCJ76CYdAEqkV2oOz JeeLi5wbeUKiicdskC40FeK69ZY5t+V2SKzeZiciWQCKbVQ+fEIfV//uvjmd0mQz/ZUmg8mqNovL 5mbQIq66Wa9IjcXlADV6QL1IdYhKSlLDnQvnRTH65c+VevQlqCg1Dft5DTRVWXZSPbnFMjTR7eDg 0MWWZSZ1iHETuvc21eoyp+fEEf2k1ot7c2PGrhQdZbOvZl8PpKHO77GnUaTl7ymQsLjjsnQNuZ6d cVxQHNo1DFdKV2r0XTnrN6xHDYPMmmxMPSYiVzQhhtZ0yBqmfH5XdGIf1y9p2zqGhKxRIL4sjae9 jBC2VNUhZoLnKJcijifZNRarh3dFSvKJOp5/nErVWDybkcYzvMjMDVVXa6aMXj79b3pGTod4FnQG S1zsHbShePpDBKmhtPm8ML1XWnpLfpKl+7vmHc3CekHHmfDEFBV/8m3d2Zli0U8pM2dGORCBQmTE 2j+LytkOKysOK9srzrKjHdkOBPgRcs9oa39WIpCOiwaoWRTkJqn22r86dOnXpvMfleVWZoxKkZxS WheCOIRnP+CjH9yF5wlzfcN9kzGMDQFvF1NFYrw39O9wTFYfY8gOZYKZOWSlE3fL1g65uWwITY3g a4oZMgsC5vUOGoeVE27VQztH9NBE31Cq91/rdrge2zt7f83aTm5KTM5wyw58SxCyVTR9tbiofjCv MH/fa9dL5Wrz9Ow+aYU3dHRDd3C3GTzV/oDR4FdZL+koxvAyX5ZWxlDZVcBTGIQaeTk9I1zZ7W/7 2eNFLVLWrfHH0M8/A/l5f3aiS+jQUUdqTuJuzb98+XJr+2aat+4tk/JHvOyFTL3cxErf3Dm6CfNU 68R32XyRxQPDY84S3xmsURswXXZc3uOLf8wy59xv0mX0HLpOt8xjav5M+LdD78gz+Kfm5ZfNkyhR mo9pNJLJdOL9pmINM7MDDw9cUiXSM6xuX9IIDcwihuCJJLmIbSgu5OiJNZOGg/c3wkpStWFsM1qy ZKTp6djP9RYXnoHCI7ufUvHZigb8NTgFPVySNYq0pZCJ9hxhc7xfVyZPWgjbFmeExlcckhxOgJdl xOSh2qLTqnNK9qesYzWspeJiTzX4kX+ly7/OiM0Noim3N0Z1QPSSd5LVqwOruDoziRIbTjQ6U9O+ atzK6HsKWXTnhCRsasv7WfCcOq2CJSL+upCUoLb4smxdGAThSFHODxFNt1tcfFQd5hJTqNheTK3h S9cj5bjl/Wu32UAio86SMCmbEaKvtMyU0UPPYHgI2awf05xxrhw9mTSaTIcoFjcnJ6eGZDVmctK3 /egw5MjansU3/Q1m/JKETu1179yQ4cIYddTYwFAWb5ZW/raorXLM9KSAyZo5IXLi8zkum0E/HfWp LgN4eb4Y6fySPIW1So1C/pzU67ynxl/fRwSj2u0Av9NmkaBrQUvmfKJGtKixcXLbFWndre0b5KzM UAtfCbEEUNS/5dfGVQuIcf4pQVkXfZ1XgNaMW1TjmJN2Q2mmIHn2vaiCigp1iCRQ1apKvujXlcm3 3x+zLndUSwqZuOTVlWkjWlTdI9HTJF0tMjrpszqZGmP4MWSTfdzpeC46N6VJOFyk6bm6yru6iAY6 QgoisyeUlxEqO9e1bndCwRDeh9mV4jGMjqUKhqQfjsaz2ysOztVyIL4Ey6mJuiCzUWgMcyRIWXfS HL2i0aeUZcD0wuTG4IKHPjlCZOB3vz8DM3mr/IY5P/b03E5RkT0j6+yVPTIYS2FDbKxYsCt4g9wX wzUTw1sRd1k+bvw304laiOGjXBnNiR4NbbYb/Ld6TZUCxiRp4IbbMcwbRDrVmory/hyX3zXH7vPU PCLxiYBPr0LaBQrD58RapQ3NSLACD5634fUEPsX0IEVjgerLUUuIuu9jZXtHF7FVewGarbgwKarS clXNDo8i/ssFOvmI/AvFwLfpu9qTavYTgO7EwId3HWyNIayEb9q67IwLpxaSw3+BHjA6OTYPKgcu 3tqtPERr3WZt+B9kmfHQd3ucz1XH7DLncFpNijW3vdv3KFUxBo7sR/zFwiolYuZVmnO+vwqJJNf7 I2pjUf/X42rZYQXBHoTAzWWNhkO11BeKQwZEHVs2cCM+WK3YXEoEBDq173QNEBl6eKAclrWN+4xt +x5W87ktu3G5TYXN5NY6ZHNauXwiXJ937n9C8Gld/YY5MMAz2dcL9VzTUfRCZkwbUPXjQbc7n9sg WRngWdVRVKCvTm73Xmv4em6vp7MeDNAIHq/nleAXYUlH0dPDtiDP2wYINuQzNRZHRQ6dnZ37j5Uo FxvWcTWTeSkaxB3clB8fK6FwtP/5EyrWNLqJrbeHq6SRSc+PaXOspLFkZXNumsyRAl7K1Kvg1C9R 3pY7b9LdrTLKtLyEy4FpKK0xX5qpi1QaFg4yk//SziVPuJ5q4jVkksPHTa5pR2s+h6qyuLMyPNeh DjjT2STEOqdpxVDRTs/bRudO3lJGzY1iJfSQ+P0OG3qYH5LIT5QWQWWVRJKKxEU5r+WZ+qvOq8uS vq30+0vO6MtLyY13Wyld+8PegbUYLf74OCAjfKMNSmiHMUA6MOY9Osen30rIxuSZkIikCZH/4n9O Ot/HdzIwgHLj0L11ta/AGqXCetc/QGTsWm+ZZiDY8hj5l0iDv/pRbAlf5WP/YkK97/1Vwj4cPbEg DmG5s2DYhwYo13GE4vBgYx4ci/ceFyHMaKEHSik/iICPPWGkm0dGb9RTl4JnnF/QSGm0WnYmFHbs zkyaBz+Udx2KcmjkY90nVv0zP2sdLg06jKOWrh8kAaW8YuFF5yAFbqcMuBnl9w78NHc9S+GDMRs9 jiLczybj3BnrPqKTMQlfoH0JHdAnoibhZp6zP4yL2V0exrkeZRKMk1Zcb2+19ftNZD3E5+YYW/rb qwRe0wQFOyvzb09T0AAgw5RgTTm0PtYhs8NeFxhZDvwyGr3xKYVIdNGFMcWIJvY9N1kegjvce3qw 5iI+2yZQjsnpWHOuxDY9Y7HUtlID56y95b3+xprUnKS1iHNQzslf1J/tOL8lsBkhSihccvnJX1EG AzheTqMSTvhQPg0w/Ax1k6EIyQQvwxnyJBl2uKPsI2wy9oTY+bErY3ZslPLZNR23LWLs8R5lxZlf 6nxnMZ+vX2KvNg0Evzy7Zo4P+ifwByXBE//aYYNErq5fbFlzGHtCH2Ig1+MjpRjpaZCXyjVwj1DY pHEDztMqxgvG2nkuJPD64WXxZu3u2c+F4wTwCwQORlXFqQIEwC/jVKFww+HAkQSjBCsFoXPB4cDH gSxNMM7YzxJE3/7BtEfSC5IJcgB5mqDUvfXGt0ZaDBoKMgRtghxNcHCRbhCOQcJ5EocbVg/BANGP Z4jO33mR3OFV4FUAK6I4fzCu4HsR74PhoV9AnKBGEBWUD+oDZT9DOLODojrj8yJ3oWIisMEPBadh 6cENMYEqQXYg9jMSqAcUC4p4RndGyI7QhdUF6MLIQlwFPKPxInXhPBLyYj1iw4SckWFwMFwYKuwd zApqHKQSpBIMDgpEeoZ7fAPjgbqZ4MMQYHgwdNhbZ0IYMYzz7FQTNendAzk7NjucnCjHGY8o+nf0 d8FcUKfg8yA0WRRE6GkQJhTBBMGZiv1NG+pPREXkEjgigCX0AYQTVB6EaoBggG6BQAhCf8QdRmAF BCDKgrZBBKAUUEKwPQj5Ueg7YAvBkxJnGKUGAT3IBuRugkwJEIFHD85F4AzWBc2C7EHwBgDe4EA4 gyCSNsIzOCkQqQmrKuY4oAawA8AICgddi6JBkQjhi0FYou9VselBZlDpPIQ2tLb3OgiwoGIQhwmf M4YqWhXcoygcKgJTMGMesQ7SMvoy8gxcK8ALzgvBC74y+LMoizOPM04dISq8COAgyC/4IYj9zI0S YQZwGGQMdws4DMYCAUDSUDGTt3kIWCAJUeq69wsIgpiP1H8QuQD6wYTQNyYkdWQL8EeI5Eh6wdzQ TyZEZ7x1JAsAyeBuUYE6nD04M1AAFO4PmiA8KWIOYkdQaVBpsGMeyh7SfZAxwhMI7owJ+h6qC8U9 Iz0TdH7nDQ/77IzIi04KMEJEDk4L2gSNgXDP0M8Yz4jZMR+Rvcm8AbzwXWhdSLFwToBTuFOEj8G3 QYEIyvCngF4kZUAvIAAnC14YThhRGEEY+fk9jAj6FqoB5YQaB4vABSI+Y8FI3yH1wPUg9iA8I2Yh 9SA/Yz4KiPIcn8JvwgG+I9IAAgFFcOVBb2QBz4TvcH4GuYvCPWMPw7HC0cERIbwNjgmSA1mYoDt/ MkHuwXmE+4n+DUQLKhalM4GvAuEEM0M5oDJBiAbYBvAGaI/vhpHtQWsAPlFWE5SLICCUMQ/uJ7Ii iiUcx9nbPFwYA/vbn0gGWOPIpKDPQW9hKCCktmA7eBxVxHH4HYQBkCCU30S4Dk4H1QAnGc7I5I0q +jJcMvx2EAIzsiMiY1BmUGYwbRCODjozIBXQCpcCQgfhIAZR1uGVIVQEa4GqQQ6iWM4CzijOH52J 6oh1ADMIXoBbOLtg3DPOPOw2ojYcVIAIygdRoTpsGJKzSB35ApwgnD0iOSI3POMfOEFELoTMYBZQ P0gEQUmUs47AGp4cvgV+KZgMpAxVyyOwBpADPOETAJ3BQqL4CxhNgIcgbErkIxRsuGzQW5AYVC4P wxvdm3gP2TfIKA8HRvsHBxOuFyEHPgcJGx4MDwZEBhMFGQNkggpBn6BSJrjeaLzYXZiY8LVwtQi1 8P0gp6D5YJ6gt6BMkD4I9Yz7DPuM1RnPGwf2EYp/JnymD+U6E4Degt5DAVAJKDXUHJobHAgvDC+M JAx4JoABzmSga0FgeNfa3v+vyqBn5G2Kdyjvgmgo38MuAwPDFFeeAy1cvnz3ZzNKe0dUSwITgnrD XyFZ3JNzhtAIBRJHFj/0FJHqWOkGUtdpap/juBEZ+PmHh8dzpswjvqRShKQOJnAm+PkYcMzJlG9c dw/q15iUxgtPBhgF0Prxfh9DJq82ZZO0gwhE6utaTOHP+c5j3vwO5alDSTUYlMZ2MI/0rDZdsrWs 6zlubRg67UyFBFxJzF2e4XEvt6YLdVKDjI4XQTdcNSbgZmTI+ccPR7A+LN4dec+X6f2q7gBh/YBr nIVT6RwzP3KdQf6TXDD3KkfmLOt3HXuJ94fLOiHm/JBst4DhDnK9cSOhd6bFSET13dduuuDUAWYY TlrD/D13A3JvjNBsE8ID+Kvx87nXEWROqypwSH6ugTH3mpvNXMWpPap7dW3ct7XGJNJrLXgNKECy 0BJyHGcwRirC1VATQbKQ+ZQJWe/2qgvV167zMgLGkh22EfWu+95ErmWbqAh1xU6kBf5uqU6fWJwz GnNkzPpVcNsOWX2oMV06YTVjO+pMEyLPAd+3spo7Pdsy+ZXbYSwBDz8fWT8Q3/SRsNW9CzgVAw7l G7Y2rDowQbJjShpLzztzrHXGPcOz7JeEMCA3zp+ehzIhKzWaNwcaWLAJnoYnklormZsIHf222Ov1 2+ed9omjvIOvU36WjZNYl7qHGbpV1+Qf/RgILavtai1VTF7Myewgh72+yXGPrtSHTrp9q4HNgPl9 U8+t8yVI/R4ZLwVPI9GZQI5N9w8s4frUlYOM3/GntVZ+gS5kfqdn3C3X8bpHK19uGjTYhAY8Vzhj rpufshx6Dz9W+R3Ke7ZVZ3S7XcndbDxfQ0HAOZ8XUs+LBWFP99NuGBbV3HxVndDtxFd9xye0JfVN y+zDWqshs+ujOIkJ+/KPkd3+3jgCZyZIMLURzwh5nUi9+LXOiO7l7sTmKpwNQcMxcmPOH0+2Sxxz 13lE82bv/Q4XuLMat4/qH4ga/jxiLEwNfWmUOf05YnRcboVCnBqKEeOcs9PIMuvD+8IEOXkgyCL6 KOBiTWTXs6l3M/rMvuT3cj3uUwy6P++lWG4IO67ojvD4HEKU6WQCbhUBFVDx+EEHy48idNMa025q TMFDLXXYBmub3aaepL21XpcfuPE7Iycm0kHYQkZD8e4REA3YZH91a2P8GenN/eUnwqchLXtYOoqu gha3nZ4Q0VB7JNb643PVr9HFgE9pQp12AKYeM0GBqe5gKR5f3b8r83WAwxpzp0dfJpKFAE6BaSPw QQ1nvaMHlZ/nYdxR1ARPyF90v9vfY4rVGQPaRl4Efpvlvi2dJ6VHJptYR91W3I2rxzz1H3nGzS8d 3tsfb6RXYQCPtRUgkR8fFhSOb+udw8fjjyvMgytf4rP31HQfIg4XoogovkqssMAoTqx6yYhB7S71 +rWdiPtq04Q1nD6bTdw/gTW4DF1P37gGqAx+Idc/PrlIGIgM7oggWO8/bMoWqrdzC4VmQi/3Y0Mx iI6i9YkhmzIq9UxjgZOuAJzGDBkUHYcrpDlfGBn3V7WwibbKlJUz6NujBlqcOodI6YUMw8iF2AyH o7lj/6PFB3IrkcfEOBaftkiHExLLYDJwA5ZhbQNBnJ9O3TUfoc8G75LzGa9+lLmysa9IpvHaZIDz tevNzPDpQgPKTd3drVcdpNXeYjpET7uFalCe25PjI5nbZLb9uYQhs+uZlqeaGEOmfm8ay+p0P+tT JOXSwi2x2x3JQnRJ6YLB0UunSMCIdrPwmPbJntVdpd5Cw46R59/UUl23l0P7gTkjz6GT/iPPxx2C JeSF5sTucZgESmd+fozDSeCPlfpbdv36bUq/owGvhW6yoYVrGNbHgFuUlqP10oWErTv7m9cAF5sd 7OXXlcb9jZMN3daMtN1vuT1Pe4gWHs827SFzAS3XX5waWAzZ6u0cV8bnmii+snWdwwc4Ya65fF+J PjVsr05TMnb/GDD/196l/+34+8UBwtXGOILI1sbMc5GSjhNLLJXuUcffTj0BmwGEi35hKeFLZ34P Czu7Af1dB2LcDzn0mb35Pyb0/o5m3TY1OB/Rel4vah+9IOrHrD3t1RpZkQTy/dJuumqM/7JmhbPJ v/IMe+Mpc/Wu8/3u5pwhW52Afq6pXe47ix8GrQ33T0MQj96FsRaygISJDnOmpYfRzqPyNOV63dsj MxGnQ3ORdjsB/fbmTK1WMksVcv/I6rWXD5k42OPtvT+OBTyTVjpv6THWeegn/O1P/P0WVBxXfi1/ 1l+4PhTQ9T96Zyd8hTx2zvzVD7t3gpFcEMTYl5D0R1m7xrPuM6ybpNPYsu+a5UgvqzTdzpm89Sna h+LIbMyZpYXML4ZliE/f+8X8KOSOquX+vNB+hyyh4T7nC+QiAmD/po2dYpeh1hcjwFxE42RtIouX rRM722R+dWr814Ox6fxabxraF/7z3ttGWt6dz82dCw2DrJ79O6UQwDGY04t+tGQVBtcJnMOyn1hN W0h9N31yaLK+ugnzH4IUTHQf5SzgZn7nTJsVCvgWLpAAFcg1a20lt3T7RcZ883hoPysiDQkFYzYe VRBye3m87UQZ0n34jduo/Rg78SRFslR3qMv9HG3Wkv+AeOmI6HXiaDZfLQBqeb7H8ry8gddeCwhL r6k0x5h19Nycs4LEZeaaoPM+XUR5QaoYUww9VuS1X2ZIjko9OiFYcSiQHatVcx6H06+X3IIjHPaX kPEBu755Vu3opwflgOETu8CoEQJT7dbDdw+dlQDFY76+mqU/k+T+54h2++Rmt5uB797ds7itLxu4 rlQzR7tPE3anSZ8W8+X62lwZuXcTPQEPpOYLs67oSy8ZRuUSxGcLVcGV9JpPDPBPDMGXe/8G1ieG msv9f4P+E8PS65u+Pz6iP37Ypd3rkEzsn5xxaf064H/yx6+/tH4dkmVen4CiS4vXF3wjf/zVS5vX IdndP/nq0ibZ/YmF8F6febK0VWfP6f30Goe7cPdX2UCMrGfCtssDFud7ff7rVvccGaf9mbWCql6p O6BvTMNzqt8Ty+3uX/0ToaJ4gWhk5cX2gxLiI3hv0nJTGKo47vhW8y9UVGUPqdUk+DTzccGQWfPt Km3e8mZ5igqfGfH8VExfQdMkU9auCka5lqS+pCQJ1zfDY5mLNCRhpJzqVnI0H35o+iF+lmT+nDmx 7NHSN9Iilk1WfUg7Be5G60kXl5HEMKZ+6TB3n/ki69iccL/+FI7Pp+QxjA2bCeiJHHB6yyKcK4XH JNW2KxyZaJaPjuGvmb4Fr0Fzxw3MxylmmNmmJouIslTN2CjuOnNmIdM93+HDWxBnxLnLcu7W0yM0 3r3AHMqYG+12hjQ/6vVnq1VS7AyJKAx+KPd+4kjQa8lyBq8bXPrSO22GdqV9uVU3sZPiHMbW1mBm NrCZYbi0VPzZF/qcNN1cguiL0AfZKTqbuJoO8Z6xE2M48ODrioLHZFEqKKvY5/tboobKXe6p7Agv 1Tc5DVNEz0QkIhnNzuT01+NIIKwqRdHnFSnfw8c1P1S4o8aCXroakYsak5ZwGcZ0xrc6Zfm1hX/h v1v5QESMhVTjOHpUDa1mzWqddU7OyPBl8uXLZUhuEq+8Pl4qbd45/osgOeI3Kfhdl6rDzAPrBnnj UpT49PoTqmCJI4rAeyoVMbXJn4pWoMkg+fy7DLs3J7dhGgCBdXbq0M9m20V0Fz/8gpnLmaK183ZQ 4yLerlOVIipHMNLnPD8/szstw5XLhRJU7v6BUlbL7nj3I3t+VwBZzY7r87WB+tfyPLHOMrPQ1T5Q IGJ/sy9htUajcWzikrfk3PUYhm8NxUxOsycrpGR4h/GVW5+0jDnJqYOcvLkLQKdwpp03KhzJ9a27 U7NRJTlaQthXfPANHjTTzgt+y021y3N4l5qo5M8exvmgoPeHQUWZbRTCeoyo9PgaVk1p/yzQTJ3e RHHa/IOooVJVe+VG6HhNiS+99/gTpi1eefnI7gRdF9rPDMW8hksODtvXgn1fLxIFZaFxWo7//B6J voPISzGhw1yWr4MsX9xhPNmR5dHED/+5D6Gq9JL784ayOh5Oe9Hw5OJiUVYWwkcnb2gCZrL6lpYN PE7EBO0vW5oiFUFoSgjH2N4nkj23PlbbpR1HRJc6rmdZeKeRYdY/GWwwMzF9fV2SzyIgpSBxt9O0 HNS/bQbgZr1Kl4uLFCXw3veML6CBPMLS2McSdJaDRjk/LoyNFeXKbsEGvh85qjOL2befB3L/gnCy 39qVuX0O+o3F7EDq8YP7HWtqZYWFLqTPMxOffMrY7GtiQR2eM1Gl4H26Aab3MM2stuYtYmVltKSO TwwQ/UNTgWSbNZNVct1nI2rE3HXuywgc17pKRIIQsoLrD84347pmNUBtYSbVykYuW5IBe3y5YRCV Wh2D0Kx4GMHX9+hxrtDEKpLHmSQZrDlZZob37xNRyoOCri3vjiDxjVYMRsQ94SxcFyPDw7Lm5lHt Lt2BoQbuqHRpQOD42h7bJ4XQNo9kkJwMLScN8QiJzOTgoLTtTWjCiVO4cZUPe6r8B65mIj3Qrrj3 xNmIv6R7JMBi3uCQ2SD1xNXg/Qeeb6d/cziGGW/VZdCcGodf4LKKtc8eH11tcUYy4SrUW2WFm28+ z49XpqtyAhg46WbGN2c7QtAeMOi6YB+WrY22AcWqL0vGqhp6HYEigR+CzDTd+p6z0IrqHka88qxU BzfySi9FLYXzD4zxspBsJTev7DYTf18daTI0ZTVxEzVkKuGgz6mHcTptlSnJDxGJRjFwvd2qzc4p +kxpnk3BmHbxNY3FOB58YdiZGnqcJySLXZpZ9DOHg2aXRnmb5rnJ/KbqIMrhrFB/Eebkot3qoTGE 7/6TnC2MGZwxu7y07HkwU57KYaXh4+Tm4+XlwdOMMcVSwVPYUSyQS5znIm65FToabFIUvBzblMwF kNIpGrESpVB508mwEx1UIZ5iZmbKDv7qyJDJ8XW0YD+mRHEE3ppPWJfLbUdRbzi7gLYfFjvtWgJs shuVETwm6T9o2ueK2yxI2KPU+cnh9maH89MsXfL4bdzHAYdFLpOdDqm/rHqNewUxrBugHRu7k4x2 y6mMdLuSqU8l59mW8ceeRJgCyp2Hb8ZhVCXVupwOE02ddSgXVbqRghhfhC6Gf8nAzN0wKHTbzhLT OSl8tt4sui2Ohy+qWWerBGnJnAp3OM+uyCSQZ3Oh/dBy+5Tr7o5nPHRh3+N9O9V5WoKWetrzwLfI rYuBms1lw4akcbKCobp3sbpLd7xd3sQR9YGNbZlbd0nZ7osRiFr6o4YinZSb8vMBE4tBMoqNkc8Y d9U5PZhpyLkP6Ysa7i4S/oQPLeZfDGubTELMe5ZMxfpSXhDQ4Us0SbhDO7SC5adRM9JfDFbv9HgX +DXfvgVHfH3+qAC4lwOm5lMR/rvKQmP/z3d8OaZHKFO1+bA5B2P/lKxYMxBfcidps843/q7E5Z3V p4nPK7M+kwfRR0eeuB6EQvRRHTb+6scBy6Yl4GyB25PCXfuTBffpqfSfr3dRx4tkDpfdP9+FiPe4 1GTQ78ARXKHZam7hmMK5TYURMg4uZ7yYqsucAtxCrjysIy8TN/Gmp6u7sDWjx0u/89us1G/NacYB 6dSOyeej9VvdX6bxf3Qnr2+//L0JsGIJKNI36tlO1W/qniymuiZ0uJgQa6r92zKl7VAx4XjX0v3U chM8tdi+5cQd+ONb8xC5n4Bjgg3FRA9sI6aytuc+ptLGTnDfNqOr2qF/ju2k+94WCMdySPRlDaP/ 0YglvdbmRyWY5XL/GLjv6RDwcIz4k7u4meIsPRV42n2ueH50G09rvTR4c0+3eSwSNPDX2sbeh3ms PUvw8sVn2I1ht+ekx+/0SbkEtpWa7pTEJsotqNzYFAMZsJGVf0+exsHqQBpOc67Zv49MzG3SJ8Ez F+AxSxTYcwtee5c93Grz68vzI9Lkjdv+wKf+78GRuOpc2ott8OSUKchKLSeU/vE61FrkcnjJnNo/ ykeJsWtz378y9od9PlY7hS851Et88jkK94EaV6mfQlYuDFftffxi9da+vgFXfYrH4yKMO9//RHM2 O9TzTcM61mqNY+OtFT4vwNMUHtIDp0ZeWFx5Ska90S1Zz2bdPwvM5kxwi7bKa3ZrEvAK7/Xo7k2B YdnwyvU081qu6T0o3/PcQAIbnrO3wMIPipm2GOZj56S5/twtUaX+NxCe95sYuU8o3KnbKGv3qRTA S621kSGN3ieB3suYXm9HR8g+xaobuHfl0rCwqC1bv2Mjh6kOOEBwCxQ6r0A5EfJynUwRFN58m3U4 FN9iIGhPbIbPZWHLzrWw7vTbu4tq9oSmnR7r/mjjfpwkmXbdZOXlxNu/I5voZtehGaWFtbBl4+uD tSwpsUoEHVCMpNgKoj2een7uae2dfVz7CIMFBizXklOkpaL7x0uTHEUga8SqtdH/XTysahjq91yq VJxZoNOpnMTXlVqfpngGvzR2ZN/eLLH1Pm4f1vY+uy2wtQsplCiZXp7fJWEqXO6KPGxXtwbcHc0E Qp5zKW6vW5+dXeAWSdEWGCxmRMXWBdGzMoYFRylvcw3F4sDRWhluA7Uvuy+6K5N+D8dpbIkr6H4I lx+N7gcU1hbYmpqNgUM9y8+dvUHgoRf2eCR6fmqEwP5V0WNw0eQn6TinpF3cJYeyCnREpASTZrzc w5qnkZdHkcolH6de//2ew5erj/cGgUKWXLSdwo5NUkvuk0YZvvvGoN3jtAB/l7DBhW8LJJj1/ACY PVTFW02S9I7kY59VtLR2lZQVNCRr7q5qybgv4GH6eh7oOfF53iBw4mWlJkGlFxKwZrzlZP9yry4B ws+zItmv5wCQWF4xF66IklGSD3A2CWgT5L/jqSMBEroLH97M160974tQXgRaz8+/hAPjq/Nkcr+B PaCXcF48srmVVRzn7585E9S1BfGHqy51W3sjxLxfcpY+m7s5pL8YusVxt+9ksoDSRJ7HYMsm2yoD 8xBzus7g4qLz3ep0JnXa4Qr7thFWRIToIXMtwQooIev/bXvQ+tG4zi7+Jfz+KHqmPZmyIrQeeaOx TxlP6STi6L0Fz0CVfBghA+kwS9Zz4qTVyvPDjbEl51Fx7ws4ofPpcD2i4puCWiidRFXf5CbPN7Bi jXoVuUrUuoWiKgI80z6nFPXh/esq/c+9Z3dseZwwwROWAan+5Exrmjfk7PJPDIpomgwhpWErFmk+ RaXqXwlotG5zPRSsQ4XntaT2inE9kENHJhfYETOkPxXc51EuYH5U4iLs3VBL/lCplPSastThlqfp 9YiglRmTaGk1irD+T6L3mME7648NEz0CHxCRxFLohdtlp691W8Najo1LZ6d+BggJqfGSftKwNwmS /k0t/EM0bcFrHq0vz57QAdqoleTxb07kQGrCKEm/ez9FtbeC2G+1UP+K2jyDWkxIFh0QcgnEzlQD WwUr5lE8FCyWAvZ5fV0FFv/+FaVWWmQwSR6KUQeWUS5hdh4zHsSc5e1HidrJzlut4EHahFGO1Ioj pbG4BzBtAIugcqDiu+LfdQJ08tEV9A1aecGm/wvnMIaE+MBM6CkbCzm0O58KeS0dRbQTgevDJvKD 4w9d9eVFWUCDwb/yS7ZEGePMtx/AQMefhEPuRYnjQsYPQ6O1FnFDXxTNvUbIfXG+F92W7qX+4Xbx Xtg+KUKOpw/shG92ODu/u/uWn0QB1NZKj3iviphQ1CpymLqAHCiBG5IFftR6z9VSJqS02SiT+ijB QEccLZsqqA1hjJTMBnfQNjhQ9CxUh4CFgHCBP1ZyuNnxqf09p75JbtwvnHxDDOZWQMDaxXPdA86x JDpszNu4zUyKWqnkcaL7ONZpPCCHx+LlVptVwj8jx4XIAunED//3HVFnaM3kZM4kXGAuWvP8eSse gxZ8pYU+hQCEEjVJYouN/o3Fv8WbHCiEHTzSC7KfnracuBawGK7MuDYa1WkX7ANWe8Sop3zpgZr/ kr1EF0D2FoFOwypQJbnXZ+o7B/tv4zcf6bUajA2c1lYoVUXy43rvxKYPQ1+nVCKNRwIsjtEc0WkA YFmWu8ceDQTAkhv+zipvC9/sqKoMqW7hMn3xJZcNNxpcVJS9ahEP4txyESm8CsECe85l/Df46QkS h+c/B76v5hbofyCBYfIzwT8HUGg0mVoHufhzD4unfD4ReZsrRN7HWBlCzlahL55ZAjbF2wti0Cb6 jPXO4A15goUWyLzXvzX70SpqlUiWTePvXZX+h6XzdeTJ3RlZXrMGnhnIUL11EII0AVPXDt7LH8e3 3bJSBV4tFb4PjY5ojm8jD7dM8kpLP6Knherl9e1+gw8rseYPHBmCcsbdftWgRXN/7XR9s6Xf663R odlTAZ/RxQvlrVWChZeab8k6txJVZHOrOQLfROUdvJajD+s5AoouTRBu9NGaB0lxkzf3ONZoSYPD dbxuySL8UKw2rgDG/18x3uSGitGCBDQUoW4ZVMTwuebkNaNDe0/aWtHM8tF5IbO+/qqtYdxnuuoH vr4IQld0m7K/cyydpRSRO8UIECsdZn4pZ1hAJJwWUit/CdhP0/K/9r2JgLBB6Q0if0qOaB7Kvb2M P+4HJaD2VylyQ6cFsnpkC1+pylk9zaKEl9dwSGCCqMK3V7dvi/u28KXVnm5+KqQgnUF6lmiYEK4g 1P+gtY71jHylC5/rxw+YEp35bgkFuLw7wO8zJ6nmCgY/DvyycpjjjBT8t7B14T0lrOrqil4om2vv C/FnV1XBXv03v7GdDhw7Z21/WOhHVjMabE3lRs6y5L8mqF2E+BgN+eEBgKW2d6nK+Bj3zq1zpQJw D5xmPUNBe+KmIm3R+49JBg9DpyZN2Bcgb8O5cIqLpH55dmanI0nZkjYX/VqDy1agyZxwo6vau696 Rdhv07QZjfnyDoEU5Taw2gNcDCJo96dxSVlc/LDcD5qRJKWrpao/VkI9yq9cFjXT8ybcaR3bE9nk 9y7quW5SNfTS+kDubbIu4VNAOWOVt/2/qCwyvW1CF/8yIIaemKhYqaiYWAellwV+l/7Ueo8U6O31 m86nKsm6UVsK5Pxfa4vlzopS0qOGdP7d9uzE/G1lG1hyi3O/fW16IoLBsaVXzxjy/JjniOZQhhN/ 9dMAf5XUPV/d2izCGi6M21swepautUCY3qesPzOnTR3x6U5sBW8xHocn9ioUHIIQfOKOcmyD/BZG yjnsmjJL102kHLUgagFx+oHURtLRm/8v/FpDaqE3aXmIoWJfSisW/77rnliavGP2gYpk0ntKXCzR Q5VRs5+fNV6WRHR5Vp4lNp+lKctC/mSzDnNd8RFzQ8w/ydXg0fSldixhy0ik2v+x6mXmJTSofCXK 381R/Vi0T/DBg97YHQfL0VQTPQVrFt8gE2epUjb+vAOS7qnSAvaS+39s/qWhjozCMyVs3Q6R4P67 cKMspS3HwLgtLvDmNYxZ88uERWkZWl9y7VsedwUTQO52UAEqcXGfFbLw3x+MCELTLDHlDPCZNDrl MaoNel//a5O+wBtEfLHtiyN09QfpFLNWmU2gEYVslM5XsUTaJCsxVbapJ6wVvIV4HBkLGAlC97GM c3sIHbHujGP0oKacGhI4Yga/k3KEPLN6s2rWvPhWf/8V2C5Y12IqbRTAVCEpeXZcxa/IvnNL+G81 xZLkH8sZ6EboxlqwWshcE7WmNhPdFawzeUkZ9k8j+SvleUn3MIuwMZEIfqxYoFfYogJX5Y5JQo6I pOSSUhifnv6PDz3vhMhdeX5B3fI4PUAm6ntqTl6o98wJYetOw9qVcbCufvnzgn8l21h8JRR5/AEk Yz4gHSka/Z9dWXa8qJ8z3ynDirCkAJ5Sryc2c4yAhY+m09oflsS4jTsCle+rDgb48VdXmcgR+DXg szJatQaC4oXqhoIFe/IZtGrXyMl/Z6W1oLRKoBXurEgx4562hsZPPK70X2JSKd/A6ytvdPN4yodp phqW814ri8h9Bin0viegClvMybzkM6LYMmfXS8b/EXZPGadjwpJU7euX/QrYMx6osrsvotyr/qsI EQpHCvu24lgwT8KTQfKgcZTHiXVL6xOdzFj539q8uf1TAWKqCDV5nWvCIAR5SjMONEctLu6ADTmX qJCj2yUa2LR2moJT7V+WRCzgTVg/fB8L6m+rzykw0vgFc7ewDcXIBeJVMutkxJEpqpHChubRDtHd V5a2LwKb0grSh4v3UQJjZ4LzRQmQaNqRZqmic8M0Dmh0U36ryRE3j/oGtjpGORjkpjhH7akCxL6o sgeDgzV/MFSgXpRZ3zAxJH5njjnjsQfGqnX7S7RKcm80FhSJ56bkjRXTe57x4aHKKGmL1UFo6kWK xdT3ld5e7NGf6/4nP0BWmTJoQeCrsGjcXTdKXAJECGGS9Gum6OUrJO+B0oRX51Ie/5Bi8HnjPOxr uQJeSAimMEmI1rosF+NwgexTaOehpGvevNdC3qQVreF/3MJbFQtax0W8NAnsnU64z6NafIvqLk2r y6HQ1Zs5jzKfsAjaa7T6jwW5XXTOiBi0VM2bjfePbn+CdkXzSocsCBHlrmpFfpihBy9iF0pcpchy /4/b+p1GomXOyyxVAlXyekUyuEvA3+1793BKJek18YEnB0lSxvXkCUWvZ60Qjv5Wve9y0mLh1ZX3 66yBlMRlP/Cl8LYTCYrABf1mTbzj5Jng/P/TSv01eAkyWiuWWi4oBDjXONOVmgdQwRjai4iC5CBq /CTxgv5d+kQJwpV/WD3mHRCptGz2zq1Ad+wj+xrBuOdeOsKsx2wW1UtPu+H8LYQYPSolADb1H8kW 3iqhhuhVRVM2M5UFgeF93fQ1k8cLdDgQhENH83Flj6uTv/oDaV7ZcM9flHF8uUy+YmwFR1jm/kEA 4KjG6AKTkc1dd+AFhocLKxQLr6a9HujQxplT7kytRl1XFK1ZLpCicx4gu+AdHsuzuRQ+GEdYH4ht nq+6XPyfAi3cRal2LayQD6GhrxB9CsUXtQ35QRXNnQhj5ouVnlpn19Pcd/kfuyNVInIohBypIQ5w mTjjMK6L0kgisCT1igEn8TslzYsLD3n+i0dA2B4PH8c2LKkCXWwG5S9mtnggLy5ctkTq6O0rihBd PL9RmeeDb3cQ/mNLpTBhppA8ei7fWAHZ+2U0H2xEUioqTRtd42S8siNciXjxwn6zRFKWjn84kD4G kydgSitYolW1lAaBuZ4j3qlLGBlvxycPl03QeXizFMzjoXvsH5O8blct8DZaLFK+fwhV3PqPMHuR vNiXPwSu38zyW51kosv7uRfV0Hb7maJ7eP7vnL1ulyxad10Xy9T6G2T4GSO6UiwccKxv3GZKOU01 wo1hgJ33X8vmH8OcU6q8ZTNtwmhsaxvTfu4bfhGnp+Hjnzt99y12dNqadtj+vH/tzxrKK74yb3rQ 5AoiERmqcg85z3UJJJJqG9SVo9zDxKkiwbvs3NFlOP8UUzAWkPzoPb7WDLKW1Heo0897WjG0DpoN N7vteHiWnklrdxgpdu4/blmkwwZ/8sJW92pNz6FI9gwBz+BWn0MQAgvlw4RjpCkOIrH/SU0zkivI MkBYwZLzSjcFAVAeytgdzb6FKpc6eq0niPfT/pMvCVlhwn/KOW7j8B6lz3JEsbZW3Qv7iOvvmJkh dtv7lPBqwQCJJphkZOsf65n/pJ/kRqMt4YSlmrpQCK5STAVeN4v25qWfwAYwQlKAebBm7T/BjgVk fc/8iSfakthS4uwnsrrMeIZw/8RZa2rRb3FoYzgxL7DH7Jb2P81pf8ZjAYnoyBmgkg+xXU1PPVB7 SMlRPqDAJ3tOSkbGaNJ11wFa5kpwHD4xvNbyTW51En3iiFjwIk+IY3Fpb+QlZJo/Sf3LPmUjjCa3 f7l4aH7/FR2nkVogKy0tWgb6Mjpu/LOr29tbUKCnDmg3mL/A17RYBV+Gxaz+P5Kmw+4MYxxhc5WI e4WGRXjv1OlgBdisJRlTskxgwIxLj5Qq5v/ants3gJ1ZocA61QJHkj9lMXdFPvDPeqMOo5SCnDwZ H8mgYsyUVbm9z+XVbeBT79MPj7/HIk2b/TWJz3isk0mYwqcW5ZaNefSOr+VmamoKEMTFiOqRrwUc VhOiPFr9g38NWe+MljqXOPBmCbGPGXlaMdRSDHdZHXVWrHf7B/xbmOKGvWSO6rzEf+J2c9N/JKmf Tb4BrpV6VH2FMXkRi18gD0wLYLUdr+Qi9jcMyN1UMvy/FiRNvhfqap7cVKNtjEpHlnIVlIy0bu9q cB0KiprHjDPau/TNVanFOUgd9gTyzqC/QJijqeNCo/kbOFlsW2RDqiKYCY3XUPxJkA86QFbUVxDT y5iC/91P7NVAu9JDw8MmqixoecL0GbSzLHfMqcJO2xHBqFjJmjqogf2WP8R9HyIco+yHImeTCJ6l G3nNyI+8KkPPclEmGhgRaVFgBmjCmdFIVBYjF8RkBf+7iXsCdRgZLvQlpxTZVN+TQtBeIFXoIXgh woGqujCXDLmkaAnpM8hepPDh9as0hMTjJNw/oLS/GGyoTexo7jVKECLy7NnfgfTbhVm4D8bsOQgt 70iFl8r+7Vp86dw0t3gYkKAb5lX1c5ae08cazrC1/s/hsV25PVmdF29HbFfn0tpU/hD1fuofT8EJ 03PM6CQIlVxI5xTpV7UU6YPd+6NrnzUS6z1K/wi+3/FTa3ubBHuvkHuOKJVMloyhRxPjhGVV/DpW nf2+VweEVgKdKLltP6WSsBCay5KSzS69qj1rgRw6V+FMliRF4Cpf048I7jRN9i5XOYXt+uB3jKEE 26u/xHN7zTVPKWZeWcZ7MZMafd4q4UOb1GV0PkHociDr5DhHappfQj1yZAKPiF9cAfifNA1r2bSh 6h3a+f5bXu4NTf0n0K+BD3HPsyk242GZLrED4tjk3y3Gk4Clev/L8ALzaIFxA768tthnHuRpdQnh NvITf8PBi0fgph9A0fUbdi7RBzLXd/848fXW/+6emW8DSEj2hhA7XFMXL7rzonH0snsIGZMqF6dZ LLJW4cJj/zniP0WvZwFh1sBNGlpeeGfKJL7zEtl9m+Cw2XUpEjermK8WcRUf2UvHOKy9HK+tqD0Y a/kr3eUjh6z1jwq1El1xGoV2QkklXT10c8JQ1Q+dV0jOzDlJPw7CDnJm28ppJCLwSy0bPXouEioq a9lcUlRlyQbkWt/Y0mD3HCPJ2vVhtSzA+bWBJWhtph1vewKX891Al9O1b+TG5C9+CZzuplvlBG+4 OOEvIn9mf4SpTApTkJaUmZjAZGU83/1zlq41wEB8mHLkmO1+IoO6uY0ZcPl2FW6uWquWlilAMkVs otWnKKXUfAW/FwcEz1+aH8U+6FF2OJma0rxbXmzrOvfu3fzopj8rKjPkYvtzN3IT0hpwgSglxUB2 h8n3hP/PASFPxOsKeep65Ykk7YFizXbVo+xzNGGsdKSPUEacEw9Q+o60FLT7nxefi/Hh3gIZamws 4v0Dm/HJae7S59Yp3tzpaFvp+yWnly1mggTuGyIybMtNwL/PbWDLxDrfkO/9epeX1ta67E4g2u5s v6jhhYihxapjENPnu93yvURTRtzYzTv+f34Rt8fkEEhNXis1O0froWqzR+Et7CBxRSaeNN8XGbSL y9/oSlOBg7N5hxXb7bO9mOjfTe13+yE/4RTD3nDBw9quMtB80xuamOoXUU5eUWxz+6aimiU+NXbj P8u0FLtgUA9otVs1zxR/YdF37+BCmiBMmHzlabgb/gAI/PJFJsi2cAMoSIyJLXKNY/xL2PwohgR4 goV4E9AWujIXXulWrY8LrpwS5X4Xh7PXSSqS5wksiWh0EfxnvXBi109tfYuVDA62/czuRXA/OCh9 epBobQDuIfGt37YXfPdNXVNw0qrR5Z87lh1oF5RI3ZnvdLTS2kpcFgKePZB+2V61ZiehiI9s6ds9 clZNAEAo/zmDLbP0UpzwNjidrsbH+5PN2r7OPDeX5keVC+jvW4cWHxtabZ5ba6pcnrfF7x6ycw/5 H9/296LkAqipn8iqgw8uZiWqn7q70/wE4hEp86+JvLKLQ4JFs+SGNtMavIVEBlfbaqVC+3tPFwSS /KvMnfKaX9OyPKgdeCrtxM6f5X9reNbOQIx5EJulfJnmvvzPEDHFzuXpdqrb7zYe8U/Jjn4kZW4l dXc3Cn3Ty2Dn+Z+aRlXBPMczwSusrn//8xcVPoQ/89mqr4573iTRcg+o62ie8stLBPPAUgwN444P vXVLKYdzh+a9/oF2MdHE7nAVZA6pjoubrT7eNrR+9jmEMRLEqZ/2/IgAnqBiWnl8swowfZeA8unf PtRsP+Y6OTqQnvbyofsDxld1sAq23U85mFi+g617l70Fs7F+gzefY+s5T1JNn+5MTLbqjxCaYler JTqxHbR4tHlO4qQbHztP4yMDpsMdJXkVxYInkSOcoMDBhfe3zaYHd9YyMiZF6PxOmmzGQu5AO/Pm WyP38BSgRED9wBtUxFDNrN2/vrjGa3H1PLUGJHOhU/5+FH6YzbHVB2sGT652zrcnm7cFDx6Xu9tE XnwIamVgl2wV41Fs83/uiyl257geFqerIFQ92g4tIefrMZmCTi+vo51QmRBX28eBko9/HpH5BX5i B4PbRP5raEGlPu86c4rfboEvc8E1pzKAh5tg8DklbWRxay05xoGu0ITE5p/GcxKRV9jajzOxnMZr DN3GCd4soI7uVkfWBPAR8067PBpFJ8hsxlw6GXsghkxRgjWSq/457/ldjjaTMN0n+lMHgzbZ0Zcr uGtOVw9EAuDusp5uPvjNThHHPlMK/xkcA37nf9wi+2eZ5lL4rBh3tCJwAUvDsb9ymji+F+kVuVjd fOquxgdHrt7RLm2hIjacDpZzS88xoP9L0mcoJwWm8LOO5+lmgshqZz38nWBIhoxTJetlvhPbJM/n L327JA7gS8zaXNA/c+KHRdFv0Z57+d1rgY8ue+AJFjdq6jQ/tlv1rslI1jgwD1kltszmaUszFrug CPvZP7slc8rc3W3roWFz6oTAF1cRWJedox1ihjsbeGgz1n7c2MMeaeN0MLIQqLcLXvO+aAx8SHtO +fRTJOZh0XlvOjEeJHu240dS+WQtcun/HdyNsrHv7nxWcDXGKnP4Roi8NGf+TsHmjv0fW1Lmrk08 U7I3fK/W5mG1Xxb809zhZWG+eRFsKo/DEds07WHPhCvJk5kHuxLYfc2u/mYPXYJVoGqcdGSlPkml Pg+FbUeX1+n2atxsy/p6G3cnbKzGXKtJKFCQv6o384Tv5b9glgNp35/DdfBu70w8x2ViEGVwB7C7 Qq1PbbMKNjKKny4OXAmqjxJkCjX1TvgeqY84BwfbaieIBQlipUN5WrlBu4VfWv8fTVcd1+T7tVW6 pJHuBmmkR3cjICWpjBQkpEaX4GhJgdFIS3eHKDFCQKQlRkmNGvlufH/v/8+ez33vnHNd14nnc+hp diJBaev+WY2sunO1sEI90UtrRnEA4HfUHIvNPv5pnN4LenzMeha6dqmoZlrt9ABVPrfTC6GOcXOV oXVKuqjypKdv0Uyj1v67w1BRdP0VtiEShEKTnh613suI3PMeS7uZZJUikjjJS//m+8oFqw4hwLVi d86YpPh8jBApswqW0NbquO8qL/wDAjK9ssQaRvm/JMh72k/lX7pf0akAQqGEtkjnzrLfnuwJ6yLC R1ehCItue3p2obgkzg0X2vC8TI+3+yWQOotwEchJK3rc0fXUDrg4B061Fsl4ja2CxjIfmYT3ivAf 3U5nx3EeOkJanGdMLCEMGo7mWO4aAizqF0dtDw58Th42uarmTHQiIUnr0OXv8MbGzm495POW29Gz Yr/v4f1QQvzcVaw/X3s/TSE4uiOQOHqOAbKnYMyWogijG4a1ligeLikBhB3vXn+GjnwP+9UzKG9J n4eJVQy/D4Gh9pUHur63mGPKrg9df3xZt+i1vRkF3fGSHh+NgtHFr4X2fgqvG4WPDvaS+gahoc7P ivlXgtJErrmYEJO23ZhhZXflT4tAD/xQqH62Y93kczLQLwJ0fARHRT7+LnRSjuzKk+xKRWTV4c/2 yp8/f3zfydm/8cu1oyN8W3+yzwglHL5ZXXvRQY+D2s9YKNpCZGES0kVcdeD8rm0x4QOfOKOgNBv0 U9Z6PuPgiPSMiiBqp6/n4lyL3/YYXq/L3kG83IeN7ZnWWW6l03JpNQIwfyw8ftIlm0G6d0Sof1iG 479NlglYXp+hk4FVVTPxWxXRTe8U1sUBPYR668nDdAGc1eEL4F650AM/XNSyrANnW87y8Al5r59S fxZmGtqMlM3jCujEfKPgIrJF0ZT2cmkZ4qynjyz5Y2uFHYJYMma8vV6wURKcFtwtWi1JBvFPSTzH 2T+Z/EceI7GCBuhGI6BGvfXOOdPr0YnfYwTt9iNIgNSTKjq679Fcr+15J91F9ngMoDYbntmwY18i O+dcTIj5mYvAFzoq04mzu5KS5fWqUIfVS/jn0eEoe4k2FQWVFiAFiD4t8wUoiAhlEIMda5EWgexI aDo1wA39SdX1QWCu7RvL8tqx1483PH8rAEZQ26z82thSo5Ks3demFKyVoO+8RF1d4hoOFnyky+Ed gGqqsXgb9uzdSV57Rko6yp7AB0sPkIvc0uIXdAkuBni/crtHqo/4JSTGFVoJVbZG+3Jla+AYm/wt dNVdO2YcGm8xb9CTxlNI4O2B7QJUX7p5H9oFXMj4yp7C9NRsCWUo01+WfaZ4as6EC0My66U575bB hyLiiV6Xb92tzoVtRPvbvwOlqWGKPFEfvD7/DRCyGaurTOSDoDaBjk7PmbDQKcWxEJlMlN3ZqwY3 Um9/bWrC5AKQaTh6qvqxZ+M719cLMG8cBwk94FXlwLqDcrBAe2Kcwsrvr2GjM+uPNXSFRwtgPY/n Q+qYkKiLL/txzs3aJa49UvnaDYwerb+JfV54i/tkZnb3tkr+DpPlub/x4b9akZHE3NINon7UAq2h wPZo+YUfvLxgL/SwX7Me05sj5qFyZ/OzeeOaa4MIvFVhMAaB0yNQ2oMRF+e4E6FtuXQ48WD0MmPV 6d0hNRE91wXcXUftdemKC9qmvrS3R0L9wvjLVmRIk79bu7Q2m+OPrAsl1iAUz3p61k2Lb8BRTiZb Hdk6EBrAhxvWQ103ur1ujItUDx8wz2C+khGgZakCuJHqsw3PxL8LnJZpxe/zH93OC4ho70ussNAY c4wjFezxSq5A3Xxe9Z40RpyfTfWenuyllswnPkoR/OqWK0YHfEDp0wsB/Nzgod8096J8IiQfd3c0 tz/ADc/05jaX47fdF+qF2kATqxF4F/gmiVAKxR+jeYvw3QcOPV4Zj6Qo8OfMwchcC6ze87g/zJdt /pEI/dPxEZT25ofay6r39kc3XItIDMMcCmeSIeokiwWWYVjW8ImN/bvudU+UDT1PmNySsEHQ02u7 HPk7JyZhEa7fdgl8wDzxy2bAOWFymCADY6nW8F3cAeQIQqDgItMnC97QR2115mmcTpEMPXBvpLXf 7egI5Yvw75G12SZSu0p6BS8QZyY0HYNHnQqwNuvfqIPZXjKVwG4S3JF3pLz/t6Rjb66bIIwmLdvT LOPj3RhHrbM3DMyd4dUV/gmMseF1fOSEhVoaftP+q6gjJ0rl8c7oyK/tmeWmx+JONKubj0fKa4eB vmE2GY9zGMRDYWIPpw1b2ZqWJC/u+RMKa+OT1dRv0xJ0zGw2kfeknc6XKfynjDVF5k2JdHtkjAz/ kTNO752RN7W/tFQNFqhWBETzFSdBo/qJtUYO88ao/CT4hC/9eZCpysry60IvmQF8fKHwm7zlhcZj k7R0LN0369JulAUb7oZ+CDqHCSEIffoRyunhXp/MUurlRSg2vGNx6bf/KACEOaLqbx6xxKikF/4E a65/de/JIz58FYKU+gukouxfIvPpG/PgTLfbHveE1DSxT4HTaHWsZk+xyG3lgJTEJdMnONmoVYBR oK36dEbI5Nk3/w8NeyeWE1RncSKiDiYG9YXUyW4hY8lDR3UgBnpCWxf8nzA6CJdX58xw6Obdd69f ED+NhGiRtNDjVdxp0hesKsK+COncmn6kODX98wM9/NeT4pe93I2N+ya+x4IaDLRg+LGvQ6Ro1pdn xhuf7QWF6vsuTle7QpFovPDjyiUtujfvab/87tbiycdqRbPmY/9soLFI/3sXG4s0EcXkDSL+4qDT ef7b4uC3+FvQvwDNtDd0LpZyOnC86HiZ6sLBW44MX+mxYZvCCoT9x6S+5CJ1LTMAeO4Tir6DJ8Z7 NUEseUyQ8OgsVcsOdECzYCI0P7FINOGdcCI0jVWd5waVyzgvAsnDcJguI61FW9yxrzCnrpWy0zOP iQrHnr/kGb1kHjk60TDb9SO5IADHvYf8Y690pS8Qp8GP38Z7lhb+q7gBMIH5j0oaRkDJKOTxJ6TJ hspx6ybFB4ks5xgI2uXZMz1OcRL83YVnKhWceZO+RKxWVMC0dC7226eXvLVRfOu3ewJNQ50VX6wp rOXURN8ptAjsfuXbPyXwCqhonrwRfgtWBAgLkU5RddxjDs3KATgyXWUMXeP45NaxAXONjUS2Ewiy nHR+wT832SxdQoB34BFHr+Df46/eo8Ligk808y9XZyNTQ5Dn+PGlHQ9+21xt5fdX+LMOHwbeZia9 MaUHFn2+FH3QaV9Ixkcvm5Y1MFTq2rrct38vf6fMLS0YFVemwhx5IeWL1hYlDQDwqdusGUnTDyDf PR/BHZX3Ti80r9rKrEX6z72Jmu6eq2NJEnRQ8WlQUKRu+LjQNKnOg61r9jU+G0gzSFsSgLcZtjw5 x45ct2M/I/yaPIaJgXlSCQnCjiok5PuoQPIhHqeR7J6grjQuwwi0Ga89o4QeXo6GQHNb+WLVi4eo VNKKcsGo3aBUF9XoFzrf/vze/1Rw+a8w/m7Nx8/+aOARVI2XJw+UNrTyOH8aHsVa/lAeaHa3cAqd 0pd2C54CennzjtTlFn6/TPV5l9dw7oB8YMyv+K1g5k++bcPGtrFXZ0iZJOJJDFJBjNZFxx9PSYkt h55Lu52iTLqV+vrT3zhN6e5OveJLJ+/8tXpeQQ7fTLHfsXqIOkWxDZr1NBFG0+RhGxQ6btZ3VMGl yb8qRFu2rP42wS6muc1MFkn76sK7d3IptV7Za25mwnp0g7z2vpspPlyMK2fOHI0Aki72Loqxphf2 eGiq8ucFoQt8SvyS1zFrcA1BAK563/yRFg2w12s8DLM+at38MqOXxUDrYjE5Fhs58nQ5BJRG+WNK 5ClqzTh1sCbmGQHua/wKRUCCZPnChNgGKZhVkPeyY3fi1dD0+jY1+RFVwsPOPonRbso/mSvYBgsV 8XcTzdM7vaTbN3lDZoMzdng3ly1v1KJeQHqR0gGZ9odxhkPxDBMJMc7+zahe0exBFnw/vvkMjabF 49nGrE1jiqPh/VRziDRP8CfOoZXwK3w3UKOGRNu7d/xHO6HAfM/hStXntJJNncxnp3KB9nHv7ShQ IgrYA1u7CMObdEktaCp4rPrK2zxhD2QuSQcT1e08eqt6RDJdPy2GH9OLWh8e8IzDwG1nfjbJ+tsf MwI+qaamSR0hV9AV5rpNpEI3C6VQXxa74FRH0RrS80QPXitFBWvOSankuejdnEduVv3TvIn1Vkib PungeAzYU2kp5WjMSOL9dLa6h+TfoSXmkjC354vSXY2NY9sO3WG7bEfzlBvTOyKXFovueirijS2c 7jC2qKQj1LbKFnPxpOD37W1tj9csZpggFVfFXllUtKvTQubEuOYJelrcvB627JHnan0Pous5+nc3 txXprtqel/J3ihA/etAWE6QXiMWmnmNhKzjomFaC8pmhpeTVv26uK/v/rBIVkXFwlAnbJN05fSQ7 7sHhJvlX5dKQPcmUzATthKpGtQ8V4KnhXaFX9eOvyr6MjODlJ/Jphn8eHalj6zifrf1uPLRpGLUu ZMHd+PEa6WR5t2J/+aMoJJ/I55Seltt5Pf53kror7zMnIu20L/N9uJnA8f1kiskGxUuuh0g0JwsN FvTioqk06KCnfk/7emIyCCqDVjdqUhkC6hKpjuHSMbXQev4XNPSb2gfvedFKLuHrqYrPOsdiNAC4 R8nLNNaoH9gcVgAk0xjkRmRovFX6762GScFSRVa4xwv5RPWPAtenmrkA0+r5Ml28TOeXtS4OIMGU tYFBfBDK1PinBFxXrrkwRUkGW2pAv5iMMQy+nfwujjJgkRhokDn696+tisUAyi9vnmve3K57ZDGY hISu/lSAY9B5pfU9w6I8yiT//J3OFNODqq0+oxdOQ/llvbuzh4FKd8SRE4p/2SHdFtdESgCRP3bB jqm9UFnRLmXM1VcKh17YoPKnJdv8pffyDoCGPjheYaH/x6QkqBC/aRjuei/vCif00UO+0iz8p2O0 1M+SsGrb0P2AkyEZq/gPVSaDtYh84Nrb74S+fEx8JawE2u6rtyjr3r4yGKQs9bKMWmNUNoI9PeqQ 7vnFZ9n2uUuEnxWZv2sDWz6XqKel9a7LgzvfN2sRwRSlG/AosU4WZibx8OYTAeIBlK4IaSguh9WH N9MuzP11UY9z0FYYKJAk9pz2/V8DyaWWHKOP3a34AMXrbQneQs1Kk/f4V8Johb0ag4nCYVhQWTuX sbvXEVlhTaFD4fj9vCHQ9FVGUEatPZUKGoTOlMUbsM/lBMbsV3hQCe/0h8H0QPCx10dTwaZ0Ql5Q QORk5Uu9DKCNHHYgizhfqchsoeP+X1tc1BGAN8/9hMj/Utkp6wjvJAatPZLtquszixYdqRNJ8Dg5 RuZN7KNOaUW1mM4Ptaz7f6yB9MmZoU9ytvx2+zql+0ed10jrt0/mYkkCFmtDXtTZUao/6X7+cI4V 5SkZf//cmD1J2fEQqL//YmJG7/z8t0H/X7UX8RiKWtxgUJpJQiiKFT5DZUydpOlgCJEThLxMTtpm L6nx76mIgvK8LqazkDFMJ1ohVLHkRps/aUJsiAowJlBXWbP8yQlLWAr7n0J5CLQzXrMybdJkTIDy B2XPLRUqcpPU7DG05wapVHSBr3xKN+VLXgQIuqjX02/TWH2wyLIa/egQzjpU54vy70s36EUMD2eW n6k9/l3PStFkoLXzs+fOREs1Ve4IFxBbKi4NvrXDaALger77tAbce2N60+5ADdKB51V02G6rMmwQ rNvGZcw05JpSElJcQ+0JuNjUhcJf7ANzBwB2LuD7D0Auz5g5b84xIVJcerpN0bLo5//mqIXHcTZl VD8om40imY9Vuw+BynYpSuuF0RXlALn0wIzVSTRHyosZp0Qo0Xd43++RMTwmrwqcbej6YR48/EH0 h0O/0tKoSHbW9aGrBkyvCoKx8m2G4S7Mxy12Sun9NiOJRT4Gtpc/pJBZ9/Xf7g/cmRZUYuBjEafh q+3H23TGrudgG3Xw1k416P63DkATX7iL095yEHkOQeAHthhWKFiYZ+jnZQuxpL8cMGPe3bUbHQAN aKMJ7Lc2JcCM+PSpIASFUC1fHIR+jNTh4xAA4JyQ59vQZ1QxSQRI7xnU36i3FwQj4ddrHR6O8syd Pc1quRlKYJ77sOkvCMGnqpw1gigIMLW2Of55pdoaPs+PqDSNgSP/IBT7J5Y4yEmOdFRHU972vWev rFX49zekF5+SABLOxO5SG8Ubo46BamjcUUyTvXozJmfO6irMdGRqGylZa5V2Ger3Qh+E2GbD5Hqn bmACfqAVB5nuYTUKlmi5bRUA1OlMUvBTU80XiK7vMs2SCiDAZCxxIOOEdRlKa2d30wzbeaMm/IZ9 wG3vpi/UmGW0rvFPJS8VmDUmNZ0mUBHua8LDwh3z6hgpA4bkVvL68Z3VvrorIf5tWv74qrb2RzlT HtZutLk5eQlCcgnPo3ZSX9Ru+JvngU6lJaYOQaZbbJ17T6DfKHgOYFQ/rD/V/gwg7JSqeSuU1SuQ WcRp+8ApU6qfopgE0RKhUWTokFcmBCB6pfQiX7XNqkIpRCXV0HjQ1oMPQAJjWPGHEn1b44RYlybx APUuJ/gsgmCXMo7mhC4p6Ful2cJQKHM0ylKXkJYUCtG4GdayuOTN08XNf4lvvymVvj2u6y23c6NT C1A6orJ83K9A8FAhUe1q1jHkpldM49JIy8CjkRYh0M6e4M2c5N74ff54OUUeUE9iRzkU2IJM3MH3 MelXH3FHhKT7CY9Ozhe50Vi63WER+T+SB5M5Vvw/TikVCbO2MKmjVF3oXUdug0kclfWlvGJJGmTh Bf7IbgRoi23MwJY/QYWAOCKqLfSDwwBKM9zvY3nFnX0TYnsp7bwzAtWPGsRl3hC2c6wkCdjLt1HU spcWoP/MOtKHZAipddkAIISUAOutXQhQNAihMGwLNO394SS0fuzlE3wtZ/iTtZ8+4a162aAyqJMc +U9Ag2pqBpyIumYZ0UT9vez0prZkFAhyiCrJ2j/xA06lL7ND7yqLKVpHZa1RnHI/cHGF7TB69MF2 Avfl6+9UY/3GEdRt9LPr6pz8AMpU6ltTu2fvkaH+lJqQJM3eBG6wkOedZAYYN6GPe+tMIsz4TCbm 7whWnuynRGglUDAVtX89DvmfOZRG4n53WbD+x9wNWrSWgVca21FaRoEOgvbknYDSw/4Ng6N/E44Q ZOC4Y4h3lRQT6LliAWaV6fJ7OdtGv6YXPIJCJ4iNT4WSWTWkLeDhtwY5qG3l45dfLFixMPqFGh5n pnp9D21Y4yKLoGaRD7YndeaPHyoG97zPHXou2o8yxjHkbEp9TO5ClSpRNEb2Q4hYbGqsibBI/yOI Xb5+7A/sJ4YO7/XJUnzvUOAL9PSKauwBfgKKoIF06pWNibC9BhnN9+kXACU0WT0xmWAs7v+SdSCL SC8zvhdAwMvFRw3+7Ym5nchIFuQVI0Q/eNyd/im3Fzviv+QF6q8+OfGBuiFqvLSIqsmgcmzcKY0V m/syO2dOyCJsxD3Pm7Jmpec31S+IMxxTAybAEonF1yBkrPwVu5Geh7a63umimDAw6hxMQo1M83Lk 4dBKUSg15sgsr7blknUDrnkZ6bNeGK557GvJNOVBKoBQNqM76tbyc+a1cN4K0yzMONNlcT5FwLO9 gUqK3Lemouf/7Exf1HOykthiPjHrQYmZE1MTQZOxiQjcCsGKKiFzJYQ0HoL3m1MQxpUKNz4AjzZ9 4xuqoq263us30l+XhnF4Evp8GGjMOZOc+F1Z9+/GjYf1e0GWrzjyZH1Uj6Fu1vvg7h/kxDDRpr9J fbw8QhXmFObEu2dmyXjRvbDf/KqqFM8a254cZxMpP0U9jL9Rz0VpbIeZNYNe2FxuFPvE3IcZwvS1 +2xkK2kQbKyPIW8kQXzYjcS2u3o/M2uZSpu8tbwhWjmExbMemMoKkRVcvIlComkSgqGDv37mjQoT GiYcTbhDFPFsg4C39Yh1pG2noeZbIdti5qEt2BOLsLdGj3P0frw58mdFeoeYMvX1j2/U5tO/TZ0a nYxiyUOrig3KlMf7B5dz8cK+854CiXcxo7+joF32mkTbN3YY+KnKObxCrFGj2ITMKVOLexDnb2oz rNyWvZILR58InS304WG3k+QwJKiqixrjwTvxzCLf8uwrT/Y/91D+u7HgWVUWYS0PwMOJNOyKusZE eonPppqtsnM2Axk377R54+5gbPTXtwNaP1+SDfXA3sv/IqHlwMYxGkQBRvcOm0EGUIYzZd4/p/Xb W1/uuLuOFl/Lr0T8HYG8PXWipX3yK6tKZ+1IJ4g7PgzrWssUYzWWozOjX7L9RK5dMWbfMsB8mQ2E hVXqMTNCjHRWDVFJM1KdoO8l+Vs3cDhIwbA+kTfpuFvYJ5H+4nFLeEdllkOkpLPWEhEGLUXZlguI W6magu5A05g1aS6qhyBywuFLtcXwznI9sKr9mAPaIqmtCTyP/5+KGM+7G6WOMiLb9e6TaK99K59E EZGVqFasJN8qFFy5Yr3HRn4lzMHeFYmSSMEvpTKVAsPZNM7aPJu6nXAYRczDJ61UeLin3RIwCfT1 MIirgoyvuj6h/rK8M6h6VUFko2SnYQ303Ph5Q0u38bq4YCpX4gSkzE9fzZ2KuNJ4uGYdhCrCmbpB PrKLicgz7Z31oomJUiw7iSatJ5vJ/+jupBUV0SfqAerk7xwuo3TasyME24w1RlG9QQ3B+XIDetOT WwkudvSk56+PafEoM1lLw1ayCz53RSEfzYiCOvzztJEsmXW+2cQojB8v/SU1WaKWJfBPgiJH1Sic lCRMgRTVUcG88mSIrlbj4mTL7zmhWdj24KnaGn0jlG2P/QX+3SzzG6ecAh53mcfKIFLV2ekF69Rh yHPy1oblCXbKNxm8iZQEYz1THlHbknkm+aah/Ws5toYW8RGIDsV1R+fELq8ndu0m8k3v+jDNj7+R b9RnJIE3nFNV40eBeoGYOXBB8gsUHiDw0eRmyyvJ5xVed7nTgs6x2US6mTTSfMc99/20ych0iIZB YENUyTKzFAqY/u63m2Vkwv2rFzZDoPhVLrj6rRAzlq3uK5XCrJDZWFzcE8QeysEQV/NS18mpbcVG uwrFjMOdDjIG+nY5BZzYAkIu/NIio5ISDV+QuZLB4ENNHXhPeERVRY4Rk46+1ZMW9YL3K2lYHi71 l4xq2r3ECKUnY4DwcVTfAEn3Uewm8tZ4GNqUFcIVRgSunP2zyVSCZX6/pANcfBI4fScGwwWVB5H5 lfONbksPjLmi6rljn9lki8WMSUMOwgUYRWq6Da0sZOH1iEEHY9mV/4lDudc9KfQUJ/fJSLw8oIYc fxvK2ECeS46h7HoJqvROIt11OIsqT2R/0OC6oArzkC59U0VAguN3rhESdO2K3keJR76/3GpHHh+Z DkfIuydn9/13KatdnW+p/m9d1b8mkBetf2bv80k1SyYVny1seqVSQfsd10HMUzlf/UGCQxUAc3iD f03kOSvJM4xiN3/711oqeo4Pw/46hIQ/ekazQB4Ctbrss7p6NWR9x3unmrtDgSvXD2MrTJ0TytJ7 Zj8DZoxIgo5UMYPxU7btSTe8DqL/V84bfT6Dp+nsjDEMO3ofq419VkBEMYiefvLV8ojqDPZGhSzm 48iZ4qKYwAtMhBankw1XU5MhJY/CyteBoVjvo/mUVZEEs2pp1ef2uBj6ZK0GAwvxD//XFz4SbYvE IgOu6l7fb3HPKbgrX/Dg0r/TL1zgGTHiYyGbXC5AzwzeMe2QJRkakr4dFhZMZbWrzejD1cRw9KHJ 6iD9PQ9ONHlj8seciiCWSkcOka1HhoHqbQvfMSxlPts2ARAieMny3Ab2woz4scPz+DkcYyvqaE1G TYyF0DAk81mPgqyQUBpMegYkAdHzGMaezS+hbR9waabO6+hP4Ic71EhPxR6s5Mij9Rmq/CenuoCG YeD8If1nuGEg0Jeqet6P/wzJ086++q0nhXxeaxFoGX2eq3uLjVR/gnfXB6xGQoTrvYJHreO0DG8m 62BXvPnsInHKANViAY6IACGiqU+LFQ9zLZr9sBsvsOHQrks+Y5UCoN9dL4MNO3SG9685XFcJ1l+Q iANUkh/lBcTAkRHcA1Qeg9kJFjN+04yDL1VulWGLcjDlaaf8gbUXUH/NDj22thX0RnsQoGKHYC5B kVsLVbj3SedqPZvh7ra/CdNLw+pvr5r7dGbtHtuWwKSX75E+2QPDnu9sMjThNuRW3obWMZqRNxmv o8evm3j7d5UFv/hRZzMylededNB/jRSr+JfSyj7h45qakQq1fHQwjN7w8VJWUu5Sx92q5poXoFwC 5zDGNzprqGx3o/7PMKy4tthf+Y/2jJ2dQ+fXYa6CIe5aRPXdt99HmeQtWltGyFSXZj0Y/u5lnPwL /hk8DPlvZohYM/lrFhxbu1v41MJrc9vkqo+2GYrNRd+vfyA54n51iT0nuqnW2Brpkc8xXS17cEWJ XW35Phs2+fFIr3Gxp6g3MLCEXtghmeeX2HDKF2dNZ81KPSLwnZcyEbdDENqJaeWEXe5W1XzRd2Fi CpwjqpUaAjvnPDel4d/s6KcGdMtVlnQn8yy/ctQbOJLzOPNfm3uXDsaib9SXcz8IcJAlh13iuF7+ 3FCsSo1lZR6d+G5OQUiT4DPLxRmrZ0nQRCiquBoKUgEU7kjaOFaNn0bhPqlwTIQWZBBjGPhd76qI c3lkkpk9yll9QNoeX/fYgxfkHm2MZJacakamar6/CzQi+jOHIoYWXt+WFa3iQKBv0JUHH0RvVztQ q8FSpEYO8KySO+HdBgGAo5+ZgxX7yA+pq0ommp2eHEITaoUnxOyZlxAZJDyzc0O4Zjxs2GmbxNk5 VPqGQ9sKg7XE7OhewgpPvYYeXrnaPzdmAjY80Sj+ZigQ/1J5cJ0r0as0A4eDzOBY5OKCCCeBKKot iQgdNSwFvLmQkSb9obiSwfftrPivCw8hoH4Vjv7s6StcXFPHZVwOGXp5MtJyRlRhsQnzSkVCIbn2 5tSkU9zY2izT//GVZ/5y5qh7pODRfC157jeReFKM1B7YS4HzofsrqL2Wl4xLEP6/JNbGn2FmXBRp 2aTM3/1wuU0juohVAuI9wrhReIR8cknYnpfwsQzSYc2FX/jKP4+Pez6TraTwhscpqNLP+YWLo4Oi pxdgs91XlgqpU7rv4jLLTNb9TTbqvbJreCIV8i1ZBtBfUb3sgZWT25syMbk70LB1QPCRGEoI2P9i YCuozPWLx87ZmOelfmyqxpL6Z0Mm+eTIvtq4cZwwo3wXzlgF1MhbjjxAdWjiKo55wIN4KLxSjxNb U6lMyd2pHxbPqg80kv/IxR2DBDrq+972EeKGIDtPx7KQE1OSCFsMEHsPcFDkO3d8oHpBEVdsyAEk 7AL2HfWkjPBLvwbLBr3KhM68Rmry/LDqw6iu0PN1KxqpJv593tpYBSIcJNhvyQGgGXbODgjPYksT YbM4/75CowhqeZ6YCI131TJk2FIzbdysyvKDF819v2l+QbQxyONtOwWaBhqolTHC2ix5UtH5JqsW /ddyvzLlj+HJwUj86FCAQQCBTxcp8Bnt2inb93OSRfYZsFkUaK4KZwas5T4i3UKP3CBLjfetRQ0g 3M4/Y7KzB/OS4TljOIaX8Qxq1D4FVEgBZCmthQREwDjDwGcPXOe2vPNpoMSOtYwsbQhXhYcFTB7h X6sSDv2pTrpZT7wlbkSMnpqLKtyI6oZDX9buSKvPTr5eKDKOojO33cOYxcEwk0iHWLaLOeU5V5Hp RIQc9D8A8Vj769oUjh8m+E6ete9Oa3zzXMnSe4Bs+YuxObTmcfGFnaPkfCl6KF6cZYS06w4Np9RG 6KFDAhRzlYot+cOgbxRMYgdxCelt+pi/c4V9RJqJ7r4Xghg+SOGA17bp8f8qXvZ6W8lpGLuvhEMN t79jveQtnRhrx9An/uj9QLZWwb+/yErQvdSh+H1lEnh+yWhe82o3lXqX5mzsd7MeoLTvbzQgHTWq sS57G+fRFZBlWGrHyyp8yUtyplC7Vl/OyzUdiYU2iiBrM6IpJVHCQZW1qe532j1rD8YE3/qDq2pm Mo0LLWsKz6CkYdycDf7F7lBMWcotQzYm1hbWh/Zdab6bllu167vZ+Scn87aaLvmWNWyT/pJZvvnu 0PeBAiysZKmkJOocKDMs3kUvlJbWuFjO8/b5fuujbR5o02N0atQJM8Qx6hA6X53FZYkpL4hK6VM6 cUYpr/cQ/8tMkAv8Z+tYcYG1o0GFUWmVpHm59kdu/PsBT+cLFwEZma/ub9yRthjPfEnYnFI75vkq LS2WXLsht/GFdtOTwHVDA0b0Yq+DSKwAP5Wf2LHMrIZPrCBhtaI12W0LNCxiNRam3Hk0PuZQ8y/E WSWaOTkRzB52Gm9cG8QGisTJGZU4LJEgJnqtK7PP9mOssZHN99nv3BfGbNrJfNoh0IhvJRu48cvk rVi7UczutslDKK3EA6Q/5467RXyfncXdHzT+JKKdwp4dzaFmQMniA0qTSEXvxEGNhopd6wb2a757 x1eVX2GD571117uDrc0MkWJKwvOq/rZIk/xWnhgbJWqX3kO62+nG3OQUEuLIeQy+ULBovmR/7c+t FasQCgY/r9Eoo2dKOOfR2yb5rw284yadEh2yLO3ztl6P0wTPxUYr8iNfDi4P7YZn0bcOpzdCT7g4 h4HZqFw36BYIHbCWbmlofREFqh5/NvTZJJeXTVgh7Ixo6/diecPXGXXOCZypbATTw+xZ6aELFDY3 8U5osM9Av5w6UtCAaczAQIvVJP9N17cOyVwSPARlGXdtF5V0N6rBPC0bwN4dI4fW10YrgFsrGJnN HWmDzUn2axFvJLoIvzRZkMTVKhoGQaIz6EPmV1ndZ7hIaVcyw5kX2KnlH6an0Zfxt7MOJE8yGSeq XvyVCFW6cF6sWfk34vPddhrRN/V7KuOXExkpjkiSYKgOTvwk4tkWnwBVPtKpPz9k8rKBF0Xz2kMl pd+HrOU4jUxt9lnLPrMPJMt9JB9sb7pZlNPgnFqtz0tDNZNmL62662/yoXpiuKNhpeJR7FvZ6vJs A8zzd32L5R0t02Lojy8IwJ2PIUC1DU/L0C59OTiNoMgRjzdJLDd48t+rp66UVMTXYMQ9xqpnxP44 LF/2WZ4sTRVobSMeaqug5jX9r7vrQtzuLXoKq6OXov9D6K7cNNdlQrW1N1/Mzc6mZRiXiKd93ByL goYpQK7PwqE7Zias2m1KnLgPQXbRCmouGUnCvsRnUSgz4iGLcOTf2f+BHTahneu8cmshSss+keWQ yvrQxL08vM3lF3vNByuxdXa209Tq4aQgeTNaFND3hCPR/qBxCapvQKjPHTrJOg4Ed8oHspB8+bnp Uauy8luIW1meaayM/hcEHgirrqS37pOhPjE1MnzyoOLCfa7fJREfZYKrBtVajXgKFjQyvLhZWElq u853WmdycfrlLgzkL3T9UB1FwYM5hg/KJzWbdkcq3Btrxh8cf2THZhQbZmhiL5Xs/dyOTAAZp4Ke omY38uBLSTs7Ji7UiErad41pah/3uAqEy8ojFJqsJBqodYRITkz1h7Ef0KPm8Fg7ZxQtceLNvm1F rVLWqqfjfUSKXvvYeWOrkWYDNUKrnBuACm6k4uT9Isj/VStsctnd2TVlcXSzZLt/rejrqfJ41WuT HM7aSm6iIoX1PRThBx+NYztulZbCE7sjBcvGhF2zWherzl7aGD0/24S+9jtaxlFwWTykHJNHZdlU R4jiDKrwrvy8L97Cri68yQkb1enjEanSnTpN3R9WW9QcqOWJNGJKjpF6avZyxauV2fIXZEytUi/R vMqENZkHOrHGmp823DWXCB0XqPj6pDUCmeZvXRIGQZ23Sh4ns6bPFgEbM2J0nnXJTqp/Vffdipxc QmcCJzmpMznWEaLsIEB/mkX8C9ILs1WO19AI+sO6YiVbz/BHeVS6ebaDWzKHNU7HJ4U95r/UJsDC vos2RitJUNnI3nyzr8piINtsZcW0IAY98J3rgUecOzfDFRh5gtm868ZMhAVrunDndARJ0Ozv7POs VfgAuvx0HJwrvZ8NmMOXytij3hGMuhXhHT4im0d3sla6jH65vGrpJHnLEAdRibvXDfD5KqYlbrRR r5H1X5kcSx+QPrJaT/IygtSoQic3HMTn/YFdkxsLsdhBzY49WKQZdwd+OGlvdCC7o8LSI9OZKUS5 MaONNGXmn5VMMox4wAX1pYXBDyH1RFbtrP8qnUEtS0VjHuMWVhxGouSNtrUpgpd37hzy2Dje8J+0 G/UvfySxkTCjhgNFE6HVHRKbz1VLtJKN++UVY3JGVT2EOSQxFMh+jTVuzZjCIohC3dkdqaFzNi4E lzdaAyIsrcO/fhnyluhHeQhRCLPsResSR2Qwvfi+Rb0uP82KlBwL692HNq94w9IYtTPtedkx4357 5YKVPr4szQPg9RnYvFPkTSUjcTUJQZlVOvDIpgZnLRueJVLFuZZH/iU3fvPnwNrnDPWowZ+/FycN ufKJtp1MHqMm1zGvhvTeSWIBYGoesZUEDkU+1LueO2WG7KlrSlAT+LYfc/5nBzWH3oFrWTsXgpNW /Cfpr9+mgDNEY+P8WFbhVy/L3DUM0XVrW/0egUq0PbnZMwL/K5D6wE7sq5dmcoVLt3FixwImTzED d0Hco1waNvsT+ketTwPtYgzVO4JQRQY3wL4QnH3Ak0ol0oujeJC5KJOnhuFAmlzHK8XZbkwVS6Nc T+GahTg29j/fWnFX9mj1CJDAAqTYaDCX2k08375deyOUygiNk9jiVFhDN9IzUvhfrhC9MGaBvqvC ajvUVvxCUzB99sXYVJmOgjQ0CTabBfuTrRxPpMGq/jWmJhCFHvwTYn/UU7xuza+rPqp/iObSjOF9 7npe1exN8mM0Hvq5Pv5ghY6FqaD7UyCq7NULaVS0+XDrHMCXnuDN/9SkyCfFQmiOMDrG3WS4uUaU 4a/mEzxABW7+wMPUgFzwO7GRzexmi3MdmB2VBotnrSgl1QGESLl2YcFyR/KzAbk8GzlJjuHDrAMy I7H0aJMxGE99vUyZuRZpYsk25g27w+G4lF6y3M6S0mWEqB+1RszBUZccgzR+15NUVIKNmtiHxGl/ V5vm9ZbEOZJYAcyKzqEBxN7NqXzGfqBGAfqbObXqzsWnGuHQtcdpYK2KBtMsxo9aJQsuwfkViKiX q2QG5GRh7g/do+Cj4FZhLEDAiKUVa8npEXlkNvuPsrOY5NgtsT9WniKE4qSJ0IbYB+VIyPBhTG5m ePPnZpm2kOgw7hsAQ0ylLpGXbxLjaxitJ1rEk9SsEvWkkK7jyP/vfnZfRokZnBfQWGyOctWlAH9Y LINHGSEc7L+6gl3dctsfA6YdVKmSemDIJGoo+IqmaxFcAT6RIBGU4npOuK7wS8zBgMhoamYZdCqQ z8naJhepZ/QwPHujmw/6kD+Z1ywD1Gk4S5y2TLHg1xbHEcxkhHbOgk5B/TCuZK1VeDhlgOdWWbTs qcTfM5VRgcGhPN+MOU2dPnV37vmgpwgt7rgKm17nh8GF4GOC9LnoqyHDebxbCW6uVW/WJwBFwHTg v5oxOsl9JcCX4mQN3Brbhx7Pp0N8RMdXAGziNbskpFMN5sE6f8F5ma01ZX+dWtgZnaPRD8wClz2A yf1fYcUuoWQJMXLBnfEmU6H0wrm5GBJ5d2btpu4m0Nq3FGN5+zZWTl/pj0hWmW4m0N5KnEgq4/IK 1IhTQnTcOZQpkeqYSVxk2R0IyFc4NFsYECll/6e2c/LVhS/0VzLEe6fYwVjXDkB18pTioTvv0uyi 2A8jokbMfgyo+VDKjXr+JwiwMat20qqw43LBjy5vYNnn0V+OK87xaNeagXFLXcMGXPCHWX6Rq6i5 vTgRaqxLC2GWLw0S9QesO0XGCaBD0e/hpdsfcZQcCqofpliCqYfCW9Xe/fzyJeyvtOBwFqOb1crV gKRMkm3pAahqr/fWC72RIIXdkPiB2K1A9gk1gte08l/kdPG/fQWo6gFSfsxL+nGcxum01QjSFml6 nwNQ9fOMhCvMEyoD/4IqCi63qSTC2RwRbVby6TOzuZMykqqpIpzbTL41hCTyb2Xo+Mf3atz8vE3O ITm72KnIp9wr0COwwJA5eYl4Dk87Pje5fMKLgZp4yqo/EM3O7gZL1jO9Zv95u0VrGVfysuxwcqv5 6S/8n8AsvaugW4U5h5ZaX7vOhCLtkz1xpIUxQcvhV1FQcsHSkhLJBXuWTXPWS+nHNlpft/0rJk3N 5M0zC0niLpBqmFqkW3D+AH4FkhBhEzt2EX9lKQRkn5OSt+S47JhvWHxZQD5BheT1PRukCI3DAnbw iaC5ZhXNq9cmlUVBJ8Q0SPcCu7umGkCxeakkhk/rCR9GrIMv6Q7P6mqkjaJAxoYIpZzsrBLtDWEc gGqQzD/Kf/KAL9vvXC/vligD1u+vfDqIIW72Q6/Yx0x8dM2XRjc1WXeh7JcW72RhlJ0mBpMgOi8H T9xDjnCUvlp5P/Z5ZOszPxbgu8GqJ6tKYmCCzmdmNiDDiV9rbVf1e0Bkdt9c6UMvqUJauL7LUgXg U6q3wqi5NVo4nmzKfbb5B+otoUNUbqYAxNYUiUE1MvBPYYet7K9f7iVOlhRkqwaylKiw9wKzOM+U GSEJOe4kDrfCce/W4h56yroroiKG5/5jmR4QCXb8phmWTemdMxkz5mwd2+8weQ55OR/MbkfSh1H+ 8BV0CEu12gCNYLoJPQI0fioPIGX7DK0+j4Ju+/OQnlChGDXufvXVOX6qZ9dHnxJ+4xAQhdpRmzRi G11eMTj3MYTOlbRBYfqUDN0L579XNt+2QzdHMquphLpNqUBNKrrPU+2pERZmF/6vp4eB5P/O31Yr rvU8wHI0hOqk1YJ4avOf1MUTqYmhgr12lrlJ38QSeOt5Y33C0bi3f2BgjkV09NGV5H9Bfn8A9wdq 8ePjpju5unqT5PBmh4JKNCOccs2dJTWJ9xKqawqvOrriYajouT9rj4oCtWbvwP1GVj1T2WSHNy1S IqZNuYmXkjz5pY8HHj3eAXXWED6hWZHFQPJm6aG/9fCXTxmWK1p8Q036vBIvc7My/ci0JyVmuhZT 7SYgczVW3cuq1SkiXcG4SP2ku3Lek8jzjMlTOHDLKzDv51YXLDbvzHvVM5nRrSoUer3TtReI/JEj iitEdSFdrtjacjVQRkg6JteHn6/4DkdlK9SzsukD+ohljHbND8MfM2mTogBK+K5mZcsTARJ++RYi VtfqZZsH8O60yEWHpOiEMf7gsdPWDYGymo0Tfn6oB9yv+URZCG9GQVuLr+TMb2dZT/yWdrximeXd KLLGm3I8CmZoHCLp4lAfBYGD710DouztS2bdWu2ZYS+wFn7vrdY7n0yO4wDFkZgZq62rd82hsVRe /uKE6kH9C6/Ci9ycAofIM83KCZuIm6sL7zqCSoTnM/8yF015nbtPlSUvaTQXkKCjxvSBi9du7QuR 74p3zpSZvc+PBostkEFjfxLXvwpHfKPSz8rS0SJ6Uva1qJzENzgI9T1ot5BIClzFQgoh3S6ifKGt 87SKBaIbI1i/Vp9SSEoAQTXw4wL+NuXc7v15nbRof3ukzFYHEN6hCQNR9MswO7InQkktxJQaymNp D1BFJMR+m+X5llZ6DTJr6hZvNzx/OnbJXgPZ1tIpUhIOAx1kr6qF6WErsHadm4KCTcCBoSB67vYO 4RKopsrJ2ae14hNwBRQWDjqQTjUcM9fkhEgp/zF9sk1imRCB9OtX767FGiy9fr7KZbZz8v3g6DE1 J7ZjLjszP/8jFGqn3Z7nxgihuf70wPUyx5kyfHMTWgOwT0onTk5puacIe3YG3/Wylz9wNuDUl/v7 +OnsH4eedxwHgSml4PnQt0etFrkU/onQCUjgHGSXTHmbpvVZW1YiVAmGfkpAgqrmUFMSPk0dqc78 OIIBSPfPc5MW2DjT7qrtFs7cSITGl7woTcnjYHf4oy6OqqfBf/JYUWVlcqn2wCyenkjcdEFhWafa CsE6JLQ7MmKBjTvoTB8jXrLO4KDKOc7nuiB7Bw8Pe3aD86UsoZ3cIwM/D6FnmSA00NZHNz9o50TD njRTibi+3kzRdMzcnM3+KM94cJD11CsV81NdFa26+pINe3aWjY0EKSkpnND99jOFly9/+t11YDvm hHx+KKbcqU6ehU8IWgAgF2lUT+c8LVfIJODr4zE4YXvxi2bt/k0c85kkTFXkYT3XmXYuYzynYhf4 CIsuoTZZXm2fqNRs6DNBjmDpJC0SW5/rVpOX03IGRB9Z85PRUV8YNA0hhmQPQ33Pxx4Nw/4YDOzx qOqtuJOMH6R7IKpLaNQL0B1f910L2u7Hw9EoCa/s896NaqWJ7dU3mgunAJKzQYXTmV7svbCUeD4J dSJS0nGSGBTl0MISuhE9G0RZoHPET6/bAni2m0cyOwfDPy/JnB83wtVztE+P5iUmY97J6ffNEdq6 jBXOuQX0iKHvWORm83YnnMxvfulQtrw/ziyaVt8IJIDkNHjadqe8wOEIRY3VjxZOiIHijhk34CSX N10jopksNd3vMU8yDz41NPtI+GNnsbNnixAQrp2pIW359VA4AFQtZOA/1ViWk1Ec2JVf1rWXkJup hsw/0zv+PVVNSNHTyEF/HTYwdI2M8tErrJVFtH/zWGXS67G1nzsMc5UAyJc/af0FO8v1FH+qS+Tk ERxjyYGNqmZK717DmF75YQLYA7vCVM449YrUPU/ibnXC3M8RidBnTOk5QGx/Oies3JWe35lnhHd+ 2D+FyRwoybmn4Fp0oCBI9mOIfvD51vhzKR0J5TDxdfScuWNUHeaGcrMeD3ROQOCXXmmscjxmwWEj /XtnP5vxylLILl5VJ9XBI/DJa/fGrnjUJ+2jaISLZ70bG6MTE4lQ8/iZXIJuqxcrr3pgMSoAaMZ0 vOq5LO6Sn2zoeU0/EhIILqUlhCUQtdD6w+tRtuIkKPpAvU9b4PykOpHXTqoBAzftA4oS3ly/Yu/U y4leZWk2bL+3XSIXJK87jLslmtjSFF62kv277cW+M6XkOKQUuB4Pvfvv24iTsfauHU95n3Ptp60/ vzReA1f4dXXz7/ABupUXZ34L6ZAQFv8l06xs7qru0zP+wB3+Wx47geC0+72mdhAjvFsUlEtxWNMZ zOPBk+Z2CR4nLIBz5YzHTLWlCMxp7jGA/rkFX/33YerI/YeF14R57irOV55f/tTb+HMns9jNMSwl sItcgaqt+KX4SNxbVtRr0rcza25vPgXvWFGFI+pvaiCte2graAAReq/8a/Ox2bGuujyL4FOt0mnT sLbjmmdpAdsGP1pXHJkhVrfMyNi2uruQ8dG+mtiAJ+6t/EmNggpLyHfeoTwN7n9/FrYu8Gd40VQB hgXsuh7svtO8/0k5Ctns1r271lOEMc3l/GPYgoMLQL8g+gCfHEYNtg1h12ooCFXcF7wPDPSA6vXD ZHwC0u0PD7mUrzwQN+MgulOCV9cepJe8cpG5ChdHXZdfuu/uc+/P54Jvp3MKu++vIX0L9yz3YQ60 PWsrYst3m1Yf6G+P9lbuR1T5r7YnZe9wgld8TwohZ/zBA7K307L/QHeQv6/uTyusbnEDb8msbndf TWIdLdTclYpYHsc8u999FXySvHJHsUxzc9DcfdtP7H+/5BZ80ZrTLLt2CNjyjLsYmuRguNO9/DVy t9EYfNqTcr+ZcMV/vx18a36j27lPeg+uAfgviW0EPPKi/zOtI3RxMbGZmT13c0wDTGYLM0loaOaH yOxrMUPUsxhZoEF3sG7EjlvQneB91THik1XExT366egzn9w7BDQY7eYmQV43+OTykxT/3S/opcSV Xff8WunRHRxyfyrGcNzMAC/uviXtOl2D8YuG8DMAbop1uy/FGLqvNBlO5nU9sK5+rxWGB0f0SwEA N9urDPeX+boy8ASrFjsYwdODS4V1otwQQi/wb8TNPQnkPqUQGnwHZwi8vRmH0QHOBhjor456EyBL End93wnvj1cuJiFX/XO6dEEn3+8nreCIhPuTHMgdpOMKj+E2MeE+k5ofMQC53o7UTdNbOSL4N79O c1KtfgHlJoa37bEdzauTKq2ALxZr66M52NGBpaQgCqGLFbjsh6B9OqtLQvSbZkTC0MX9R8Dtd7rt 7jnZoJPu7eCTQwQcInnZ3w3WvTHrdroRvsW6kgLc6p6/2v5XEYfme79rxQTohi/7nthNvESa8rCr DZ68IhriFoTnZrWEoJDBd+u+vcRoLnSbDFhf6FYIvWgfUpQiDL45n7xm6FqQ+I1IktINPMUCXM0z 3GEyvL8uTZi8/hd8uvgvTpVat09/nZzgQ1fQQf/hu/tFGABwKRJ80sPx94qw9vYYpjtwNn6smnC7 RnjLZH6/sQlZUJ/Q7Tjt794s7P47ff/lcju/+3rbOxj7ABp4cwOJOlwJPEjpnvnePc8QdP3qNgFw lFqDr13gS0/ttPJmoU9z6+rzyKfZT2kap5rLi17T1S848iUvdCfYjoeSulsvlgNy230uepfaCeml A6/OpksJu4Ku7sIvGKQvr3phkPvBnenS4McdQehdffU9OyvdXTRdkVhrxL5+62jxQZO+G2WluWGE Xviqukst79ECJUBbo3E0pQYw3RzJGQnB2uB7npyeO7jH7lBcLpkAU+wPHX3pGaoDrbfJP2LGx9/U 1ZfCb9bchVKIU+SAsLKXeunsyeqXv3yDbJ90RR9OMJvAxomv0GsiCfU3lHTYsFP1jIiXip8+1XTC eY2mRRRm9tf6Ru4ztjwRiQjt52yl9WVv9F8CvjmxLyyNhnOug4mPaG8CwhlURIKIqNUPXbJfh72q mi5yfBG/Cv1CLJwWXRPIPj+HlTCqNNo1VNuqk7XnTrsTbnfJR/Lej4XYN5CqfFXLyorqNZiQyvCd BStWIYIQcNkDC6+Js/5DhS8adRlwjt8aFXUQBmiFHbRPNAdQQ3vm2qOovwd0PdE9oM2vCThoc96u rslLkLn3Aa5QTxun2dOQ7cfb0T8B2V1fRbOBXSQU5D/coK+RNem9V38EbBHE1mOx+5TvW5SHw0US 8ZqOm7Dt0aQYI4l3wY4hOclMyvcInHLVWAMfZ0NcDSfJcgeVU21vkZ+3SUX2RUkFFPoGhbnts80J 6t4rAfeLUFgtdPk6e31gr7Kzyy34xc+J5yEaO73n4ld2LFIW4j1871uFCCnijuVCVMU5xpmljk/7 f4jXDAvpEhx5WWCJJeu8b3C4nSTTSyf89jWVsL6+gYsn0JT7y4aNiHqN3Oq3zaO1HjXrN/aORrIn TtSHTFSCwfXf3dF8MWXh10uXCVYCX2Dnh5ftBcxuxHCJm9qscCzCu++yRp3BG253/1buOu/X+uHf op25wpmaKHj4E2S8GHZ8xA3in30whAT/Xrk/9D0rdJio7LAwPsDPweyPhLbze6V7TQMO727+KlvJ fLpLJgmOWZn3DLhJ0T0/uN1IOY7f3Ny0nsA1QUu/sTO3ceZc3HOFP+pGDHxtnnN2Je0fD68iv9b7 MhOe3vwxePfF/pgskYIR52u9vH4+MieW5L7ZuiYZ1zU98UrNvVV6ad2abYVH1c37l8ekb4G62diN P60seYlGoxQkX5NNZGHcTOnLUYpWTTpIUufQ0OfS6JROT+afEuELuLpusmsrJpwSvUiwL0xhT//x 5oWuSvQLPffMMb67RMJyCl4LUxHTUZNWw3ds2iWsuOnNzOxZPK1vY5WYi01WD1xw5DCo3z9KY2iZ pEygqTeBn/JO/n28X/vmzD+QnmJ2M9804baA2Mj08+lPkzGAw9zepktTvURznTGkvkN6hhSjcUPL qlTya5dfuSnPycECcE277ssHzXXsw4IDtme/5mY2fwSMTS9n3pBuuNKlCHs8E4of8JuamjJYnhqd Sr57eyJwv3ss1lUhZlygPV1Swm94Bz/lgRMh5hdyu2tkNjxLLDu2A9aCjgu6u7vLud82L9g1xihZ wUohXYGh4nGDtj1cj1x9WA3E1U4HDeaqz2ao6YNxt56LeX3wobnRUQSW5k/jSCOF921OyAcObnyd 7hVZy7+nUqTj9JGwBZn19ec6sEvL+67leOsA1W9i2EpYe7L7Z/6PTGwbC+f+7GF0+j9y0BXfl590 OvP/0xfigP2xDa2HjrAQH+2yL/fbU1FrA7KJZQ2zQabnRc4EewWKkyJSZH7utCfDfpJ/k69t5LcX j2iTdDuiFHChPEo8FJEL8/PzIm1RXmGbphbuvk+j6BUV6+sV5Rrm39A/2XwyS/HsscsLt6zRgYrI FdI6Vu0wYIqjs7OncB3XRPzXLO0Q8WSRVJUhjWaN5iZm86KVjxM2jrQTceA4ZWbOR9D3giFf3IFn GVHk8qyrVXqFUCZ+er1ittupZP1wfoaISsFcI8Kw8xBOWrwBcI2NjPDLUvKYBqrHq+eKTGKx92x3 Z37UXq0vE4jSWqwt+HJKsS5ORlssu2/HyXM9E0L+bK+HEhd+4AFQhCalRzMVcnS3/qblNfE9Vfa4 grB1V1vb9HprHsN/CNNBhvYP/mZlZZWXZ1H7GMl+/E386ezsTALbJpwUe/CJiKSzM2ljTFeX0s+k 7YrAD89nXp5c1t6/7CYU8E4T1zQDsfVUdw+IxSbragAaEGZDt3JHvuo/WmrMZj5/JtqUOes9t/72 f9R3U3clDLBsbExsTGzbmFgTWxPbtu1kYk1sWzu27R3u2Ob5fsJ9uOusdfqt31pV1VVEvna71+su HRe/E48a0tOzwnXeOMA8JEZAs3wOjqdrRapF/42LI83Zh1SO5HMXdHojg8qSoMKzVAmubqcVZw7k zl1Bmw02bfUW2AqKiIjQ1Y1owFsJCwf9axqiS9Dm587EXolHUUAJ6myIKV1PPh4G+yPdCnsM61Ke T+G2S0aZjRnfoUMFPbEJg8Al0SovYu1sYzPZTMuys1G5dQhurSDz8wSugiAQplIOMpQl4hjsd3ac oxEXPiQmTLHZvqMtQ7yQpKAMX5XQi92/ZUAhdReiF8h6nTxbfco+1ibnVdxgZQy3Dg/aOM71/uzB rQPSeGmVPPDfxxbGTwXwy9xA0zjw3vv2ygLvfrg/U4IOwWdbgHqFpeilkrbfD3BS5HCoKPqIu7Fi wkpKJIo6vYmvqSkJ2FNMN/e9BGZ5RqCY/draIqWyPOLqinLS2ssKLSpI7NZNO3td+RfelPE1Vfg/ HStokAFlhH7CXX/Ry/lzf7HCrcvwYAwEaxm6yU2eWLpNWmprP7YHfERfy2qvp52xqRVsgO7fgx8p +92V6tqKVgmqhQ9Kmm/EfOBomXV90qF7OFg4o7U2OAR8BKA96nnBBbwjLYHakRmJMHq68OpztkEg inFtWAFx10CfKLsHWAmMWV/cu3WmlUrIWItCx1eaZoSRxaampYEl/ESypeGmJorDQu19PHQTGj6L PAIYJ9TMoBOZ/rp128pqtRybPI7BwBXCvBSwJkqZp+0NNTddjv4WWqvC/cBbW5HsAdcqzA+5PXzY PBnHxHw05S4Kyx8MN0jBMz/XaERWbaJ/XXIO/f5HpxhnQzc8ZgPmWlJ364BJ8SXi+WPqzS6UANJ7 eIEXEEPE786glM9PP2NflxbXOdYgQD4K1pO0sV7+Zu6COmfTX7T9nSGAqMZQAv553mYSG2M+rhvm r6goVIctwL55xe2AeYQxy9R/n2ntUC+w2O5/A1ysqAiBLYvvrKKLN2ezbyOAm+GYKTKiN+yyhuxm txfZUNY9l4bfqlNX12cvRrLhIluHD/upa8Hdf3lx4f7mN7BiBMI2VEoI2IINtwcvhbcAduOzMEO6 Q1fZGUMk80H6sDRaJCwjQDNiIp8jPy00QDroQs+COX6Nc9ng+bLXe/CDy+JG95LiH/24mPKzsVkT Hxv4JjOJkFlPJbS7YIQ9q060t0fxXIGPi5GV9HLH5imVJyar3oNoXGQpds1CMGGTBZ5TBVlg4PEh jMQr2jPY/lpsGmodlq8Qw2Pc1+ZKQURUmylldOQJ7O6Aly56qaph/GoPhf+Hh5AlwowcWKiQhrks c3vwe1+KIVGTYlqp1ZVBzEJusTRxQxIa95PL2Uwug1693wL8obzMorTiJmfj92yQCmzd48NYZPLm rwwwX10n2yKd/BQCbzvfSIc2tMZRZzNofeRLSb/4cc7G1Z1fBvZQaMh5zzo1k4u84gLiDrF/d7W8 OPw8EYMhez/H+RUQU2oHiDRnoeSQWLOn/Q/H3q9XObjE7NcuAxsJkOzKOYcIUeBO1RjS2IppCkzw MFULLnHpLgEc1pPDkMXiJxfFRooUfLeyYLvw0mbBhDe9fu/rl5uOMGlfN+9hpaJ7lF87jfNG2vUb GM3HkJmmB45jCMNofI6BYGE69vdjzGqq3BEDG84iZRhI4RKckLmpyPsVyrwYpj+WBUQYc3gRwrQh mHINjEnJNuiEiNTrHZucL6H8xMUbS8UFOIlyXSWKCI6R7y4kMf9BdYobZ35OzXOIIkUqZhW5uBCY f+kVeJngMjcNdwNSsrL+OSIrLBT4n6UZBpFHiSfowcg5IJR06Snlga0xId70dHTAI4uJIpORVFXH DkUBpxl5sQkI3pmIR9H70X9uFpnbTknXxicENffFBKRzMjHhV9D8pv/FtAD1N04qdr3BE5s+PwFu Y4QjKCsdqz95+rgwVd3C7PxOaEE156SpmuLFPF70N70vQVPiCvtABeCibb3Tlkhx0voB+Ye5RDNY vhcPETfLncKdIaDqPguhqkqOnf2NsAxkZYuqu0y4vQCgq0zXSH+oWkDXovE0qakmFcxlEPwYFr6H PQ8E/VTdC/jscje89B3k024/E7aOjiGwYQu0GtHPiVpHhi9gQ9OVE2Us+3PUcDczgxso34SxQhu8 pswUWDp2VXt95XssD9eqmkil2Bl2dJQ7dM/5El8Btb5RMcXMEF/615oG1WL8JIKIyBFh8358xUDa MjKilQvdg6AFXPSiMAAHAQvOr5HmN3ZPYohzVszdPWmqMoZs2wBGKFtG8SwVhZySPRwDP7fUMj2b cXLgfh0CPdGFs6j03KI4ARYr6ah7ipf9VdDkobPdXZ20Uiec5sD6f/eSmInLSZlCRs5QOgmoWz+M zmLWNGjVGyltbFSRYIQKIpPGxCQfOqRSRjoiRKMlKtSUBitqSS1HhioodxL5JVkgGrsrsb+LVjli S3GX6xR7g0ljfs8hDzFDAi/QqA39e+nWdjlOEH51gZFyWMLPhhC/ADtQKFHus6NAw5RPVVMqB82V ZDnu1EIxVwUqB4uq9AN4rLWTH4W+zsRm2uTmRS/Wk9S1i56IMAkt30z/MfewtHNjYWGuOE2YYkFd sfn8ftblgZ08bhUGCpZCTCld5PffvWretL23tzSXBmVljfzhLgkn6Hqd0kHiaa1bbzC3ZW10ZDg2 iiUfhokAn6txwwezhLNOjdQVzgNvZG8TDLUr61+XWVB8fBQ4pxCN6Su37BpSSrs0MRu3rCfH3ZJC Uyg6rI+GjcyFbS+dGcNpkM9PcELgC3A8/cVhubaSyownMEQD1WXMjyQbhn28IUsXzg/LEyMUDslT HYjIo/MPQKKNY+kv9CvXN6aPA8lzl8xsN1hF0iLF5j4qur5jyoUJJ4s7DbNViwrej88d4mySKmqM cpgCs0zC/yAG9xpPaCc6sq9tDE7ylw4t2Qk6DHYfNOnPDJw+Tv8qmC2J/cTuN7RMzZFHPr/4RaEJ /2xKTeuze9gfoe9U9G8ry8t+am2Xd066zxtNkMH+dCJ/EvD6yT3TWVtUs/J+JH66EtQGMBUkEPGX JDVb85bYs4VUTVk6ftEi3FVDs4iM3VP4pfVFYXs2a38a0mRUJ/ppRFE1W6i/QM0OMBq6fG4/FFmN xT3v8KTkG96cLB8eM3uMCF0Kq5jVNfJfgLkWbfqHeubNFrOxwmL7uLBThjGaWNTXEobq68pBuBej t8CLT/RiF1WfQBWPAyuGmiyifo23G/GJul+b2s6MR+YC1q5xGpT3HWhNPiAbO/H9Cx2avTHvitIV jX/niHVaE0dtRNU/RTLT0K0WPThpeQWkjv2U2PrVRai8e6YDOtaJAOmob8WdmdjzQOVMEsJW+F6B h7jEjk3DS1qhTh0b32Owd2RVI0uw2VItTLsYCma8P3K3k80QUokLewWb3Y8zXujXwtYaggN5Sg3b Ol5TpvM/Qkvy57TIvwx+FQ947ErcBIP/NVF5QdnSk5lJM9L7tabJ7ptIod9s6jIycV0vXbQApTJW iTAPWX2slUeUQjAu44k0ZJOq+6txA3k/qYF1eG0drnumeuizUec3SzCIiiChm+tVKlailS7gebXv nagz1umigEPl+0JBVSUtOdtzRh9JaoK7KFl3Tps0ApQyW5Ro+EHpXPLx9TIKms1XysLJwsYuxcla oN8t3qucY/Gc+UKrvFFczOWHplbyvgrXvALYafP2NjY6twHt+2WTprK2Gc83Xp+2Twaazd5inndo 6Phckr1NVv2kyt4NnOK6Kuvq+r4/K7/8aUxgmxv6Ubb4cmGAqRvgRky34OkzydgQGEObB/KBiYW0 H4d6ZRjZ3xIhq6vOZoT63rVq4jLSqZAZ0Cp+j/3Ku5aJvhfP6pAbyz5A1AXaaqb7C14fDbJx6B81 wXJi94Hx6Fngf6KjINGxV5BtCjk2tn4gkhEtICGgoir9ihAt+wFb+xOGGEwq6AxyNWQPtha+QS7w uQQeqLZBTRXOPK1gxH1r9MdkoHrfJluXzCr/psipo/ctwvD7jeS49836qoqXnWNkKHSSc0/l6RAc /BPsl//kI5j75CNUjLUPwJ2MZJTnvR+SqVpkska3rfftjF4P++nco35vfuLWI75v8Ohi/YAmj6cL xMNlxqPF6//xsu0Rny/otO+Jd8FgOwvfnLtNHqH1nCPo9HR122VmxujY5nATkPrdVsTT62zWfEQm lJt8ZR/Q5nn5ldqveefuAYIGQVs8hyHmMuDyFeLOgkpHmFIJmFJd0wlqnaWZDLt0/As/6JA6F9wf n49sjmymbWxsMo+PSbg5uLkNeza2bg7MWTGz6za2WuWP6WLuNes2skAElsPIwyFrHB8ZPasE9ju/ tn1dBkmpi0EE9sTW9vY8rifT4iHIISEOA7+/zQcLsxmI+Tg84dyue33uj7sCHoVRiN7yrwe+vq53 Pz2frxRnL5ol9ni/5UUXyYFeZds7yzzq/QAX9eX+Pq/vz+cqFRRYI32Ta+FrxxychpyG/LZNwlyU 9rhwnZNYw4+BG8QIwSbz9m2pEwIVPz/mt7zH7R3dzdVn5u8FULnbvnqXBzNdDs3VJfgbP/gbegDj lPY5T/7JaVXPZfclB7AeVt5QdxK2aPP7CUQkSvdDWNw/NjhxVmbvgIgo4bNIlMSgP6bfiFnglwPe XyM3t7q26raNc9pz5OB9Hx8/ouVl0QdCCSUa3IdKpqa7+f6Uposq88Mb7QQ9kpXz+3cSYf+tkNE6 2JKCupAmkIU9FLPBYYhm3eG8gUCtoOKM7X5hNfOtR+xBzf6lbPFCogp7EUy24FFgBLiH6BC20Iez z0Tth4WHwrFEOHiRDfNJzlqt2D5WV0xMTJdRiL7+cNz9/TnyeRyNW01dUW2D001Tf/9+7f5j7ewK AWjV+OQyz/DbFngwu9JV6qiYDmbWU+VJXLf/+lpb+zpS2599fo9sK5pLsHzeTrgn/oHEdWMeos8Z EuLuIe50K5gTOSy4yxng4N/b0JDUZiYCMIekq9s4tuMo8KjpzrmxlazzIkj69KGZX0KcUAHDW6NM ZA/0ZEjZe9sfRiRcO14lmcA6trN/Rox/43rvZlTPaxD09ZxtHXntyPjsvsz7/Hi9PzrCYdLTmuwO xE78LsNh/gO2OXj/oTS0lmDDdWDVSRfBPOf9eOZ76327KYEw+/3SJgEt4WHAiby90ecDa/ccv23o /3oUz9w3tHe1XWk/Gp/Lsm64yteAXMO/jGdrLMO3vXtr0erT1ewCu7ns5m5jcbHSubtbwTmZprz2 WUQis/c288l/JOQcjXsduT277LPe8f32lf/tK7ySj4N9xczA0G3g+fbmhulY2fkz9jGs7BkHpTxt ukxYcvkr9/25iPi8CzLEIU+o59x173RgQL8LYVdQkMWzydjP74aqK7cUy5/rNw8LS/35A2Bp6U03 JCTkPA6gfvtm4cBZW9e3/LgpSWb3uTNIfh8H2Ha4Xubg6kzArNs9kAq4zrvc+ei5f4olIp4Q3xR8 EEu77N7zffXynYpDzeR2xKpr4QwxViiv1ztCnDsARK5uv65ZJSqj9cIM5j9S4hh79j5dpQHL+74u 2+TOPikf81fu9whGF3n58JHemFYOMssuq0ZDtK/JmQOhvHsK69sESY6nLcbgYjR9MbzJjBUGwzIq B8D9zUqApv0yMhYyJimzwtE1C5AIat3EPorKWCdqlnlJ/4Kbp+rOFPMYpKWK5qmoSMtxkzmm9qOh X6m9DMAhZdH19h/XeCdGIDrg3TtpSsaCh7Jx3XQy8vw5BIn0AyeJzZoxcfL9XEFJlLyMH76NJ4op V0TCpEjvaH9JjPvDJSkuV4wYSXeE3oQv5JA7DL9+DNTZUfe7+X274bK05v/YDPCjrrra7fMP+GYi vXg7XQTD74fe7EvRV4LUAMwB5oMqRDET3N2QXbE0CQWjwRF92XjWHDGmoA2cUgRtr7L+eDBA0lXS uO/68PSh4PaPaXHh6UXHmIikkptdezw8+hnVb848k/A6F48YX38DjMv+45GIu9m3S+EqTkeNVFbX +A7cXEISHkKf5xX/m37YSj1EC8C10pgr7SjpWXUPZf6F2wqzh6uro/xzS7NRILOyEFN1SehiYb8B EtcyLmlBn2ywGVlT929Ixhyr4Lj4CdL927GgOv8lXeSE4Eyq8qecdp+Bgw6f9FooP/hUxRwepxX8 4NGtTufVoq5skqexCz9/fy2vCZHDaOwIBpp2nzYwWfnj4IzYf6rw9IB0I/r8K0n6qiAmYGiSbBh5 O9r8+nihtuJ2NsNNWlG1vU7GL4LfYX6qS7b/eUFERPPwn9RHIogtuqVljOOXHX4YkOdT6g3StVjc i9XrjQwsnrxR5/IxhU746jQNJPe1h95/rfT2WWZFcRg+/JRtU8ZPpRJQdJn6vK/l/UX9vYvcam6+ PnOfn3d3nfIlB0KTrgBGZR5YyS0Iz9feNkarS2Ao7pcQSpdZZxCafgKcnCw3rDR21giIGx79/ry/ g9DOTxfLsK5G2ngasbidadxMtNwsKq3prLeG464ipIYucjIrOmCY2VWPahv6AGthSZmOjWW4C+4i bc+P66pRanSiqayModqKuf7Ci+JMrgFMjUSAimt5ypM/T0axSm5/XQk6mYNXO/0ev0b3A+PfhOrq nlc9VsVpXyqr/L6UhM0y6jFUAnz1eCuIiIy4v01Ilv0ny4G1bVkYPGYrbMFOCfJnqWnam9WXlzmh 47PPoWD0daBaal+cymWMlcL4SETagCYRHIR8Cj1pDr7xdvLIf4Ns63DWVtH2xVi081mWVvopXpDh B8gQzJ0/2eMBcNEEpYZO1wPUsje26ll62aU/m6wWBwxdumwb1AywDyIS9Cv+Ooxqu6UZaNNZOcS2 OjpLKmxoJZeg+ykTMEopaZROyYTr6znvQ0im4eOsNh56Gk2ZDY1DdZ8BDvkyC+GhltR8PkqcfI4l SBJ5Lz1J87Jr5x1AIsOGSosO1GSn6X810jUgR5IWtpZihWZxcfHw5meQY3EPyG8P90xPHXboJ5hp FvTPeKILHw7aOmFgOuPzmLr7zoUK4uZxumV4UOX93O8PsgsGwvu5PRR6ODkd/7sbi74cPh71bhhG t+aq/ZNsMvBh/OifHxJ0QTiTw9yBBsFfVRW8ZA22kflT6nzZJDxv1jZdXcyuHsJdn0jEZpdNOuK7 1IItgrl0PPr/xMhmeg4OZokTBvsOQ73hYdXm9PzcHiUMJ4cJuIO5wbp3jH6Qn7Y7YFZ6bV0TfIc5 NFdTamlouB6EL2/szPczmUmIuj7v3PxJTFP+qxo3t7xiZpNdht+ZrQxwzDj1KWxaXh4I1lBqVzim d/u5AjoePC1sVZTn4GQtMbFkm2ZNrcjPQfQVes85AIZneQRx2o39JXyqtBr8sxPJZZfBQEDAVnaH UKALZmT2Fob0IAv5b4CiDcySkraGI1js1CxsRJrCkRePBaZxRMSKopETO0Euw6GBox4XjgE/szok 4U23B+pObQKdtbGz0hD9x1BQs6fG5KSJfW4WHxIc34H8dArDD0ZW8ZgjKwwyr7rFuIcRNMZSLrJc CnHa9NkkRFrm03TcCF0dnaykyK2psbEFuie58pU6pobo65jFU4gdgSixKhQBi2NMDUwpntXG5s5O tQhJsZx0AyLt/SnZnYWzSas79tD5KCdu4LG7poDfhhZkvF/nf7irKCteja4twgq0JD/8+hDgR3ZX X+LQiLxe0FJWVjVre+7a/nz6okN6mnvlaiPynQztXvMa5GwbtNKK4c2VZ4Te3mBdeuZlQ79yYXG/ rH++NCveuL4OcrGUjh0E2rb4BsvuptEzaj4BtOvsK1q9NwamkFrYEkxQqTU2KI4GBn+48uQr89FH KVcKaJwTV4EAsv2yQaHXc5uL4IDWMNccFFusxQrAY1DrDuRWdBgKYeKLTBZ64jLdpeLAujGHQacr EDC0VbIiV6/RqiR/osPM2jxgOU7YlEFFpcVqmueYSR1uv80mvL5xePHfq820OgKR0aJyDKGQ0qaH JJPN22+3EfuLzmoLoi5pQiWlQi0mdrz7KUN5kqiGQV1ZoHS+YUELn5XJWdZB/ngNtx3aYfxQmith 0S1ACC0pnbNSG1GywDCidDnHXWN6YFhuuboty1pD9FLdz95/I2PSJUVNbZ8rPZIiIvpPXAfdTPxo 5kgbApW+Ph801B9Yz31PLHqjiWql1CiVTzr2+NiqW7QZVIhm9rNQtB3MF0OxUYFxNErWA9x0z1c2 oWCQuwz+wVv7sPNLz7dKs3PIjgMyqa6y001NCGwhbh7EfCIyxU6R/v0VfjaRZ2k20nNzKcKfQsmj 3Y4ONfWOhI8pY+rId6LPOVh797Z1E3V1Nvarem4LFRh+Qt+TyFDylH+W0sVw56lFXODIG/c84KWK FN721G/oOSymH7PCtWKLX+i7zg4+SRPYLdHXEHpydLBcgKp0LwL0tGOhqWLLNCLkP3YHWy/EMrMp nb+z/xYEYfMI53HVuaabCj5FpByWlFqq4imwGQ+uSz2gIFKzc3hWtKjXK5rKNTvae8YHwvxlZi3H 5ewKtNd/e60+dMzIBBrnFfOwiHLIi0XKWidrU7qxmB3cmZUyZtIxq5pmsb44qEtSyJBA+lMa3K6e zIDruVs7eyP5tWXIV/Jooeffm8K8upGVBbJyJ4NKDaEy5ZHZjp03W9mL788w89I14sSqdUo5qLOW L+B4nWg9ktSXqp0XFAXJAcDkPIwlujgKUnyKgjtRMNMSBTXi3IYHx8AOF8k0noE6rCEpCkhUEOQ+ s9x6lNIvUm261cIP+PKAZGlCGTY05aE6qO7ntsu8ta7hq/7a/f3aIqV8Yqi8fMWknCAQbaURUHuB h9TPBuilDv566Axc39bSA++8uq5r/EbCxSKp2p1JJnL8L60IhoIpsPsx9iQ/QlzEpLi+vNTer3xu KiT9728KY0uLnx/r6OVmTojTv+A92++XNDaS7dq3+KMnd6pkNp+lzm75BPoTu9ENggfvO6z6qMsP X8VuT8qiB9SAl1Vh6Ylm2feyQvOEtIxZi5GK9EzvHbNrNvZcT+OZtcTTb6zS6TXgLU9UVfLbbYHn 0CxCmDoTJ5zg0ImHzjt2tOcT33hEPAqy1CsjJmVMxJSyvmtyXsI4Gz/vq+XTTK720Z28kI5WRi4H 7SgtbV7SXVLyuGy0Zox5VgZj2rrYmcYMiWRgJCtjFQ0ZiYXi7l+YVlWmOCdGddw3ttpZs8W47hnt nVKTIL7xRNoCr9EM0f71Xz9I1tCbaaidmtNFhRMgAmkf2dlVIFzOpKQLnOHepooYflsw4T/u4uPc ouDEubmRnOLgFEZiw99L4FMk55HJmP+apzKUD7ow1BuiIu2BKq9LBucsmUj54vvd6fl6Y3aEXO7y KjGQTt7ndR2HiBxWRhAdBdrPii7r+7RbTY2Mo11blPQw0YQuz7Q2ydMN7gjeks+f2dYS/Qcjk1LZ P8PK8BmLmThv4v7ckjrxroT7hzWEfCWddIUIqkr82BxzYnxWcEaHuv3VPWGKCh9p6+FldBQvis0V YtyCT+jCKOu712+SaLJnsoeop+f9TPijXqideY0YKiPTOf3aziEiHmbsfrOn56SN8JB8DnHsiQmy taf42XccDes2Nl7jRujoAa+OYhV80Xj2rnGZLohOgXbSQ0ctybAsOSN5osKeUgfcxDwWYujHIh8Y L99kSGFYWFhpmNXXsOsreendOfVfqf0OJSUbkZKEWqzMizHpQAm284z3pKXetGR5GLDTwOO/8KgV YUdoaL28o/Iq99DLm4ErILZtqKkqthWTJcNpXbMg8efK1FBuCdw5UkspSZEZOcLVeUM3/WkixJHv IUjwm3zM8hbVdQkuOZ18de0lvxbE2OpoBLz5q4RHSju3x/NL6zW5GixKzApmg2MdA5hy/qVbOeJ5 lL6PaZ93FP0+/1RWz3J4H2Rwb9eCUphfCq96KeCMm5f3yTTWHqNI7roj+iYRPGNL0v95iXM53ret it5UBdHV3104W7pVFGHkhTfl6JzeI6MVlN7NF+SG8AKCFv8iKooPNGtFeCH7GAWFFEPfm7f4DZ83 H3vbhKEvogOXPz7+Bae8GvsPy6ajUj1eIaLHGpdwCyz1yDvYL0ssQp9CSMpSWmHGbwVBOl6I5ejm mr2xqXJTaKq1ETWrjLv93K5n8m0Euzl0pXcN4Z0YH6S5P6YqJHAdOmPAL5Kfw+gxytMD7mpn+UNd /DNLLmRYuBoYoJ/k8OX/wlrUxPcM2pEKtK0w05k8/G14pmoIJz+hCTGf1azHVCPfK9+LdAhz7Hkq 9xjXJXI6SYGnxSZ8xB/wIXAQlO7M+oCnPUzNL8ag8qN6AoZfeXwN0RVOO4whbHqZEBgI20+KyeSV rvO8VJFJCB+TKzbc4QL6cr0iRJnJVcHaojE5kq/luC8rcXGe6HDR6/3+8rmqzzOJcFEx+qyo6/t6 21qt/iRmXnv+cwZFXAEdzt77fb3r0n/MrLDsm99nMoqiuRPwBZr5tvntNRp/3Hn8/fRt+fbd+o08 1X9U9gMM7UeQIjgYGAoSmGfORQ+inu7j57fhCG/12E+kZK4ont/lpkuy6ZjSEM6nxlMbXJQMGGRL bBNop5ToxVsqkDOtFf+BV091c8PdZtj9wT7JmvnfiXV6dHq8Yo3Geu92707vWe/5x4LDucfVs3eA Ynm63e6uf9/o97fWV8K3VxJoHKTnjA589Mp/BiUfPlSN9207nZwF5D5wYilF5z68Gu5TD/tZ6ZJF Zmq9rhTL7EZWB3yl932Y/WGH9RRJeKfKQNq38mFoDeG5UWDBGwrpo3krO5sl5dL4IvEn1v7WpQAG 0PwSKICQaYSmogzBLIDBZ4GWh9YpgPR25JSGXg10COFIRKmFXg1CSoQvDToXxWYJvA60ZSHaAjMP JBBFyYDvRYwFQJkH6SXC3gXhaQViYQaKOWLQ/NnJ46iASg1eF4EyA/oUEPqSbCEdB+oC9FhQp2C5 6sHUwPjLoYTBUG7EHenLIZYB8PaQnAXYDFBtIRIFKB9wSyHDBeDSQJQ5uCsoBSN4LYS/QUcA6CuI aQCyDmC7AKsazK6AyDVQcQ5awIiyHdZTlPsE/LlxdSc2H+vFMPWgm96RyXtIuLai/BLD4J/nb2tk yoSjvqzuQs8FxwCrJ1hDoZWv9xI85Ptwkz9WlOjSf27S9Wb8z7/59TlPCVgNn+6F33imi6NAzIPX 1wO7jRDfESXfo7P5waAyw7D9HeG3D1df3WK9cJA+GCi1qeTg+/iV+jP/60sz6Fb4rvrD6/CbS/kb 6/NbjvXO7IO+sgUK9fv8+rUFlm9HEMv/GRQg6/OYQO2/1QHMbSvznWoT8Nc9eamzCFdg9vVWmOnz e5NBysHwSbv4rFv1iz5tpUT24G7j4q5tX9lZ6v73uuFsNR593FWXm3a/bXMph6/RvO0H25WzRmjb 1p2ub1lrO57Jeap6LjKZbghEJfmwfOJnP6vbBfacOuB9bR4n5H+4N/RaXeq+1+CI618HPGRextFu 2l93UV33AKgjamnd7Cf0+Oubijy9Kp+L4k12+V1X2lrLTS3m2ZXSej09RCcFlVo/jrrE92DRj+P8 fXqqHmuS24ivvb/TctPj+3gPHhkDvIWFD2behd/WbZQMAzZj80eX89+3f9qdSfHO9t3oaQ7GkOhr nvgdL+Z4KXVdfR1VHVkYsl0Q7X7YjXZdfsV3auZ1fLW6CVvnPbpcza2NxvD9Eb5b/RotaQA5fCic oQq9XM0nCFv6XZ0JhyoKu4EmSb4tpIYbXGxKhV6soq5Xv70f90qfda7ar6ec1U+2F4V9XrYu7T4I lK50W4FE500liDsfqu7ns7CGrKuHnMMv6MQ7vTd3rf8NFiO7UfhreDO/x7WN121o7aW+8+CputYL 9Wmr/jIrbcVlxYZYCEMr0eXjKS5Ar8vzOA/S4+gTN6DuHUBXj18NLlSPvYX6AQS/IdWChSCF+4J+ CI4AKAG8f0AQAAaNyNeguEKkANj1WLaQwtDCkJv9KDc0J5AJQblGOC+8J7Bd/cT1OBeQ7/3gjj8E UFCCwG+gcKEi+lOAtI5QhNCjAKcbDlyI2UCLfhZPFAFUf3DFQByAzI3cD5gyQIwRVDeUAUxdoGa/ 1Q09C8JMoGHIKuAciOyI3Q2/AwECbAKJWGD8If0RaW6FUP1h/VG/kLsRdyCvITsD/eG+iHyhhGDy A4UDv8ECoHAA+YAyoHA/TzvcF6IeRHq/BbCvP78fFLhMoObf6ekHOQSBckOK4oshD3MLpEsEg0qE UyOF90Wk+P9HHRDDBf/LxBFMEvJ/Z4dfWDmwfZB9sN8wO9DXQc/9sEDxm2sg+Q0rQMJjgQQQECgc jAhUAqre5BsR6kF9QzMFTQLZb3aBs0AXERz/zrvRQIdALQA48VCQQ/A4KbEeNHogGHoQAkWQQ5Bp IsSSCGRpYIUIoqsIai1MBRD/xi4RZqG/BciXCM7Wz+EoOAYBc0OUiFwaQgBAciQfA2fv9whCywAw JCLeiQixQCLWB0P8hrOHkCjATQ1UYSGILEDyRU0NuQ7J7id0RMxAPA56BcBgByIYwaYBYQHg/nD2 0OoF+Dz9dgUwS8FhQPd6uKUgkiDvelwOMPgtcPz+3AJ4BnC5frZ6wnaAfgFeuyhiO0FzMFYBcnMI yhx8ZyBsNdQzGPMJjCDQ4MbEkUQLWiOEEwC7EvweRCIARgx1LgIG1d8XaHDz4wVeC1XMCNIT1xYq G2B+A7cG0RpsBywDWhjxr4ETQ/sBWesxLiCEYT+NuNcgn4L9jIR5wFCCR/t/soDlgYUAWTzRBaDj A4uAuDwoeTDiQLwbBlyY2SBQPzMA/gaCB94ffgCI6YkWG5gOmARi3dDxIPtDS/bj3djc4HsSdYPP BHP36wIJPQm6IUcADgCH/r7ge6AH8Bm4C+gCCt4IvYD5/r/ikPNt7kfZyAv3V9IXCSF54K//lBuo S4pXDMY5F0hrRDcHQTQXUiVK1w7jS1Ac5OrI2I5iGijPgqyH2hgI7gtrGnIKhGGB3IJzBsjf6BtB UbEgHgYLJKJOASCqC8Awg7NF0GhgKAswp2DIaCB3IY+A70BzFtgtiONgLyOh+iDoAog1UcoXcMdA kmBdUaxyGEVHgnLwFqOf7UQMEG5AqQJiBhhkEQiPQElHaksIOYBKPRIDLJMjjiWM/RzEFUyNEbQl 5GUBpGswExCcvl8QgNgpitqe/vXsyDps1m5I+Sxd03cffl/mXlObe3vDtsjOr6N09dR9P1BkU/mY 4I6JBOWg27bmePVqN3t9sbGi4/hRxth11WV27FEr/Hazb0iCKvjcZFYUQXJh2HeIk8AUYGY0Ta8k 8DKFkm7YePWozjXz9dQFyrsw9Bj1DzADKs7fh1xAoq4QImx1nvfePb2uknyNXxYpVTtllV3drsfb t/u9PtfxuwjczC1k5281m/btup8ueuT7LAk+sK9ie+w0THsItOxJ1aHaCT2NJeP47zx9zGDN2uo2 Wkwzmq2OkviftHJHiDFfWPn8GUz2kCT2cfpOQBV4GRTu8Xkaj7guZ/iYaWVqmPWZTIh+6LrObgL1 Xtvp8l4f9pJc66jzPowROQi9j01GcIfq9HpYO6zCOuQIAJsEb+f+a9+Wt3V62cDOz/qeCBJ1u7ep y3dTMD6/VsfxhfqR3iFP4O1QXMlOy5XlZvAm76pXnXO0jdHrEqeQ2rvKfZec2Lv+br52QeqaNuAV UCnV0wTrr/K97399PnvF8+xqZDmZvBt3Jfz8MbinT2+wte1u6/I5nss4mNDaxwG069B+nxDdzXu/ 7PMz3iS3KzHp23D5OqL22FH17nZ4VOK357uLPA/rPfZQRI4n9DUi1fIaE/7mZr7ibwGNMpOcCPV6 GX/7tSIzcttZ5rqcBJH0egKeR+6zSzpG2gxPAgS0PB72Si+3266ua/ycAlarpCB0ibX8AR6TtbXJ Fm3bTjxaj0Ph/DveTpsNdnEJr0TbabRl7m5XlvR4gmc+H4Ujgr1nIUETyNMd4gnt/leGL5aar+sg D3v7riNNWM3L2+96X8mFueM3ai6GndPXnb1HDwGszsuhHbeuLlC1bqq77ulD+rNrLk/9f0W6GPC2 nqV96o+KLZehbpmwV+bvujm8zFVSQ6YxC3T++a58rcvnqfcpel8d7Gf0OLI9a+7pBuUtQu7kdVr5 PW/mbb4CgwlCm6SIt4jKN5rvfBLqWvpuJ6XyXq38POuuDXz2kwxGXRIY8OEYvZ0XBxqa6p521M8a QX23xdegZ2zhhq/WXZSI+M8HqRBUDbUZ+acdA+eXfhLiUzf/l+wD5useB3X9vRj+a32ud12LhKcr vzl/d9PRU3LdgYiPPuHPKeLvacYnm9n4i6+YLYInYavTrcXjnFdYlK201KXNzezUXAMeO3vjPf1J BMTdgICd9+s+4Zp6fn5aWsGeNm5+fn5OwS4GIcEW/i4WwaaK8i6WHoamQoae6oqfTbRdhRU/WxiE hITY2XstvQWwM2nUOU01llfMzYZXqahBojH8/E0Fw17Nf9PSsnPCctVjmu6cXfg9Lk4u9HJW17Ub eLhRzzvGx+/+1XYItL1GytSpZOYoxqvCE89U1tW23uQMW3McZShQxTc55yRRRAlcA2uwYZllgylu 2rUZNKqWVfT1VVRquHWKAyexEn+l0/B6Eidw63gpH0Ln4TjWU9yujXV5VUkletKCRemEaCB1NusI DB09WuujM8NQ0AbmkikeLVhz8NWsECxYdfN9a41dDxPX4SKEjYgVitC4aoP6qheX391okj78hVHu z89UXbXGZGX6xTQTelzripxle+x1J2Lf5B7T7zIvfk+U+PKn3akyLYOo1+4x0C/gn1I/Uj8+sMfy AqJykUabkQ4NO5fY5hbQcdpY7Y0CGR1xcNITRaog19jn2OqdyO2LgyK5FmqOVI4oN75eO90gCVbn /xx0vl/pttmT1/xyJeHaCvj+zN8NENa46lPaEUHUbnba/mW1DSK4tkDt+Pbv9Htat3CFvSqDvLKA 3vDfnWTu8/2ebH5k/xDJZx1HLeB8hdlDy/+8Ye80vnUb1xWi3+agdprOKT5CTElORijr+f64R9Ts +RbaLngGmc/q8zDyE7iH71plqmX0OOoYG+9NDViFra+7jH+FrbMjWswwTCky6+qEby7I4wp2sXD2 MAj6BITY3lW+NDa+TDWWVsqrYOnlrCfikewm5u1s5xpg57e8fOxX/6uuLK08iKkiFQjHPnToEFrK mO7N6sV3QbGymJ4ZyY3jjIvjPfLzOzombFq0XcjGB4ed5c6ajjPHAHFw7rfnmldzcmW5c3Fdba1b WtsuETzmLFuHfj9SVe8H0WGow6fMQnno1nj3zFtvdajWtSH8UPpH1y+X9A94W0809Y698zO6nm8W 9jf4byXbtbORUrCadqANgUDtvbUbTfjHofY2bqaO1C+G2myagYnmhExdyKT18evDF99clOMwHyss bKUkBzV7mUi5wD2zg8FmR75XoZ9M/6R/gv/7nJqDND3JAKf77YZrRImpfZmY28sUfgbV5Dd0DXkx FsUnwvSdo5ExKVw2/IuycABM1zaWEKOC6cKLnNqyEBltvO4U3coIeESfXSiX1EOj/y/aM+rqUDD9 jvloMtsqilPlqASkce2GP3mlMEElzNyNaOy1061+wxZ8fzieoqmQ3eW4J/bCIyhIEMTXxVLB7UOl zUfLT5A3k5fNgXxl0Olq/gZpulRaKnWQXqpKSzTve7owkGl2ioxsZlaxvt3ostiFtrhIsD9+eJsp oZ15emqmLsHioK6srKqqfXx7QKKmTmlhDMlgmLbaIZ6bnZOepmnQtHjKsbqUyPv4lsvvsVJg6wzB szDWn+Ttzu5MiBQFMVURAMoNCIh4wo1bXvbWXmNTV2rQe2pS3rVkuwxdV/AWzMWNwEdrefxGSeow 9s3YCmnS8UI4XpaMgTbDvgOvRcdu29xLpBm4R/dlyM7TJmj9a8vVqu5qJWHwEC52U8EEfIyHHtgL zC++VyF9Hui+aYIR+tsTR35+bpGYQK6xWsJisVqGWYaJk1J3OXzjzGq7JUkcphqTOa0NFZHvBMDi 38wsxNC5YHT3IWzisGeExyC2+POkVDARSMTaZLK//0ejehC8yeTPPlcry7W96fu+0UrQX55f17jm wKi5HieTqc44J0e92O6NhUbWcAEGYWdxsa1NeIIbBG6KqbxPra1w5NeXKLmx2V0RWZn1H23g71rq w0IqE612tARcRkmz8f8qdb068pbNCVG2M/MbjXWPuDrb93B2Sa/nlg2tvewfMdW/RYf02zn4fTaa veSAoPGUPfO7e33Esm03nI9YS7kGPDwZulgBdv6oATbECddsXvb3FVgjhQwXq+OFxik2WQWR9alM 5Nt6F/O34KvwlwdXhFEz9cxtZGc2scKun01wSbi3HQi08urL+weR86kpalhmZkdux+rluvTO98ku Hlx86qYKGNBaLz++yFfZUMkvE++RQzU629ieNTQHR5aXb0hjubGkJFu1KzOV0VwbgiPUsqmmastg AeVUi2p8f4nMOCEQ5rAJ44JLhvbCW/kIKbUaeFrtJdAIgq+AE2mibSZVPvTuN2OqwfbczPpwgEkm NK/owwUy+cF2prqVczfobh2qCU29rFun6Va7LDx2jiy8TQ4e6ZgcE19JJ9mecDMK9hsTZqr+QXk7 eAwPu6kEOx53gTD0lFDi9UJWVlZBeEEnQbTFCQ8nVltah8zpC2Lx2y3Fcbj7tm0htFWTP+Ym1PEb PIEp/WmsztCA+DgeLyQ5C5FDCsg1NhH/MqmRof63cjB4yIuhegp1PIZ16FB92EOOaEErWTOh5TQo dy+ZgvP4Hujzh4KgoNC/crSuP4ZPPt4w3Yk13I4MoxRTlKjjmiZXa1InloUSgKdnU4r/MvgvP59B 2LU6MMxNqZDwD81hHgriZGzc2WwofJa8EHdbVjJwm4ggxWwNHnZBPyv3p4WHEnbVJsSmrj2PDK7s av1WIf8Ad3ONj73G6mr5YpxMs7Ws9bnUdQXJmcAS2nhuhQgn2jYmOrGcq9BEJU2BsLgOfne1i4zK vM7Wgn9gBk3JJHsHuW8Vy5jOjJElYP+pKHZ0pSTCv2Z49/xK7r8PiJ8QlyKmNVwrJ+OTvsJs0LAY CxaIbOHJZyPoOmzasrKesBfSXjxK2eNN2BSHqbYmoJUaSkr6EN3xYd3xOUp6zbt6lgtbLRl3d/4t es0FmHT3EtGuBU6ecj+Hj2pJGxYkFHykMrEyRStzy7Eh/OsC0aL10nnrmbxlyxlsnFnSeedNrq0S Sw60gwkU8ycJ8N4RBFMHGxMCDJVoDK6HBwojrHNB0z+erbADsmJisxcZdZURRJBVC3YSsReC61Nr 5CAKWk2I1gsLS9J4Qbo/INwO7HqpxhYeydicjbEWavs/LjF+JluSf7WRbLsT/vAfHZ7DHDJAVLgh iQlMiv/YgT1BSGQxcjB2IqKN+QDrNB0iBTpsSe+R7H2h27D/3gj+NYiSvyh00Ty67tY5sUyn+PtW 1+ZKVq/V9jk5bPIvY7eNwv7peJnSLF+P+fThYhPV6IwOu9d6ZVGEOwlfs+9rzhG3kkGL6XKj+H8h 1VaX1UZ3ehMMjUgTu5sTGvprJacYusdFRdVHtSnFW5W9PqC/92JHbSlsYEC3KaVzcoH9ycz1OuSI nURCjamyalNN87n/FpWGLuA35u7D0v6/4ZZ6T2cNDbaseG1LTsXriw+gL+j6jq9p/6ApOSEVdJxF 4DKJiMAF0rAV8pzzrW8pAPNysbGxt7C3MTGxtzCwB/3d0nAL067RIBIoX+W3sT750TIRO6gAS2vM 5cQQxsVNFjN/HbqNiJBY4qjxVxqwaYOIEMugLgqoK9UZ1LXkx89JUsNv8D6SLca0VOnsThW+l2ZJ NIPqxoHA6V7zPMMMA6omXmLqbvyquWq8TFX0kW3OXTipz2c7muy02xQjiy8ZCkZHXfHcopJjSpw+ R+tQjVaWXh9xtkZmS7CzJDh+Ji3Fwkkgv69P+T5diKNncY72bYY/2PkraJUfue1MkGQq5dr0XO/K H+QukYxWrTyZ8tpCjV5VN2TrHhPTzsfUuEKm+bcd232Oj+0rdPrIOnCLHAUeHvH+3DHCFNo/lNeE Rkn0SSz7xG0vXjGohsBkTUinPjU8K52mUS0CPXM9FUgKXaaKCphVA3Gh6N05dHVvjMLnuE448dw+ nGpleC5Yocd5ikc1oWNYJBViYKxS/OPxGm8cr/prbHZ3aDaZaMCc022+fqVe9RsDvaEVgftCKo/N 651topsWYDGrH/y7V8DqauAIEaeRoju7hRLtbnZ7ItRzJ9egneRy4CpzPewUh5lMXypPAbynMHYh rRHG9PgUWR0ZWR1z8cDGhha8Lgx0YNO0z71MFPIs03HUgqw+Xg65VG5brlAbU7eZo6epm66b55FX C+5V0zE6MXk/cT7hMjnpgojgfB9PWBj/d2P388ojN7cakaquFCaN8trXXtTe2R76TCSoswDNrWS+ eKWqAluZ6Q9bxfKbdc+idpw8VEe8memQJVs8bg05+SW5ayawHU122OvMXtTZrkGFPhkDCnW2SS/7 TfXXITkZmx0alzDleBTXuGSyJ0EVnJYw5UKtqk7dpIQMQnQZh8/JTqBrtkrGLR7+oHYcYoMBSMJN BCuDVRlHy066wkJh4u3t9tZpZahaaTzdJrSW2AshGV8PKtGn1LI8RsJgaTLBeO0yKbx8Wygpv4kJ 5++oVFbh04e0JpIZ/B34a+oIdX1OIJmHWM6niljsFt+wmOLN5QXTnmxX2rC7z8AvDYrVSJ71fRYH fzG5aMGfzg2RMgUsRF4MOsOWJEuaK2UCbZ1qR8phdr5SO8UW0rtDl9ntxqKd1ioXxVWkZ9uDEGFR LX0L7Cm10VtKb7qwQyP77kYr4JFxMkMzsjlupH+5coX8wFbB1XIhbVYIASvaUTYF2g2uJ1mck3+Z Q650Wq15oz0Y9dptjdGT345ckr19Uhz7ARLk8DVLF0tLS4PSXsmNk53zuBl/Uz8XOnYKd9Klta4V GMkpKQtlooup/WhtukrLag2jEdQzMnsf5uVXPteWQu8g5RZJaP5lqWrEqOWdzXhXC2Rl8vp5zxcl CNGlx5QXZkVskcBimmGZUR44swm+VpxqHy3pmC1X/fv3ZxTlzNO0hbGDDK8llImhA6s6z6hJW1A9 LllGf05Heb6SqqW1UgHamkNhXdbeq6qioCCNCYvKlss9zhUvjpz8YsLYrKS2trbFu/hZUuo7Molk rzo1osGdXq68WkP0JP3wCk8UFw+NodoBxu1X54J6lE2MCFb8QYgl5Jz5Ese8hB/HP0ZMhCgy62Rc kQ1m65Zydp1c6dzkNdBwb6JijE/nU0FnmJjacLmclD3RHHQkn9NvKQ78FTvxaQNkfdvy9cmN3iWE laWEc7G168d9Af+OhliitVAVmgXwoZmy+wPMNL6OFDjuuBGSgcbeHWEujQpx350qdLW9Sa5VIMN6 mCODr0BUtcAp4vmAZ8PFF6CYfqW0p+GO/BAcIKPZEKIYsDxmmJFNyEjCE3X82iClh8X74Wprys3P jqDpd59d7UjqrsHgQ/z0g8pbckuQou/vmjasueDDHMPNbzL93+ioFLW8gd5JkRETSrhyabA67PRO mUiXBk38Sfp+v/0ifdIZ+/DwVvA70RXycjyZrWcLecXFJ1HnjdX6VyiI9cOLbfFqZao0kBm1e31f 5/Rk68LjmTL5OZpN9+61xJhzu1o8ruYLO2b71Hg87J9qZMTLf/eUa1UwP/Y2E7fQCnI+6p3J8SBk q6yO1s1qJVTyPG+9PYJWrgdn9wZvbyPYy8PAjdHy1WOqfrPVsoOaynPCvFM0I44lvO7MaRy8Vx5O W5aqMjV3tnL08tL1FE+1vJwtmGqlasxdro7vps1Lc+6ms6ePOsYmnCuKxkJL61JCtI4luDHoopRn dfo1TIqXGVgen58Hb4nj3Q6N+isEIKrgMXKzqmHzy/KIVyYH+e6hGSy5mRRdoxpknJn7fnU1kAPO EiOII8hPdYYnQSbpdBu09dSFk1m4yedY1hmIk4m7wsfPqgr/uuP1DyFM9lj1e3a/OfbZQRi2JkzT h2sPD2EumgpF8TGZ7KDPi35Ykpwo862FktOwUzm0wpWmH6u5vUKCnE1cTQycnL3lhQwuk39fGDNP tyMOErjT0jiHRrk5OPVt3wpOXx7+lZbufrXSpvzRVJ5/OF1LDNt/GNaOabJGm0q+n4MYqp16VI/J jo63IJqNHj3b/0e3pf7zbvmIk6SK9aAyX26Qvv1p8fsnL17M1kxW1r1XzbHeR8Ztn3XxL624bDza RpntSAGtbUsmy1BnGwSEKZ5GLCkyJa6GOc3ADK0CjespCdOLqXcjVn7hJTjYHOEAf6ed/eEYZTbQ Co/fnCi7baI8tnGRmGUfVdF4dCOetpyzgQK1AZ0BE7pP6BnM3c+pjKydxExl3WzlbInP05bD6QcY U2Xk/yzeetg2TldTU1fXs+HFlSSiN0kWfvWtqJ0thZmMi49PxDHST0M5HR6OX5dXHZMJ+3TNLFaW P89kmNXxCXO3+V1d16+KxBE191gRQYnh2FTK1Ji1eog4T2T9/BxL/BFPv0cxuVD3XMVdUIj4QhUm QXMpjIZa7b5e3k85xRR6Q44959NX+msxZ9weV3reGx1hYe1XjGsR6WvZsnw5Ti+OkiO9fpboypQK Ek672dsRk/iJ5OYWzDr1BQTvjudCvi+O2h7cTrf7EtXFTyi5JhYiRXTvf9y5N1RPeyqQ8bYrQDM9 qd64vdHMcob5bypvb4/n7Gxcdhuu7e9kzgpPHp2eDUjm/G15X5F4a2vbPUYkBlC6PZE970+PVMiU nFUQmE35/iVqJXdetj9fXl3N7Z7kZMLW2bOz/jL5OVLFxtqwZHL00FQhfFezccGI9YyOdzCoqM0J ezphE8p+2qibDpp2Xv255VcxsLAfjlckbPSUEoU2K27fV3GlicCaqumoMU057N4KFgAwdVs7Zzmd bbQscZujEdrDdlk2ruAYiukbL30DHW8om+tvlryOzQXN7T3mJKD1WENEo/iCtq/S/m2asVgiw4TQ l5dc1pK6Hsfuxb4jPUqL6BKhjK6kcUBJv2vWujog1w5tT7DTK9WYCqLhT687xUlWcXaXsSYq5uES C6EJeLF5spVzWrbQa+Ij0SM37vCbsAC3+oHAgj0kDktPVG6vXbyNb2J7rdGi2ZxCAjtAXn9/fwq1 0n7znCMsdvPK7s78jmhbi82m8oUOfwsRIqfG2+bmphTfxqq7W4uqbCN21kaYn01ZozqLm92qjumd tRs029+QB5ySPsYFvGLhGqxs2ueKKvFYqclCrrqfQtwdHbXuqiul1Z0K2dYVPwwJ8vH6/P26qxXw brOTz9n2nxtiRvb88LLHhk3LlvwczAF7iMDVK2hE7OnC8O9eaBdsRiOy1Wu5acXL8FHli+02ZjdR 5ip3GZfkRKaZzKbI+FKEcLsexN/D9kIcZR4zha+I2FOZwt/Hr5MgBkN/9tBL7tnMgMjoexBzfoLd 847PyVyP8Mv4x6vDNqLg7VBPV11n5QrNu5dbRcJBaMPkTtOmyWQ8Q4+b+dvUw9TDwMBAx/ppG5Wy wpm9yHl1tncSDikgtWQhkti/yRMfarwyOmHWtlxMzU5aWE8jTPi3ncDZD7b58EpUS9ti9rrouBfl 1GR++vKIYM6eO5qdPwTnpoq15UYGs3YSrZFcWkXwtdxOpZIY5+lFxuiy+DVL0/J+LrbNIfror2Mt SRatFvojS0r9KzQ/D4n6CwaJTP1cLf/tCZ208hBiR+ja1/EGWwQS8DuRLiOae9es1PgpnUvsR7pn yP1Sn//TJEcg4EXFIxDNvp/E8xB7sdB0jZysajwjGN7Ecqnd3DMym9fzfrHtoXpqj25XmPY/LF11 INz///8szCanu7vrNGdmutvJYdyJ6c6N6e7JM6adNkx3O93TnG6m/c6+v7/88/LyfD2fj3q+/3Gy Zqbvc2XK45edJeBNxuYzq2MoFnizHl70qHyYGlFYUIA6mpX1ZqwH29Fc1NvMjDbd3GsDU5wnbvjz pP9MT1aoOPMzg1nnioe2rD682YiFWbyPILGs8elOr//mcKOazUQprbke3u+nQNgooSe7meUt4VJq 5FzAEmGy61q49e6mxj0I7TlpIsCW3p98p9yj3bXdWxKDBo8pDIC6OqHKZVi/MqWhsYo99/NBPQyb W16D+riI/iLk82rFygmxbOm9qYL/fNx/Ua/p3reGa0rS7QZVDtPJSfXBgVTxPypjdastx9NH2D+5 N88B9HgxPXsNT/m+NRobikF+96y6jGbqyyTVlkbexDqidEcPXbFaE7UPkaSGbgPIAy5xG2d5pWZo I8GbU1W2Fb+Kf1idoNZ6nqKQR1vuUJVmstVlnsYbsIj2naRCtuGfqnQ0obyYYcRzhagcReBhZmx3 tZIQmYNI5n7Ouop2iAD1QfbJW/RuJ5Gh9+tj+L8ZOiRTM6TiCwle0ikeZvftK/HxjW6NWWPITdc4 nKEQzqKeINxpVrA1SAULLZZm2lrYw9dF3na5tllkU1oIrCCkIbIOBVkomK4CNgAnxLOu3wmbPDCf 21fefsAL5kiigo1OcT1lUwr72RSzumqcdkz7v7azo8kfl4/dOhZO23pfAR7Vcby8KBVnKyQPMb5z /M3u7uoWnz4TsBVN1ylz4ZX1QrEcXJmdqwZLCHib8TVGZHwhZDMz8yOvNutGmyesjlZgm6602/t+ q7f8XCVSira3L4ItJ1B3UVa1mdaJ2PvtSCMWGNSL1S41o+4u5OqPz3Rewensxr43nCvuaMsNWctw 6qWiICCakdLU3QfoTdK5U+fsYm1xMlPF9dxdPMykQjsT7emN7+v56grdR94qA9Oul4Pk5Z3RGydY unOB5uEVIG2LELJi5puOX7W1FjvsuT0U4+8935ItxElY0qaUspWX3H/pEIx6LrBSCZmijillgB4t t7YW/VA4NLMMH1IbGJTSiU9JT1qc19WcgIw4OgEMlSc4P85Yk8pU6lRL4gtjaLoQfkLIiClhJQeW vRAMs6sha4w8rul8jh4ByaNjry+0oOFBMWSXp6kejzLjDQhXkX3hycnLTc6xsGiTfSclRUevp+YS HAPPUY8Wn5yJ1PyNMTTMOd00w82m2emXjsXhFyU5aZdeqSxLMcBnORTb2MVcE1WdL0GgN/uJ53Df w7H5lbca3Vt0TQjTQZ76oZnWf4TULFmEBTW1DD56to/cND8wKbk4H7i/0nJceFUyZ7ahcd+bDxXj tYtJRvecmp6+jfyTxavyZ/LNRlp9Vh+xAjCqpot+dq6I9vCxA8wMS1fOB5uzxwzbRRi4L/tWNSI5 zdikghXTcEo9N/qWLJ9yWcA4siAy1QM4fdbkaP5+sWvCp/bXKM8ki5zU0d6hQV2AdroXEDEcEOdQ 2LL0eL4HJJD1uyTFZTo4S01Yj/MuWPbaC8QmrNr6T3lxe0TFnjmCK5xr8Oc1oRzDLLPAWvViy4/K d+yNLCSmbpYDX7xZ8OmA5l8//LSmfYuwoJB4aD9Zx8+aI//dJEZPTABLNEbwFxsMQ2ZIhr1GIE7j zL+mcuwnJ0YpNnGnAMeRyfVTAzJQWJzBG7jB3O+k1DSGabz8fGLl3K9isI9s76sVWwbioFZtarg7 r4Hjl9H4b78blYoPx7Kfq8mfkxay6VEy4eBMGr2+jB8keD3qqK9OK+UtRVOug/FKtfIZ7gGLoN/H rbfifZZ4pj7TB109Gq/Lg6NIrF0XHED5KypTO81/P9oHHrIbdcGj4W0UjX11w9/VhzjvwL2bES0Z KT6QunUZFa5kNpTE2LZXuKYT2AdUl2r4R6adjIn+oy/zXwrHVRINOlKSyPLwopPaJsoOrfedDx2w p8RRTfGJblUKdY1kCSXDY6EzMD3B9KiKrrEv9GSqcVJnC+LV3pZMFbEDtt/bdl+TRct/8fZe0zMy LyLwVnZR8ayI70Fdb6kv6+r+YJmG0WcOeMNyDTBrcPwio64Xiv0mL2QqYKNctcjn5kJjgzqrMrb9 rSgLXa/uR16wC5wiTfDoXrtka9jAVfdyyMrdVXP8q9Af8RRlMul06trG0kgZSVLeiHDm1S8pf+EZ DVTDt51FtZ61pXntySBX9tNpDVRNToIiXQH3E7MafFFRUTa37Pb34kSwyVW1bIHU8yjb5ziKYVFe ycx07GQF499o8MgGuCslxfHyqKYS3bdZPC8dsqyb03I9yRmZwJEvbRoGw9wrtL9B2BShMBlLY7J0 WrBF9W5FdVoeq5PxyO6rvKVnuwZmRP+FX4rFi8QtqjjvfvTcNciJTPeK7JswjtOmKCd2sGKuqm4g W9L8oQmwZFadeocZ5jJgvYEypOoZammYiwK4E1fpFl9ft02mINvNJpbIipfI4i1LlUxFG0a3WF8B mCcKp+WLj/6H2uFLNqxUxfSBUWU09FW1lOEnr0wj4/HEkD4lRlGyl2G5YziePxcoSUZDE1AxmF6J bSg7OnJwVC046nhnZFAoRcb78It+93ibeT4APEV8qE8yMX9PT6cQG0LFFKxm1kIsrBqKb5UjH+kz Xd9XEmEg+GVZH0HxeVhoVmKrnFy2o1JQVtpvmleCSotsuJYogZCzae9e+wguhZv5TUskk4TQU1ok rcRiki7I9XtDcXFRUfHrHSeRyD/nbQ+vSA36BsyGxZ34Sb6/5x42VxnhKPzijA6ZzM7mK3eW5Wxq CkTZQtsNGxzkT2FKz+yR0cTkR/EtZYHwpl/Yko6rpNX9EByIF1f9VcDhVfXjbU/OYIeGNf00ZUOQ HIh/D5dGVJQ8YMy8tuLNuAzb3nMLvqjIT/4CJC+lR3h5sqIgh8HQzjj2jM2Zr/+Rjee+mSxN0MZ4 yVzuNmarjgOKVPxph090NyRz1teJ7wUeipXFrbHFxb1jLfFrMuZTiaJHq3Uah5keSDeo5hkXxHVy iZOyhGSWDfdxhJ9ZDUWbkQ5/Cf4x10bBkJiop/FcQ8xUnDAYj7YlcnGwOnr2TkN4V9py8aLi+p0W CiMlBVEqzNEik4GIx1EXN/qbj7BUTNitAmu7RkRf7j47p0n/6mZCaah8qGlCNmQ3zvAPc0HYp6Oq /laPBwJbWvyprMS7ei5jlYDMnld4Zn3wiyV0FJItv1Zo/iIwJXdNiAafF2Mk7bxeweL0yjo6MQ/M 1H+GQKsGcxop0FlYKCsrp9q2APk++/hoT6+V5uQU0566SFlqa46h3pIRMkEloO70MU6hpRulG+GG Dc0pivdEDZ5VDVaLpQn5l+6MTO7jX0icvXmVFfQN7dzSrPQhyibRExtDRValO7kkOVM3mYzCQnss +tVz2YyeCuRnfMYSXA7Wc/GfNLBR9K1p9cnZC5LTQ8QsltglePQhv1CCHHKl7YSqxqwGdGn/+GMJ 2kuecb9rCKEbZyE+VwCAAvNtqOGvQxN/jVIqaELYlffQssay3owP+Q80otYmKpD1DQzNipTrnFlM ddb3xfRuxkGSrdp6+zh6QOOGqoz5zIaqIYR0IjHVlzm2Mru+zMkhKSyABJpUo6KCALEh3hWuV9F0 dANvhngu7/rIm8JgLi8ZiMSHmJx+RjXGtxrLp7DIJy/Y4E1LOTtedoWLDa+H/y3H0FX9YDTQtdnM Y3tJ7q34foP3SxImnis3De+RXceyI0+cTWcXvW6aaQdj23j3TwYoKQ1NF/jU2aI5+hQzSeHYZPr3 W6h2vT5CiKMBhEnEJWA01OLhuDOexwcWGHVpoP2wPk8nmyZYeWXICJ+wl4OXvh831JnSmv4iYKx+ d02HqLOVXDLUJYKmSONxWJve6+8iPhhwZ3mdrfU3ZB7bE1q/3CsfFMFy1/1k4aoCH7Qq5RG1GYoC OC4bLs305QdrLKlPyDknzUWqD2RFVbUW+b4OXKOlCmZaAGX916pBaprEtIbO/FHifY0YOJWBCItN leQFRXYO/bcGfTvB+EfPgeYidK6+nroNP6BYBPOlYqJKQl6caegkdMOt4npksrjrDciEiqzrvczB FHENKUwxN0/SLHPf5gC09XmDJFHMhORF/quPJ6D5nyzJddRGKl8TNAsZ+uYD5HhjvSrcC0ddwtbk dEmVrOoGE6L28QtBEum246HoXn3db3S38OPebOAq+0QoMeTBQkcvKYUlmuMdPywKrWps7bruWcqG JwqWNsZ//uD0PKPdL4/ygyV3t3SOHf3GAAmGoi8twZc0j0RFbiZ/dRTQ58h0ufeznisr38JcmKPz DY2Kmz5c92yhWNIALgHjUTPOWpQxX6YV1KLhrOEznhZBZ1vDt0czlkCPPTjwZhtbEZ5pgJ0puvhF ZsW05npgxGL5dyLjV2OlAsd5Z8WUh2cSiuqRLh3V6ryeTYR+0THLLqV2mkZOFDt6fyqH050Hi74z 3XqenIwUZKUB74sKRGzcxg0Uzh2q4Qjn4tImbftKgbTiqL4sYQJj4mZM6axFFriDZXUax9TQGSP5 SqW+suGbqlVrdMzytRGzoq04NoOL3d0iQHPqkg3t63GUIuha7dhPO/sjjfKD3Soh2hf1TW3BDsy4 Z8+ygk080wxl/WS2yH/2j7AjYplfVw+lEcYvhtJDI8aJ47ExXb9CmnP28NEgL0k3EkFk4zhOl6UW ftNWlpEz1UtimPM3TkdUAe6fopkvvnxgRI0z1Qy3+uUHHMTz2ndzo/kly7gpyxtSL1cdphyYvH70 6hQEJxrjYzxUBL37eS17InYYMXifMh5ZfnumaIRZXf6T8dTUJHzfyb7vA3OdrCVlpTL7pIyTT0O7 oPdlErmIxl9a09SptDAreSErdPQRAJU3XbqovknYXro7wH253W9sa2aWGdgJL3Co/Hk1BNLOA7ab iyyLf8bCnKHnUFDQr4HMlM24Heifz5ehRBCyI3/mdIYsL9bazKSP2vyp7zWGzHTPxFeER80GdJIw N/f/sp2rQlEjyeNAwKEFjVvN3nDoUYnw+MwM6mNycsv7o3xW8Xhd5wcfT8wNPpod7tQbpyE58QwV E5XoiVTNLOefc/vfWjPVVFRMoKp5p8KZehX3haisBNMrvrtW7jKEQoSjZP+d63h10tiW5/wFOepg kyZ4YKTF68RknWVbyNujFRKqHRfOfkP5uh4bm5vvMLSnk7ZG5zAb0kqm0lOJNwZ4gft5I4jbNb0C d7CaQcBNqnrLdhY3x71MjWSuAT9fPh+Qi2UDYbdWD6MfY5s3pEkfVjyaCLhwPLLAc+E0aRmyPKqo I6tyJx+wF1My1XwsskjsGLe5Vg4T2e1IXs7+/j5KuqErf2ETMeGNCWrUOEQpV41bbmNozYvj59Sk Tdh2MLsc4RQV5YPZfjzbmRVr9kkOq94NbhzwSotMeW8h6p2Ckd4nq9qFVVUwWfAhOmUZs39ru1Le y6khHit6aN4cuyGxg/AiaZah9ZaxVUMXFAbItfjT87U+edCvKfjG7GB78irwXsNDyRntQJLgwfRX rJvD8FdLKDz0KvIxu9KxffjR7c/FT7KyR76dGzK7Kz6D1hBC/5bV4D37ekQW2WHDanjZY3FZxLH0 18PyRrvnoJlW9LLWQ/g5+Yyv9HI2dEHvWd1Ci+RvlZbKTN0PjXaNB6p1/SF3YW/YoCsIAc8kgXVE AhuqoXKJi3nJCp5bb7R5iIwfo51JaT/KdeJpWRiqUoboKRqjy4XuoEvjjc1tmaXBrEriLI7S6X1t XG1JefOlwmrJTQmmyXZP2C2ZfVNVIrqSk6fZAhG2WWMZ+UlS51wLW+9AN1nrHb6JZ1eSsqAKOdEc K3Szh6zVbT+p1qb1rrisqYrL+L58XEd3/uDCz/N5qalW1B0IDRWgfzW3s1pfAeHeB46WOpEKJ6H6 bXX7zjSfnHBJ+K2HZ30aTLfrOLAPvVykP/Jbj4r5IdjCOX+/eap82m4i3Et2XhFjcY9bJ7h0tdmL dzNC8Oc0s3WcI26TQ6k+wrZlswTV32dz24D299bg76+x/OrvfDNnXfJ2/dQjWrXSW2sQlN/+uwzs wJyppnX7j3UQZ+1R0uivLgMaXtztXtkjrYvh3yQKE9tw26YqXU4Tf4uzGehRhMO5LtPNDZ/fgVVZ 4+nG6dxjz9iMasbGwFEX1vX4OiPWXRgCt1FobOFVbWcDuoBBLMJKhWa5DWXefMIao9FccLUDTQLV 4SQx2vcO9vj3YqOu5UKx4fz+6BFX4tFAXNEMBb8V7pflq7NE2vD4UI2Hqmx7f0PSAndTydibK99Z DaFKTnmMXfK9+uO+nHdbvv1rwY4uW9XuNt1M1mdnxX35vkQKeP1SMF/C97SfiOH3qpMT7O5s5tl1 BIQo7ItJ1Fd/RRPh/fLo+/lg6F1MwQ0V1Y1Ea7j/dgXXfXSrvnhwRkn8c5fwr6rGapweUpww+ltQ hRUmOGYkABoH8FrZctiOTm+5UL0h1pYOf/jrxbkv6/1187Z7/mEYfUAc4lL/R0Ag67mEDZxS2TZf B/OOnPDbKF04lEC6MuvMJBwQxs+HcY/KJxAj9yu2m5cxBrvqqqmRHOasXaSA5v1ttNzu9w70Pp6A 5aZx/nv8UYqEtgKfXQW3RIihzB7xJhlljHKBp737Gg89PEsj6Z1fyz1mNzw8R/dv76bJtHaVqvyE B93JnE1NJCz5DKxuI6c0pH4tZkoQckXe4nPr7ncN9+sPx783gin2lZfOXIOwm2xqPkJBr0M5l9rv 9tEXYh32/V4z0JSeXr3IOi4StWvY/P9absRoTFAlYjrHSe1Ha1ZWCoi60LEEBwW1xotiL5u9caCZ Ab2IN/JZDlfRZGXX4NZPyM6U6Z8auOwbGW4gxgLRBfx3MV95+O27ppWbiuZhkroxbTlkrHh2m6Oj P7/z6ZS4ZWDTOHfX9uw/nNnd5b9om/J3aK/EiWIGeSzsAdNMwOjy7V3eirre3xxYhqW/QMvV70qZ vbRBqUfYY4kIr8zpPaF6+7MCkaLljjXnaOxn+k70SwsInCtuV3e1lh9XIHV8dL+W/b8hZVdzd0W6 N4l3Q1sSCzVl7X/CfFnxeg+01X+vNhj1C+IjZzSNOTmRzlWErr+wnJZmOxbU47EFjtacc5lv7+oy ZyUomB8cu6L+G7oGllYvPd786pU5o2gfVTij54TNFONx/6B6Pbrn7cvabj4RD033zZgChZOnrQvl iRcyp9WmrVULvrwTMfKW9GlA8dtikLjbPz/+pQnI0ihbY88iVzmmVmHz08EfRjOxk5dsaQeaaK2r 9SIuvO8vni3M7nmDHthJMapxB4XpSV/PPBcQz6lBRYJKZ29NY9u724U004RPv8Kq+osSqZ9x80wY ZH/aaoSecavoZVK5FoNcRnij0Ul1DvP07qDjOQ6D3A9XEfvHvq1AKK1Go55/psKmy5Gpn5sTq0m0 woo4ZZ6/lLqWzYXeewb9gH1Y0pLqKgL99STRVWWBs5ZKUvVGoo3NGvtV6hLZ7qp4QPa5PXO4ZVGW XdG5ZgxFN9h047u1GuIvepO/q0p0uGY7/BBUicjM6EWsi523bz8xoVqrT/Dud+wrnPkjirwr8tM9 j6XH3/CdDSWGYElZW1vYBGQjIyMJIRSD7PIY+9TeC5bTlJjg95ySfcKzXNauxmOPLli0VS0fmrh9 bt418BX0bEw6E0Zr9mjiS9ca4+hr7IK8R/cYJNI5ODNVElcQGeQjfQucGaFRMHUKYTMnpxtrvAKN +cDwHFBeydmcod/NLMsBSr8tpaOV6zPguYsJFu2pwsFK2Ky8rJAm5q2LRYECsnOF02zFXxVaR0rO rJv91NecsfQNaVr7bvvhGVkzWK9Ue+3WIkOHGJd2NYsSfaTUASWTIZfZEvi4zb/Rn8kzC/71vvdL 2fZvBvTuTBowzIR1zWIkheP5ACXVHJ8aUmvs2W1Mhea582LNqCy7cvGOxQm7dYRqKd6cV7gfXm0m WOQ0ZBgNXz85VngMRpaSOP7Nq1wXD7cIXWSbZXnxCEnm3bty+x3nm7dQLoxeFVoJbx/yWx0VC2Br DmQa38QwXEbziMBV5GpOrwV0vLcrJfJHz0RFBeu64YXf5bXSc98kmOwx81kcvnQ1rR9WOzxn+9d0 LNSVxn9zb1hY2LdPkPO8t8fudDMWOtdL/A+jaacKHfUquTgvROy/uOsNI+cpkm5CtJS4fj71nb6S 1G/kZMczOlhTafFgxvDx/1VH+YTGfxoiFa8yGHEYZ77lZy9nPrHzFqq85YTHFQf1Bfq+AW/AdBKM U7mKmdOCLrMth0pc5UkzhwnIhX81LJdIP+xT2Yw4bp2nkscH3ZWOo0/pZLXw7ur+09a3UE0X4xS2 j6OhZWNxW+aEPOTvE45dT89wqul5JeiEDL5Do/4h7y304IImRecn+W//n3bO/u8qru8vVpuPnaOM NzgqUdN22PIU2BkIGYBs4U7t8O7z4Z14HaZwut0t83vOdE7809asdc3UTMqiVrbLH1ca0IIPDw+M MfESbOGWynPpsRpHMygdNMJAsANRT5NxpkSpxhhR9Jvcg0pU3hut57eEQHb8p6N5SR3wH2rUPpJ4 uKiye7yT5n7luusmMKdioWiEqlsXUGsasepJFoWFNnCLZHjtOOWyWvkbT6ln5Sp7u1RFw8QN/0nc 4kCFY6ZYjtujQ3BXwQazhFidYxlPbCmtEcVFakH0NYj8YFlLFJeYTqJcxzFgZeMKvdMGl08BZeE7 x1BIZwAvlby61l5BI+52enS3A/OnhIB715Pd/3zdvvrz++qWD1g7Z36D+q5WVvKQxfx3oA5EHgew fdZ9b9Hcw3DKeXomd+BVa5Mug6HuPbq+qtDVjoctrjUY1LnKkx6FC3myJJBV4ynbXi2n+vjue84Q ETrj4ZCmr2qhp5jY4KRXIebYXc6rU6sV9B7fHPRSY34ypyW5oTb7j27Gu4hw+LZOefH7z22OXwnf APXaD3gxqOoFFQmCE+IkzBPGKbXwhxW8+Q7jVUow5fXLddAlwJHHIvZtiidz629satM+0p6C2Vyn 5U1Hcn2A8TmFOvPrjhcAk8QZyOdApslaEuulTdyuyingBhmlgZw5tQQ64ZUwddvaP3TksyvU/5zY Noxn7GqUnZk+EGV+eSNOs1t+5kCZ/lqivEjTUSemTfM5rAup/rAa6ctEr3JFJmspAdnGSs7OvgiN 1pnW+c4irQxlAAavhLOc4NssFHmkdkCmE6U5Ju9LcaQ5fEpHBohxmgPjsU7m6NR8GCXs3/sQQl6F nHpGhucYInu2CobpoHl+1kBd47vb36oVuQK9f9jnxRhRWOwCxdm/FsOWYPvHUyQqKpTXZ152GJfT g9hleWXoUzpZb3RvxXJkLc5ogUd2Wy/Z0o0Qqy8UHpEF6MxTkAGW1JjJL3979KtrVFt9wz6mZKmZ Z5KjNPl+17T/vRdNQlFO6OcXXiDSqZJ+QQIZv82Sj8ZBKfhD4TmB659LdvYYfExPmj+uVTmpVHh8 BBvHJ96B1LXQT0Bs470Se0340EGWZQfvKzW9oC0ol6330af9Q+Ap3zhmfw/bvWt4jn4ftNbcmBTX hcb/15Z6Cw4+vb+Q7ApKkjZvZM8h59/XhF8Zz8+aTj23kEetGnF3pfSjdEoI4pTlhE+seUa5gu5M qe6G2uFMlhwL7HrbBzoCu9WayBCArJWtbMl+1MpVpAssf37A19g0BO8TfDli5o3tJ4B+PtLO/bym iw3a++9ZzJzdMdulE6Ea1G/7+mfZvbiOv6rNIk4cRnDVnWkFKhfNa18HYOZvJV0/FXzsDPQVapVZ R3vp8aNGZbiR8/WzacqNDEJ5Z8vpQyD2hYTi/pl00gn+E+mk31yTpkyXTHlIhyEEe6k2ap/BiU8x s9ztKFfBGfKG3+lmN1TZjiMLEU/i2Z1zSb1J9mwW5ILiQ4IqfVRIbYx12xFQLkPx3dFy+lRD8ls6 w5sDqQk8hZYfzOFJl5YZd9eux9WDDNfWU7ikwbSnmMYOhJGhCyP0nEd4H8JII54LamQjQw4g4kbQ hfODJYxtxemkRaT25dm8rWlS77otOY5Ln6CCeOlRaktMi/o/QH5ooaGViXi2VLeTTR+NhrtW3Wvt 5PWtnS8h5EaraUqKJCTJeUQX2d/wpF82Us0q515G5/cVG2B+LqO3Hgaz6zhCSR9JxBLqM4fLc1/9 GINoIMMK8u/f7ctu7b/3cUN5eQXKfjnP6CGkYo/r0Zn6RzZd+3nzssIxMYdOXqsK8uQm2euRxM8v 6WmYHqhjAGnYSJHKmGCRC04o2RIoYSf8mvLRKkQ77J+O2OeIy7nJuBCuIiKHzx8OHb4HQpVV2i2F qn3lq8PBfpd6nptn1086ufThofRCZYNM+Db6DT70cyicVcV+EzMwQZditQ9+vpNDGHH68DQtFvul orFdQCmqPtmK84AThz6MOZwSinbSkEYlJuX3S8+Dpe1sSqfkn5w2G8zX5OjmXnhJp/FaR+uKGkKw oz19ntsDQJ5RpqfFllvgMIRwyZMoTSksOIG74JywdoZr3oHrbJ21znPfP0DolNs0t+et54iZhcnS 57XSgbt/Km3kvmtIMyD49oc0C1NLG8xV3ocaQyLd3anJktvRm+NuSDGgLV3oMI4s8ShEG79ZwTth rXqa4DX18LuHjLwtI7u01tUzvcworyUHRkcnWPE8ZBWlJGhdS8FH50kcm5TxnKys3nWTEW/a7E7K LB0QSneByyorvy3Z8183DRTWHevkPr2urEZanM+QM1B3b2r3Q0iemA0sCPu0T9BJK6Nfa03AZWje eAT0FsoRCqfcvK944qV9bSbBKvhF7WuGkAad4QjJEmpPBV/WK2EIBFp7//rOdtOT0k+nRUJaXYvt AKaLiZWSbEn3g2IbUqotGoBlTCuRvgKGmR6UMvDrnPLRAgp8/MNztnXmcwQ4qAChxim6ua7HUSCZ kIUBRVPt6lS+9Ci7zuMNBhBl7rz1D5/ONbV/fL+cznwVFlA9U4L5myLqBKVpkIdd/r0Mluw9WWBn Ql1vicz5cXWgIOs6Mt8ZWEUY84c2/RS2cWhYjI7PrIU1uSUepXT4CmfshO4jMLRTsvi8ID4V+iRU SFN57z3apthkueggmXiF6+xTIr1/RFUbpDisAlbml5iNqxfPqt6O0nkJHimOxGYNt84btueT4xzL 5gnN2WDuH4bUyt135sYXCBfADY06sN2VjLX3KknFA1YqnQif/BCpf/w5g5v8Hkbnz9y2rgyB27E/ v4y6/+wprdObF00uLd4slhWS3EbABhAzLOF2NMujcnb9JSdeq2AaJEC+usxvYtoX8cx8Z+8pMkpg 6oQTPqN0J2ZIH2/98SRshXoIJ0VOenLODxYmTfMw14iy2Iq8/Mp8dfu0eR7POZyr1JbyKEEFmv85 c8T8brPkWNB/HCc5LtzGB6Phx871DT2T24D0aTdbE+31ovwf+EtmGwz/Tm+AdUcJHKyMxKhWsKcJ j/VnRTd29vhILmTM/W8vU5QoY1DGUonEAp4WIhiU03pCgRPHL/lluxkP+JdIgGTI4CD/X8eMojiy g1ngzFBR6fkl/o2a87+FKEmgVXn9neLoJppcfKfpQKnDyz9NzE7pTpEZ/RAKiiyxGtAmX/g+XutT aEI2ZPaFaMT5CdmzkFzqlo6qqdXYLgdnrF6SElguUx02DdDAsEn2aYVrXgFHGaBBms3eraGUCFd3 rM0qUJDnCavQj+6f7Q1Rsh1tCt98kPk3EqvGeYx4ak8jDaEhAxi/BQyrVwd12tkpg7IkSzDjG1R4 hHYsxT1XvfBJW5FGx3RyPgbnLply/uQrKUqV6MGzcuYYMEXsZ+/wxgYbjRLbfpPhKXAjE0eOWdTG pVfzs/a1CmJBmD3FKioDywoNMmp0IRjg6eLFOKd8G+r/NhAkQoOgRpxXc6tbsGEEFpbJ6Omxs1W0 7EpxUPvqAZzqg7fa2208ZwaLh+Cniw3woUa0uFifY6u//9WOfFUbCl9tzgtoE/7ZvtovxZgUHnMF 2inXRGqRN1vQKaY6xjFWxFSVMH/5fYAiMs4JZ0yxNAQwJTM4ZlS+aKgNIvJI/19mrLOEMIxRYPyO o3CHDbMN1taPUd4BbN2cdLDtRZ0tTcvlLXQMSmVaqHj0T/6FiZzP+h9MX/sdUo380V2JDTAu35to towweH326pRPV63NMaM7EOPDzrLakxgp5uLU2snhUhwceBbBsNRdPKXeQ+esL2YXA5lS4CeOjLVT EBdqsf9lBKsIywwnOayruY6zg4N+EuuQbUIj8yzL6olPlWGBnbIhPpT8d0pU1mUbZEhyH1f3KSZK oB87y9r1TFIrq/x+y3lRJGQT9ol4CThpbQ0r/GXWOlXskxWZU0g4H2jc/8P1GGvpwMFmuAhV9lr9 chhPpSTJfJ1FyhLsxHk9Z7Yq/Q/umsaKYyi/NB72HTonezXYbjxvaO1Vo0Amn9njAEwpFBx/tSuu bGvrjf6XF5t0SvECJUPoth3o/hMs+HV5JnY3NAUgLSmhEJByuB39Bi2JMzt6yinh/Ju1AlHbQKkx Er+tdM2p+3uNd4lim/nW5rULAh5OENOqhqa2dZyXJd3F50j+W4/dNnJRUzcaNpnPtiPyCF1IYE30 bzYtc5f6FMv45EPWnAeFT/l4ISX/P7+e5hy6/yREg0NCbhPg2qUHvON11UmCpFE9uH6jsS6Q5rkh 9eXqJATHv6rHt2wnGiDvuP+TcD9nKtB1qdU9w5Lvk2wxrXkdeMQhoaX1UeAkfmWV/clN/qTxmuQ2 vj0Pz7Fxqc/NpROszW7+Qzx5ynrq7Br20cNexd7JJjcOWPalWp8ASVNr9Raahp09mAyoJS5tcUr9 wEExi3zEjN/tdXCConExBEDCQbhkBnAa8Ah/grMN34eWrgOs3wsLojeirBrV83X67ITt6wB9YU0i e6FKX2b7AmMk4h5VX/thnTA00W3/Onc/r0OUlUPcuSXSxWRGaqZzKJZ8C3/1zDLEQmGU/1hCeLef 1Advj15dvbzckC1wc20bDRgokP21SFOvaiuRtgj5dDJnfcJ8gkyvyI2mUmINER3t1gWurTRns/9R 16kv1oMVcblxmNvAKLy8XcV8HZyzTRjl3qhI3ic4H2fvspGv46Ktq9liKkBrYlf3W2XfOH6hsO4U K2v87eYZUn9q8/e9tOlOcnNz2y/d6Mn7iwgO+tg85B3SikumZGJczP6qgaOK/hyswAhDlK+RYUCd 48ozxjtxcnmJRyw+JfryY0gQtkdGVI/1hZbK7iwwsbH647e602RrYzTxsqcvWTYDZSSv6rw9alpb m0uaW5GZT8SjC6wKncsR/IVudnv4I7xHhs6+Ro1P/YmAU2mn8yXe5HfbDo/b3GmBB7A99xp3PXK7 peruofTIg6bZSm/muvzFbQHSfnjWwtMIzZTnXBGUgpvwQCbZfnhM8YJoqaT6MQChxx4KL7v841yA 2Pzh2AcqgWXgPn25yCdnEainyGWKc3BxcYENDzM7HGd9eSlx67E02944j4cAJqUUyN4MkQgXnP5L 1Xm+7tY4WbchRcKzwPimbKz2VCIhbSzUF9gGnyRSJv66k10wFow/ljIXXwwsCcC6v24vqq4H7poX IfEvXwVVvsGKEGqyPTzfICVlr3FiTPp3VHt+Jn9zjJL8sHe4kBOuZuAZRiTWAiyI49MXC2RKhg8r jHwG0ALZrpHaNcPm262PKuF1+snfO0VdfNyr3lXr59+cjSslHToEDybW8p2Gk2cDyRvZ3Mr5Io2n wFFbVz7cJiqDqnr51x3GwV17aEORNGkjK4O15dCUVJ2m4sYu8VfLqazfujItUwaq+SS/w2njM79C bgRfyd42RsJQGopgdO/3QuedR61q9Dieu+fcby3liHyzjNAu73pKYSxWn4M/Hm9s949xrsvdzm8s 6UyEVmaKeoyCa0g5Ai4+3Q5zWUyp/1b/XDr9TyYNNN1qrf60j62OjeG43h7LOVmXzOfaybb8OKUG /jUIOBicSIiZ/F7MMeXF1suC3DeQyVR73ykx0k0vgGIX59S5u69Pzlv0zPmir9Dc4vb0cIO0uh/C k8YOoWZ9uh65uR+e/1YMaOLfVis/2J5fNACvycw3TlOee7LLrBd6s91l6E4UxlwJlz75ItsB/waZ QSDW4LTbhVzv67tSShKQaBXhSWq5wKUoOT50mLGZ0q/s16nA/0cP46kTBoO63xR0yCC9MWIUyfzZ cCEv36fTqb2y1rywtDp/7GfdNtkTEN3G/tYm2boeG1BM9ZSVxYU3TBTolFOQ0Eh4RyZLujt4qICk o8LubKv0UP6Z+Qa4dxrW1DlmYRsCtfe13p0viyvzq6XWu0iGxe91De8QWDYvhdvOs76s+SeCfjfT GEZtJ62z3lSzMmW3SyncLKXBs2MfxWg+pxXlj1UkiEYenWIKa8bz2f+OZgrAL5sJlKFhkEsopP6c rFg1z8E4BXVV7Jtar5ptdizkRtE5kQj7tZt3kFScXqdaMpVX8aerubbfNkmHJXa04QS61R5Bap/k fVIRZkN05F540fpc0vnIJk7SERgf3LlKZUVE9XAsDh7JCNSxsVF+EQ+1tOTkhlltAa7EvGoQf1s0 P+2UDhKR4fwQW358s8/XM3IeCP8bIyYwPoGX3sLN9/nKytFS33YYBgX63LQhaJKjb7r0YrCvI/f4 eqbP/a9HGo+OSDwhP8Fedje7NZP5BpXCcuTqofAV5/1Wf7CcID10+yyo+2on6zHYt2c29YHrsf0P dqZXKdO084/xtNTchR7Ayx30pMI9B1sXwNKZoG7BLMSkiYCotwOS4/xUjotvdJRhvYNpGb+489dL MufKhmklmz+uItHTSg0imjq5vgWpekOb7/cKPkJ53PIfB1svokIsywLgMAWbm+JVQf1c4zzaAPjo a5/tH6loRdENKmyVxKT2IchiyPrgy1e7LC7NU4DEzSNmv1zaDl2be8AVuaxiT3IQj25J45Ij+1Jg uWr7LGkh3N9FIpwMIpOaWpJsgtvdEO7RjuIpRX5wswh06unuWjcjV/74dClJIvQI2vDfV3M7Ly+v 6MuJSCHxKB+smBtWvkpNvmZ+tgHutcLtwPqxs2FVv1PdeyZz7ta3G2e65nR0lbMuJQG7fEZhw9qs sBbgDOR7UVc7YkRjUkNGVpqHMqa35ZoE2ZCWc/9H99aTqThNNU8wp5JJM6v2tY4taZQ/EO/yumni JKthaePjZNWHMab3G6H+b2bAkVE7jw/2vus0x54bWjPg3OGIk4bUVPQ92Z6qlp1UPdWg/Q9wPYW/ PuHot5GVgvfLj3v2Yvh7wq67k0PnKIVwP1Ck7lY+13nmiXRuktVxQx0exZlXt4MHgDM8dxYcmbnz uGp/P3YvrpZFlW41PKwk5V3BP8ztPAGjW0VOdBrv7P2SQ5RXN0QnUjK4556MWHTisY3KZ/1Bk05c PEaZD4burOjnx7llke+NRdUf3FmZ2jlBUEXhGtZy7DEtSEoVdBOJ7GrKE278vSGffjK5seqktnB/ 1npzPIcOjJHuBDpOEviLj5NQ4TWvOroIRiNPk/aRLdc/bhfFzfYZ7u0O1awxfRirajIzAaRd/OD8 PUMnv+F87kT4XHbxr3gGlEcg//Hr8k2PlHisoEp3F7puAYwUHhoLXS+rdBAiI/Q2Kz/6lWtuakJo 5MwvEo68PQ1Zy7QuNpUv86trUMbDSI1WQrc61+m1nB5GSHf9VTzdHJqB0iyBzOBYr8Pjq56Rd0tX JZQAv/UOwCSCMPO1SkRkTs1Nj08urb4M3/Z2zU0s3Pzp/0G73/h7IG9hvRLzdbUckYM4EwSZdhHi g3kMhcXWDw7YozybwTlqUO/ja/zI5q83Pv6q7n4P6BxXv3D1pT81mZVg+1BehBWsK9kzefWICgq8 umhgOrxhPFxumyUuhJsceK7Zl70PsuyyGpPLZ8vRK6qZli6ERwr6rV7IMYn1aHWsQuoaX0CRUCeB YANdrvC1ECUTb3lZNUKCbzA8zcX3I4IIGAWqcOVlOjGq8bWJx1KG/bCfsPW16UTN52XHWdD0eQ2z vl8Lbjm3GrRXZh0oHfb4d8Y9QdHcCCqtPgQMvN3jdnu1GXU1VkKUz2X4veG/i1RafTo+WMO0SFpO W28XlYGjm2+0fjIuYec69spNZCVPH6JTNm5ELRehr5FEJM31ITqvAs5kiTDz7993y/GNnHneMdc+ WA8038e4QnajDqiqy+rM8Zs1wrSko7T8b0O2eGEo1DhsW0GA3bJ67nh794rMpBdobotxJYZLtrOz E1ZLfNJRI6bEHRlUduTW8A48eNE3kNOCiwLNpXYVagz/J1eoh1HdqpmkJGHKEUNBVr/fANmMAY8y Plrq369YzI1TcoA8It8xwdUlLUe+lEj6cK04q95NmtOJV6YS8olz8P9NJewCOxZxUZoTc52mJlUB TfCHrVq8PO8MkHXbKs0gsg4vKjgcSU/P6Ol0iCtrXejZWYNXb1wsluy//QDEWHSaOpBCj/4VkhXT OOoxFodzDEosUYOSWJbV4l9G3dAzXIYpBBoN608T16CO5Xz+f0aeyRpte81mpe6gQZSUsy2auLSS q9a2WYfJW0o0VjpAUGKZTqh5JXGW6itz8E2r6xHLyfHrK/KS0AlnF74pXNh0jRAJYXOL9uZxAVtU GhfbyHUbWBdelGLSddb/0XZI8wwe06U+Txz240EkjPTjh0pvYLformbTiUSx7duSuR0rLajqsv9M wSN5jGzH7PcHKr8c2Q94E5K+WY0iHNqo3xt20HLZJfUvo7zX3Yf570qA6h+GJWfuoVcvkTwA3yDU /aJVTYgbvEy9Xp2+UidJTbUJG/PQwc9duipoR1RwDUV+nWjJ6vU7gkuckbXuSpAEXgdRQ32J9CF2 P3d2SibGWNsjw2HCPKw3v9ehEuK6H31p6YJXOdPKH1eX25BwQT8FfWCrHVaKmNDlIvYz7mc1UzQM CNiXAuqi8UNjcKohb45mTcUkJJD+Vi7upGWrDB929T3MOrrkgTQVbp81NC1d0SkFSl8Lk2Hmfr/X fjIpsdrL0zH1/PFiw2bqX5bZ4nLMpvW6IFTf9Uhdn0iW3MuP6DAP8pjVCxj3Zb4/zi7fbk6jCCxU F5zI+nXLSyfxgg4EQaGFytOEW8bjdGfFedwx/+sEEVSC06uAxPLVtdhnepHkDm4dFyt2MkpkpzWV UkkxIozV8c3p1H5UwpGq2noV1slpGa1eZvwfFBFpww+4fVXdQh/uqG4qQ1WSiCJPTnFx7VOpKX4i 9O/qmSxUqHRcavCN2EROOn+3GSs1IE01vyMUmpU1wO0LKaM3sX35rQfZrSFNm2UgMDifWW0LfytA Lp1CumgojENXgOzSk0ZCF+13wE2ObPdsURxlhiD3r63VWu92RHKelr6ZhX4ijQSfc7abySwCXVHn 6vE8mYvFlOeVzF9q6IkPL7Ho2eT8Wa/vUrKZssl3O+W6DcuFt2w5VS1YImAG8317trO8pFIuyktJ 7+NJuTvF2ScbM2ncq+/TIi5xco1+Bq0rVkIx67E69uS3JTEvaDIIICf0nfPAcHUI9fDzQ5LApGmv PsIqTMFGRutD8LJ1IBzi99NWYE8T48ReZ8BPhJSw18cRQJWLDe8NreQrBMbwTOQI+X7FkQ5ScVCy iMYx2JOtyiHW6eptsvBFUbY9lOLo6OTMeIoY/geb68B82l/55gXdVsH2RwYEr06dl/U8tDD4Ch7H DSyj9onRRoEm7G6kCCQZv97cOWU8y6ciC6ubvrZxzdUuClVCv6PQRP62sf12MC5hNztpu+MVd9nT DC/mvoSz93iZwS76u5TR00JyQm8Ee6onxP2vvb7qSWqmg9W3Qy/EIs/4enqy78iTiQHaRqUFU2kA e1YMH1h5RA5XyVA3pXdzGwnEKJubdIxKNLocKR4kfXBxcwXpMFZYJ5E+LO/DsBlx93OobG9vp9k+ l+6AfKBVZvRtRw6X2M3rw/LO2VQ/RIF3D3E5oK9epU7fV7E/jUGHWqU85qanl4TngXgifbHGsEwd ynV4FhX9lLm2UBCD4rTmxNMZs9YNN8nzFOguh1uI/WLVSCm/Q2KFQYb3Nm99olevn3q3fO2NHRap G/chf0rfRBCXP/Ak50KzqmVMu3JNpJvdOdLjJhsYAWwyJkNyT8rX7UcTzXOF73Y5J3IE+ZukJkbN GEB/xAUv+k4u16trkucud+kefvRIYLgvTtF56WJMdrczRxpufxkJr2pJxAT3NjuvDe0NPoB4St/5 yuARdrV+Q2o6sRa0mwCfh1qgTv9cp/dY5/f6NVLpljP23hx7+mjVmOWokkdddFUgx7HueGccY6Np iq+o3oUmxWStY1O25goDV6+vA3nuUsq5ZjrmCnGRGqD4Wpaq7ZrE3PwmM1YQI5gHYpWpnuOTU6al BmvhBQJbds9uZIxNtnxW2V9cCEduEXcfSD7h0/u6YlA0pKq6uyaxf0s5TyM1HW+mt3rOIQ+XEgSy 9M3FwCPyBR2L3IojiSWQv+z5uFqRQw2dIbAMg0yXDpAPwM1XbT1GyB4MuOZAFzxr28wvISZCNxxI Oeo5L/+zvF6FX25GrC4dhmvZ+7GrYXrngscEoG/aJes3mW4yzJokpB9J+RwVCA2o5Lu3KcCKiEzh wZCuZA8SECXUtAqDATfOMtxdNmSD7naLxwPu9smC7iIXAp90xm1GKseUxwh/TG5y1AUF42pxmCxX tRQwOzVVSkxF0GkGYFu7pEauEaISjv4e0qasxiwD3KgIVDazktqWT9K5tHgStaA+WKRs4/Wc4Bae 41LbLEkhXHyVYHCQOxlluWoubgxFt2AmJXEbt7NLtkVnhGdO+5hkt1a1C+mYmKSP7HakkWbZEyxo f84Hh8jpITME6LWoqjG2Kc7GJgIYEqCajX8uEgsfQpsQl3iN+b7BKOiGfaTWMHDFOSKM6k9w049P Pzjq0TbnUrqR8qb0uDYYQmITxIMRDKrDb5jLT0IrhiuGM4SZ+dB7LIBdRBgyotYeMJFEvvPx8O3+ iDEfPq7hYjaoKuVbFroH0NpLSiK+Kv1x0ehrrJVZbV7v/8IcLFYoDmE2DqrEkDbdfi+qzJckDMHi Te4aosic47J5CxsrssPP7XVAPjz1ofYWu/F3JlztBwGjXn5AOJEyxI45eNVC5gcQD5DGypIR9DIK idn0h9pl0QyLtk/l3RPh7SnDAL7e0JyIZMgbn5YbDRoGC2konMx42LJaXYzyjTlYzY9SE+MYlBpL 8MZnK6pBgaGJc6xq/yIaeKIhKJFLItPZsn+F82/TE5UYWxeVg+Px0ln9TBVompgYpfzpuXE2NhP+ DYdy0Kv54521G0HMkyY81KreaVP9BA/GhsrbhDEph6nrfL9gCMuKRTTlOpd/J5lsfaZ6UhYN1m2N /qdODwhgBNKcrD463aMtF5JGugepTxOgnFa7Ay411FOo7dv4vk+dPFkn0mOb73Q5FXlKCaw+jv9+ DyiuQTkJBIGJpYqR/fK22o1PpAi8KWVeL2nZJ0KykgxpdBuOKaZ6x65+4+G4cawwj9Tw+hFm3oML SvEbfk1UaK5xuYX8U7xSeZxP6FXNracBJQACRwqUFAbCdQ0F8SepKMg8P7M6j1J+K5BLDrr9n6Yv rfui5cpV8bTzoS3PoukP4dJdshBysejYbiQF2LmcVX9QDP60cvK0vrRejqy69gz2fVM6jszjF3jd adZ1TCIVxxCx47lWy/L+WSaNhOJK9ZPUkExSklcTB2VlX8tLMZKS3cbmw+jA+Ir5SQrwoZZ+72oQ fc0HsldI5TdAPurUURclgE/1DK+pqXXxJ2ZaNKWwOajJlvskdWaoRjDSJ7gNRxvfx+/tU0CC3rHp 5q3xf0ql/hS2ZH2WUPPzG3wUV3lQ5y7sPoiMDXhMMh+4vm5K9b8QcXQwwvRix+NL7Ob5ae19tgV3 Gd3H2k8eyM2G46dO1TpIhqcNwZ6FBK7N6IUOZ6AAvTElNYY8Hd4d46fNSiIPfd7vDXEDC5qCOom2 Ol/x4ynQQ1qDnoQ05vZqtcJU7vwl/Cy4S/pXGzjozTLTRPJP7pNZtqDAmyHieHxKgn/Z5AhIKZHD nEzbXzOkSHqlxEd4CuKldvzGVp7YQA142WzcMxBsniskgWRj6+2PTnXS8PJnFyDEX7I3/YVyYxds NfSDbGy5S3Xot4BTkuc1+JRhvvd80Eftx37iIa6fj1maIb0B4TQTkn4m63v5y6G8Qzc38ewneGxD 24ts6At94J74nxCPje0ZibCnVdLvb1EWNweohnzjmhr2WXuHIW/KiUOZ+Pxbe5el8d4WZgTPJxYx QrJrSmT3zKmRu/BSIgG+YMCty1ufZOLKzd8xghC/vD1nX81wSxJ5gcQT9ScUeyyKYwdhznF/Mp7A 2uX7ho6zCdYXaKpkMmadDHyVqwf4DCsLF7L/aBvV63t3NZuvNFHtop+/aUgTl48ZAfKXrKL36vZ2 2Uoy3uAj/SJbXhbs6E+BvDQjxLvHAxSMJi4qanOMklDAYeV7H/4MyLaUm1QweJH9kzn85UB58Mmd K7HBWYD5EH+PlOsSQKAdsRJQNHau4XIPfHMxw5Obi+hrYpTNTaaRt48OyTXpvf/Hor9Ds7Nb7Frg UDIA7McNu8GeIlf2nmkSQWW6oJpv8HPx261doZYlNCSA/vj6qgfmY9JlLi3+FE6EMlj47oTnZJ/9 ya2s61/Mr0kLKhiN/yn3NL5IVB8grtKZGFQBPg6o+5g/Np62pxjOW9/lse7cX5tBEyV18+49G+Bf 1vFXXd7ZFyi3EtvAEOnjwPeQJv2ksgwGJeB2hk7MTGukr68XfpPC0YUY/ssNjlcOHgkqZ9klTVYQ dOkl7rLSxuSc5JqNix5wdNwCW8mcQ11gZ9WV/erDU1BsRUw6HqcmWxgnWwUKvhjlJI8sM4ljly4e 6jZ/45SuXoVGCldV7PnnE2KHt0dwuwGnNNWxmuQR/qIaMXkp79Fw/fDXQCjbvr1C4LYZwSQw8eT6 ybPdWxadheXg4z6kBFYw4SGp9VjjNMOArmcH7al1Yx4/T5h3/8QSl3/9tzl6e2Fhb4XOuYQjJqoB ldqT41agLLFWehChZlhUBt0eAN9yozrPg+N/OtwG5mh+XwCIkgVi2+yApHKYCAaf+5urZjdJyqba 2de0Ez91F6MYHisoYGUsJfnCZ8vKSzosSxffKkyni8mYpgHkST68XM5dsn1HjXyVyajHwwm1Klm6 U5oKai1HAvTP4qfShJraDxMKHlsEvOBIk2gvBL7+SZCu45NMxYhOJ0xp1PCkB7N+3hccupkRsOr2 kpGp5uJdcRZGotGSjUBqJHyJnRIeU8n3V9jwxDFKlsJNMi1/Lwp2I7D/QfX9noNbkKQnXYqlzJgP So+1gGj0HvJdHovAmesDF9I1PiqMU8F2BPnLnfaEhYWdAwLH8zDdAcFx0LJQl5Vif1nZGnLf56P8 SzKzST0Jpge0mrB9gUt+dtr5OaT6zpn7IVO3L0JMP8rPUKNjfX2OyxTKI9DjHKLFY/lGjjxW8HXO L9vTJjHJcpNnnQyKkVK+IycgE3ee4f2rq90XT4vDyaIUGxvvbvFEQDppOwfXsaSnhr6/ZL7F/FtZ 8BLnolyM1GhfBzayb85idhH5nrRR84HpYiZc+DXUHIpjRIyQt2k45og+8qhPlCaYuTdP8XvkfJlv OMVSEhy1sjM87JVbwTUIuPJ5QwDp5neOVhpbLxQqt+wsqRcPrRS8P0S/C6xWy2TavaC+WmxEOeiQ ZPEKeoc3C1rra3DiFEJHIZWG1Lcjo0hkL0XCefmP/jjA5DMjJnTXej4IRRxDWH41bQ3q2UJ1uP2i KCnwO5z86TsDpbvYUCvl5K/AOz/u2QvPW5uXUHHeZ5VIL4qrk99w9lgkMpDeozBHcqdnHcieb2Ly xs6G/zntubLTjzIUT2Hvbyuec8c9cXATvp9T2kfbxfauPk/38sUKfnjIW3GLLsFpIhxy9w2+XKH+ ytlW1dXqC/Nxc9ahhN/4gKiePiqRx9ABk71Y9Ij0VNbfwF550tULK8Zg50/g3bGve68xpvLmwD/J VpfQ6jutGXgAnSOjnkF97xRvBUsyo3tmQtOjZMSJJz9ZOQUgJtiMHX9L4ca7dAn+FjnUZJduX4/j RlZNeZFnvNCaKje9md0zU0fK/5ks5+z6DZCDj+DYMyu7N9fUREjUTl4NijQYsnXHRp874CTCLZNJ yK91zzkNwXTtQrp7tm2YTh+5fbVbvN3IPlbz7ewfJlu4N6L0q5WPb/kPfsGtvDSSJ3ivxDLp+elE hIRa0qSJ+rxa//Y/Hpc8JPB8NwntpaBEGJfk3jWp2pAOkC0s3OU/u7jGnB8MXeEjAuRAvOitpDWI kQkdWbGDxfUMQLlvxvrl11MZMJXPr5GCCRbj/2PpqqOafru4dHcj3Y3S3d0gISEICKMEpLtGCNKg SI7ukO6UrtHdNbpr5Av+3n93Fs/zvfGJe8/ZWV1+TNwSn+h3jjYtXfTw3n+BXkfDq7AW9M/YtHki naUSvjeIKECaqGHjXrm9DOdKobSO/cXW+5v316sKuQgSJhttGZm+IkuERI/Gx5Help7BPbCxc6t4 3MHrr9Zkaw5x5eoDOz1f8PuuEzK1mNLbSYQVB4xcWqq42AsnsigEo5qP8A65+rldUzl88aV5jR5J jCH6ECdCrVDnmaTaosMo48GiCBhrLF4m526JrnZkngfftmY3mDP6v+5Att0JyNZdhAiatSsyAE2U CxjBQ1ZCfqdQ0oG31Q6jStiZnRDNf42sudr8vE0O2yhqzEamVWLmGjhGKCLeqT72y0wng+/G09rt 1/tMMcMXIDzEmAJQ+iYEvDmqwOGNXrRaKkWYfNjagleX8HXTWcBQDX2hDy15Mn/LT9bPFIjfOoO8 eQeB4JYdAEoh2DDqeoQKfveiZfitimwpGS2vtJ/5TDwDnTLqveNr6z041knk98j4bPsJNOBGft67 BVVM/kW8JpOctOKzqSqkWkEMNF2i6J5LOYiePn2rEXNzwBtUMb2P9oUr4Rc9qc8v67H5Zo0d/lUf uE+HRzp0LxdbybwTySihvHSYqnksB1vfodYgafoSsjL2J/Lc79yypRu/f4lU6ua3e59NV6lNG14z 0Fqz2Oqa9ZQJ4yQra6S7oNTYZiY3u/LEZ8KbfyTg/b53QglObDrKBgjKBgQXik06pWSEwKoqrxP/ AyVMvdW3pCY3ObCfZveHvkDYwJMPEikvoIjI7R60pcc3/mWs2uqTlI8YgrltubCcesyFiF5Zpafq 5D7jYFZ1J8+tChg32PSdCufAW2zRL9gG8dk0x/4voQQvWImQoc88wA9ZL7g9GlB78hXm1cLoH88A cpJUslCOvuhn5OWdvct4fj3D6Hjb4WEbohjEuf6Ae+QieNS2pUWVlXXoi42z28zvEHRV9QyRoAvE 3tFMKH+vp9TF7IOXaMGyEQM4fVmGezc/01WhfXSMTpG42lo6cBhnavebz+OLLPSYiY4evzf4U8Ld 9+1tnJqowlACpBmt2G50IgpRsmCVB1/RDF21LfJf4m0W/ii3bZFzNEofyjpzXT4DQz6IqCIBW8ap DmrQr/Sz2WlVTZ6E7LHM7NCnAHouJpNBkhzgbwtPulm/Zuug4YH4nJPVkgb69tipl4cs0hfnlgak 3Qd/zQ7Rz+cX5G1rJRf6c6CoAmbCZaroYwaomEpKDqaUn1KDduQWthjVN1oCK7kzan+jOSF0zDaS 6omPS2yTnCOmK+VZC9rIeDlkQ+XoUXDlDV4K2i4Kwhh2zxDX0ZKPA9+ZvjvSXlOWddA8XoqQGiH5 66BaA4ShGA9sCZ4N65kjBRuArUlSgKQGllKbB4yDEJ43tUgfitYYzC+vZ/i3v/VkW3glUJI9EJa/ 9rXGgoLaxINfAG2QA4f0ypiHFdZ58C9UlsLn5MVcpJxQGVZETpOnFcBL9t1v6AsvyTuTaTLyuCja FUjOmAgpWyUkNGqn/OZhK0oqRdjmb9LznmxhEw945e5g0ZwDH0zYS/hOGM/qOJGSs/MtqAqHKLWy 6Q+6cCpR1qHPLkLsoD7PVzV7fPsV1CiSNOkU0l+rEQGSEbvAq8Hno/kSlfFTwipDHTwBZ9Lx6qsX g104CiR9y219NAyt6Dh3JHYv/qxj0LLFfYlKWs2lN0AE5Sm+srkd5kKwUzTwDl1VKmhtWAFiF520 d9F5xOPwPvuFSdU8MDQZhCR94HoVviRgUflZFFW0CbyESzrxInqar1sXW55C7LQggqrSwCEme5Vc lI2tekdvbHNzkeOMq/A0BmCJVSismCRDY2LvBRxei4ip/oHKyRh8A3qZpBes1IDnkklYJffjDZno 35ML66gxlD9uZrROR7JBY1/MAgo85Spb+gEK4Bp61VMeX5LZVzfdvbtv65FHdQjeYP030yEDIsNn hzc+v0joD7+in9V8Uayhx5P0wn7BTl4N0P2uL7uosnom33pHr71zQH8u7yfEKALlLzSFYtJBv5DN EkACUNfX1vOinXaJyVUuquRONbLCgy66gXD0yUggTwP9s/CX946t8YrLDyUwtj95/pv4rW6mbl+Q Ucps8vO06c59pbOv7O72TAbF/vz5p4GXh3ogPo7hgdnr/Jzbo4Wpd1Rk+xqBV3cVM99JJn3WBgNS 5fX+79kaN3UFsdhWtQVThCwelygz1n+mxh1Z6YHBu/QDNaiOYbSR8sqGgNmbiRo74rZGS00+NlmU GBBZMLEvyauTubd6gXBRWp5XP0mKJAb6bqSM7GW5JhsUxrdWKrBMRsGTKRaGxIkVNCf/5x+9BxfG DX2zQhbvtPbxFXSiSUaqNCnFeSjFvYpKkdaT0fyCrp9fq48Gbg+s5KXgx1PJAy64vSMalPaOjeRZ XOMWH1uvqcm+bRnJSiA0UE1I0uRHevUmSV8KwMhAWqzaU8pcERK+xRoLAt9nGSiPT/8sW5esESmV VOmXNMh4dfkjARW4w3k87EmQc42kx1y8/erRGcQHsmdE9jIvanHDCAuFJOTTZLGY/7LMWKjnm1Fr BtHH6F2etNly14911zTKVtYpxlcp+XZM44U87yQnH+heerOtht9oXoNIUlHOQVl87oVBfBnUFuuO WgYJuDl4Dqsu35c9OBEvW+Ah8k/AXXePaBcbQ1w49MB7LHt2szZ+/mUG0x98HCc1CFHhxX9Hsfyy QOBdeo6s5Fc/ei9Huo0RbXFAGndIn1BLyjr1gIXLRY6uNBxupkRBSRnWb4oQjvIPuPzqZR0g50x2 W41kSYdRNbauatiFyiKqtouhtSI9yuNn38YjlFrETv/TbyL29L8HJT1HZ00NgS1xhSGjoVPZ5Wct fCXErV9Co6OxWAhFO/dex2hRAM6W8AnERIjPpyE6N/Lw3MHQTDG8F8l+oOIQjEE63slUg8hdFQlh 7ZhLKVja3BNJhewvuvJVbC/gAJoTbkpsrnC3APMabFzx8mKciv0AkWfE3hWP697JtNFpbsE5e1vF Au5xS/12oTRqnuS6LsT5kq9KQEakTgg+GGvttduqH1lM+rH3bTsxObj4lt/pp5dll+hMxPfzEF7z 099xnUNVU3pfB1Cq4rfDNgato1VCfajhxgCpz49BGttxYzXgReE8BGsvKUSQRUPPvxRQz25My//W D0hHAFW8PFM1V48gEJVl3p8KkZ8TW4pBfFYZSUiU/3U57/VMzKvkzUyd/v3w79XzRcuHNSVrp92H Nh4hbC4F1Zvj8DnnVBSv6ZohusqGJjR70LR/Mxu8soyXnjqgVsAyvgvb9UdK7Rs850X3m8CZsFeX twwGpDd3PAH0U/rsDA1ZtvAvSz/kYRzDj2QVC00b3N7KU3QRpH7NQDLwSsM6RMPXsqTU+IOm3zHd 4lfnIIjDmPIMqv4MiicKO3H3kJ6a8d0d4/NBxZ1672c/6jVnDcBVC2gSQXdWfwKlp3HS2iF3sgi/ Ff8T9cBw99ZPRZ5OJl+L84d/phnwjn/ss2bdaLFdhrmi/IUR47y1w7j1U+9WfM0Ek3N3909F4wwq Bsa8oduHV4y+1gXwRm3OkW1hNFgLqLc4VWN4SitdOJzq5RJU/W7kee+ZASKmYqhQSDrzMSEWhvME yuVAQ4SQPGn/cgirt/guQnhi9p0dAvuxE/CszT4HFeQl/NOvg2Arx3SQNECby+7kONyHHMp2weXw cZwyzuJUsOxMkCP9V264wz9xVw2wc6uo3XDhA5VA6t3Ug8/DbY9oMK7mNarE99kPhCQLgEUqd6oG YjH/ZOY1vvTkfFMoR8PgbCNeHN7AF+Hkj7EeFPvVG0fps+H4caj5H49UPZ3evHCvQ5XnDElnI/L0 Q8KHWpFmMmvQSD1eOPyIbYvFl9Yv1DmAGpd3fTtWKa+D4ihAjBrAifRcn2CuJWCH1ePeYMNASs3a uje+Je6cPn1tUqTPqbr6v8pRl7twcDTi4NSQyocTYzyfpXLMRabJ+zgY4/aWVzShOS4IP/0XkvrG WTax8Oa8IZdH0KTrsWXBcpu+ydxR2ggj7tGOBEOC1i9df3zm2Y+iCUqSuw1xFP+mrVEQzAGFrNPh lZZkeFB92tEPT2fq8WFsUvnJCcvcJdNGlYjP1C4tniRgzohK3lh+S2ci26aMIteFkdERZkitxi7p FERbaETVOM4Pn/qRnv0nDYf1g9t/rAXA6UrrHjcy61xr4F3iOxnJIw11u08ZuCjCZ3/L2vwlTHVZ wcJFrOwsafW/hsqJt8SBYpfRDHVrTi4lIEOzeTKgMcVt6UWqB+ilbRvIqS8TE//O9PQz2/B+9cHN M8Uq+ptixVPFby5rvxRMHnw83lockemqGPA5tS1hHV0hTW0+6+2gz9ipvcD7f+IxBAVzWHWOTUJG azsBN05iMXegR3gw0uoDziad/qmgLPpYlRz2i6YvC7wbdl5qrG4ca3SG4B65VWzKiIHs6vHgQRPO JoYWboriBSYqquinXGCcFxT9tzcTAJYM6g+Tgjr3DbtVVR96HOw9LELiP4E+lLBWnMSzFThb8WHq b2o5rJ25Egs7+55EqZbl7uhfk+XuqGHsV5uc0JUwgDaQBVla2wx3atJ+7YTjV2y/1Ja387Kv+a/C Ymg1QHNw1yXfLWbPTrEQ88IoPKEPYOLE8etFIH9g5mFgvhAYBb8WC63qblZsZt3i0Zcqc7mMGX0d gkIVOfBp0nYSGV0JpAMQpe4ABHuI4PaOGslDG/FRKz15lCULLI8pWPfw6TXgJa3O354r28dbCGJO IMYQyrxGcuSqNbJ3z2b3cF7tLZRsTnQHwlQsVHog+NQbNb+mJgPQ55M+FQGZczu8zut6q5OoOfaC OnZsj2SyPzXXeWcvBP5af5e07lT09jJfWEtKCK9IW6gvn2Pz4dWUcZdr7q6EVjd6IQUfpzmm7U4t jFy/yzrojuKflOxL6bCkkrhgbstQXH9p4LyzNy5BIdefn9hStHk8q/94d8XEyydI59yurvGT40y1 Z51VyTkmGyb5Bf2joMbhF/fSh/NkH5cOD/nJhtacCxboBKKbv9EiXCWPOBqQbjijBl3TG/07coEt 0lXjpJruYq1FX7gBRnzYfBmYvyaJTC19k8dArQD6lf0K7nU6u3NnrNSMIBY2Rs9S2u4Mey7HDlL4 DdsdaYTqY0wr8Et1fE/bRjjpDubVgoS7IjGrxB6EjKJSz5gIVzYvHdPhHcmgmMmFLq64l+ZpNWEG 0iJ4wtUjvb/urXZndS7JDZ3zEWO+nTeA23fmimv4NZYlBNDq9L0xYEGCEULYEkjjf3fdu9n2E6cD EktVKFWmu7jw6dglmh53JD5jwok/iDMQTFaS8wQQS/r7H9z+/aWkzQTCKsoiNTRceXlwwigvN//m ZSPlHEuEYhagcMZMk6D8KoAN4cQgCFQggH6drnknRK1gWY3H1cbvNz1HARlOoOipPqRheNPkVuTV +hPxZkv9PI89QbIrsSIB+VCs6rYimkiNiFKfwIIDB8ccRNUQGX3/OqoXui2tysIuBvt1nohXLlrN Cg241cr8VKI3c+xq/YWCC4cnozjLlYz+ynnKT35OyYjhm+lLFhZrgMhj+eM1MpVL86tb8OFBUOUk 5NZE6o+vvFowQ1QyT2MOG56X+o+ni9/Yqpp2ql/6WOPlrPGqPq2WUAlAABaj4e+su7kdxi2bhl9d efVAd6UM1/zBR79xTu2SxIx1XtGkhVV9Ogk7BTBzP7j77b+FlrvhKmxQwoDtbPyARZ/T4knYoeQX D7GEwdaZq+QxZCnlQHBDO6a5rYg3PXVnVkecnYlyxoFLxUnoL1MdSMf60dIIeYGfBqgWP5X2dXuq 7OywssmgAiJYPtk2I5ZE5/5LmHeKbwqJAdmMxtkecIQ7ZRFkzk1PHfbymK537iiG6PXbQWUh8UHt ugeunAdeOtihlC10F3hO+z/JAcwJ6wJSYCNcrqSXXmDovDziVLyv95gmQd8BqdqUGVBHOTz9kfQd RZ/BePEbcqE37c/1mvh/U/m3/WBocCZaGgN8IUtJEjlantZLI1CG22VDvYkwL8utLqyPXgsZfr1/ WWMbRB5tfPV63oS1wVuZRDIvlJJsLTw8fIo1WpZcqVouk56Ry0NEvHfFyF3aF3MPNhVP5TuJldgF kn5g9mfQUB4luLWqWpfmdiA8Md/inOgVYut2mu6RyLkHglpREkgtHxnd1Gsep21cG7r3l6JUjmvT aw3JYDqBtEqHZYb0Pr78vaMS3u9Ab0BZooVasu3+nu6NC6Kg+HUBjp+KrXXVHu+5HTPeuFxvlJ34 r188z/6focze2Lv6WgoqkKw5/x03RMgq0ZFSzqujBE+70xBdKVv9KTQeNGnx2EMDdb9Uw5Br/Sj9 ggbIVTIz1HbNGW4CkVckcv8iSvu41PuIsBhMChrnzjIU73jlauUnFg3mKDOcf7JiP9+VYCAlC/SD qS6j0q7rUvGDkbIUf0tV36LRvzJlkkT+lK8z4Kr0L7BBchU59WUl+Lxsu2T16UPpi9SUuYW4SGIH dgrY/9lG3lLnHzPM9dvbl+3qhIcwq44qtBKZJXxX1ALBFnXCgeRxjfAEZK/+zUu7tTmXadsBCK9d ONZiHHXWmZRp9eD2WdQ52IEWk9un0jmT+nd3af6C1q6penuNVlm/WcZfzV6qFXwqZUCLNhYn5RAa 3mcjGt7OWKEed9khi6P5eG3HAHzJNzdEn3L+hOUHI9vU6dGq5sBQhqJp3KF9Uj31Y/Q9tqHtTDGT wc2D5vd8kDtjTSuGMXQyGxpNgge6LYBumW4JLPLIdmOq8JciYbJw4N3wL471s4dXwvFWiUFbElwd pITChgb1bGApnDYVTRiQ8PXzBmD4jOa5NJj0XYib241eqWPQx7iOaXNBsWWh80GpdvfMEbAgQY4+ pwHpi6Zy526Jm7vjvrPXGmps458KfPB5ZwrTHWlhhXXHPEl2XAf7aORUYMSCQl/u3ZU6tPvqf3PP 3uyEIBCoWmDCkPocL+991QsbsdScVRbqmxYWvmAysm1EH1rZmEN6nRPCQZNTcO3BxozaeHHpyxK1 1nxhylbzkqfQMR81eUcS6pz7Mw+615/W01WFUSnXRchS0FHss6cet+OrbxI7gG5lyZZ377PdHoJ3 gyj/7TL2v7V543N8PUfAbOoZxoaZajjC/olIya4tQ6RGF/dj9OS410oyUpg/+f3ruiGAN1gtebdU Qudx6HgFfiuqDKMfnJd2vTAZpgDjMyoRNSO4MXHjH9R3YW4XCXAQm1e7sy0FEUyx/KRy9xL2G2TD JL81EndbBOiqW8N/OwC/ymA4sftUHfEUTUQDIP60I38xLIJU0mV8x/YohbA2h+SpxMWPfBuhlw7r UE4LWgxa5bzViSjWTXL/9aijDUKoo/vSUK1+olKZpxVOzxWreDmM9fqdzr4O/e3T13qdu8WKOiGw +/4chGE7zWKzzuon+C4uUiFUl5HlAIq+f4ztBOYZ8fbw5r6IJi/7KcryJ2xWST/ESE1Uuw35isTV AZtX95XoYkxBrnVTQ+7YJHwJi+lu2TJbJCV1ZjilVphWtUIMBaPZv0G19nAzKt6YAzoAtZ9RgzTy ivMVNbfUcvc53Q64DQfTpkePEjlRbZBdZtYhE/SvvuRLkaoWWUrJcvtIcv9RknWjGSgH7z5k/lrw u8P2fO9yYFauvaHF9mMRSOwNd6WvQKc/pk9QrONfawhidraKY9dRLlI53pPeNsyKdXzfU8mMeY74 aoxqrAiMz5T0AyJYammFm3WyBLTJJpS1mfvSRd0KY5uRTaVpXaLxMkW/XyD29rocOEvJ4uHfIiCP xUmPYlQbcSRSiyU1LNn2Yf6Uhi05EDKkqTn2SnlpsL5nhyMfxtDhExAkyTlStjBvWzSY8JWoeIZ2 OgGSY+Ew17jKW5fKq31XJK/XiktMDuilMnD+85HnrT0EcdpIQgw4Sl0n7CfNiMw0Dq9H8IT+OkmZ zRJDgocp5s5jUEGdhqzz4Vsl8n/keEY912ffI+HIwSO9ovrnaGBtQQIMSnQl94BPQoD3lX80qPSp iyDCUOCZgpfcJJeRWp7Sv6WSsSvgiKm40Do7OlGJjlOfJGGKYQiG7mm1XRXQJ3RXMwjRlKWg+BUt JDcPigPaEVG8rBrmHQWGRnbkTOfATmSpMlck2vnFVK4cFaivKQfogLDUIFKWVun4uyIvADEBnUss +KR+kp8T9hvNwzB7Zyu95NSL6TFf71L4PA//k9IHZ2RQHQMI/rAzM4PI/Du/ozgdL6w/vmOfrHPv SYYpZ/N17ccFcq+kXfL3qVjQiAevVRjzO/htiGdg9oMnX7tjYWR+yjjK4wT9zxGR76++i0vb/Uea WGLCYkONJDyM+uoxNh7UC78aeNOnQ8NCsZc48yXgS7GMvn3tYfdZNgzDMtMgK3uCFNXTRpgzzxwY XOlgTHJhfJyp4o6MVoImYq1VX6LX82aIsvgPp2Vr1y3w8KegOPXNM+HX1SkIwErSuhw2erqs1zsS 2mHCrxD82/Ka5xZG4YmlZAeZ8VGLr5aD8fNClaT6RGSyPTuCsX1a87QCQT5P/v/fNuiu5p9WpCPU Xo8PKKfkGYd2FoU45eBkFmoofE4NIxzPYw3KXGnKkwrpfc0VEW/prGB9KzT6QTZC5lPPeg0OfFSM BC2HyqcWz0IjLR2+mH3uc0+cV0hBv0X/lkPkw/dDWnrnK4iIdOudzrT+9U5XFtTe+/QX1RJqIX7I q9alAhENh9CV6KH1ZNHIBoFDjOPtRCREBTKrr0IgqLyBuJc/sAWmOrTX0F4E98uXlgaBNUDKPdmK kt6O9e90qBTjScurZI4sN8awlYs8+99K7X78bIX8wnDd8g1BRKhT72QJQiP+6rxQNyMm+ZmOr1k7 FbxYstpKGEUwOgpk3AWvRquthi8fEalqBFcceAT5vFGDYSCbBbkUxD3u4aekWjhGLJKP6OjXO5dS Dt6RC8ItLCoy+xlB5oRf6EQnlaJzqo/MLqKnW8TMgq+lA5Om++11Q97jegfPMttai346jTS05Vu/ Js8A8hZASVaMUhgfJeA0S4MGBxVh6sc/TRQAtslu1JSpplUlaBZLlY03YtJVxtfBHSVfDP8Na5G9 MSxWVlz/GlfgS3zwZBO4RszRtssYGqtt3SCrxBxZJOhCaGE0iaTIwWOZ4wVwMCJt/4ijuErKTqx+ HuGKARPR8Er6slOlEUdCj00tHd3FUJgCwQIQeuyVuoMf8m+Lfd9ZLC4zICQkRMo0x71P8aUFwmPD +ByLyqCOEaKno4mWUaD9Zvk3x/He/lIdbknE2wmJgp2CAK8/6wSkpAvMonlKa2Sxe5wtS9AEgN1f pYDD+8oxNq3EFAFLQrQe47BJHsV4oxx4VKfe+a4sJwnZo07DeviajsEKc9B7PsQyrGYNtuyOLC1p admJ9XcjyPMNR9yL3oXYuIUBmajUMClA+qX2wH/Qi4eANyFXaUUYFtHzfVHQQo4GY8KEXas01kRA RitQhsmfNRi15nUgkAK8YlAp/igj9UG7e50pZ10h1+Tl0NVohf7SBMGGRNJZ2BknaObOHZCtrsBh JLHmTgjiFkAyPagfZ9+XI0jNGU1hp0Vpz0OUKjI98PpzlX7mWMSfniyo6eRedJpV/CjvHw8WKrpz NHDcbhM+NaUSvLY26HXzj7gfnF4mhcOO0vyeJ3i/urpSQm5mJhZMvV4bIr0dW5xiQ7Hv/MYJ6b/h lbd0etk5Ngu4JyvKhuBcLteIQz4tPJgEuejKuBCMwjve6oWNWxv9H5X7kc6AEjKfG8rPF6r5jKjP lGCrNpiWMlgCoHYoRPmphcD7GTEz5LUHJduvvAHpREgtu77N/Tv/BkS7Vk3S/yEWNERNjYM9p/G5 GD0Q7l9LaYXaZAWMFqA7oGNgYQm6k9HtkunjjdHrTpWtUCZkaUhZXHia2nSqBP/rKdApM1dbIAth 2A/Dt4aGIZ+2nLtJqC/GkPELf2xTJsAKCfbvSAeGhLyhiAl+nRssGkatr+87fst5I+NGNkYafHdY oJLl9uPgaAdAzSzx08+2M/e483XEQgpu523XJF95x08aIgcHfYEeLODmXRkZdBM5ZOZmFCKNPwV5 85p5Y154hlFRNDwI9aQ4VX+8+z8ZvwGRS/9l6DFWuRIjQoGXCiJtIk4xEPjV8dKobMe8JEbkzEs+ 2vGh/YgKnWxdXKSitY32TFAKzhSTXsEes0M4CYV1+KS8BpV9UQ53KzS1Ou9GytidbYHBLeuhNKpC aaNZxUpF9aNyHYAEXCnsbLi+6ORXLIIBlaxd6OKxp8DCLOy5xWNM7LnolhSjiAmDWJFQWRbTDfFf nq3wrOaznCmcj1xJDYEChBrpFv2ok0UWQapeoC9GkSD9WBduf6prknp99nXUP/kVi5AvdtiQDoVm dT2gZT1SYNxRSNKj54zMWi1ZI1O1OAX74dVLmpFYwR6GlpV1ETYVNhtFN6RLW2xxE2TCDoyyjkL6 A0jeJDzC/sQOxv3HKrxfsBwtCrGJCUGpenFeAoI0yzRIpiXM754l5s7KeyBfovb5RTIhQkW07TJt m4bo9hca/o4zBYAxI7Smfc6/nnraROBKrTnp9LzEKBpwEoZFyE86YpMDUyZZRSY4dTW/FxqbFRrv qQ1S5YmHU9XNNAO9v0Yc6fvIZvf1K6/GiVxw8PXnnEMXATLLNzyY27RgWSpFIFi7o1QL/3W4ibEV ZZbVorHLzimx8jFNXoxIAlCgpIoglfWw4EyHYIwWDk+gUYJP8aK/eWdvZprEiNZSjVIdYoVHs7h2 D/ELi+BLQtPaPxzflRbb0KwDlD0eEF/baIhTZ/AfTY7Egd6N42haXEmxkkBmXk4J3+hCBjprSeyp YlDP7MuPj0j6ym2TkAKjPCc8+8nDBToBg/Cg+eo4CKGmH2YWKoba5gHS+7peoA/DUKzAIE68kcgp yX71X57xYublBxUUtiGGYQmawFcl3XuxQoqQ55nTOL2bofWNYmEeAURu71yMjS0FmPVrQRY7yKyG Ek5Zv27TidTeJHRgz89Z8XVCes3g96vNZ9fdBEJVuLE/H7xEj6UYDEuADO/4zN2747HSDGgQqKms rB0/8o0WWBbWSHO4V6kEzGawok0X78u/cLNXGcKbcbOEpc2P+tYwJApxnoropcwnX4RbUdGxBbA5 TKF9DaBDjaMBZ4PygoV1O0Wt3qElPS8VEXCOiG91M3pMaoMVBLaEvZqN08jQUcobg+33eBKKbPXc b/VmQvXhsMuaoUI+chOmPS4Hf7CUEJg9Wn33IzFFIkcA3keU7XUOdB0ayt8kxpkNk6O2xV0MlkbA Uzpv7HeO5R9eP0bGVNKh7P5HGE6ORrBGgKMITuxVOy5C7kvRn1zEenjGSVMVIc62pZ91swSQCoOV 1q9eDol43rux8bCg62w+vhfJxlGedbd0JYgtAUFIB8sW72iMs2UfC3MHvODVy3VurmcGQxT+LkUI zCo4YVzNCo7fYjjboAZjHkn5cRCqRijBwzok77P/M9CK1JclX7NiZmZjYWHDgG5DbMuN7NIh4EUV ni+J3JbezceSerBSrZ1lExtOloG3e3WdS4SPEBWDwC8sMWrQWQJDNoP1g2xEcTaKwIoQwxqU/98J li4Qplorp6mIqL+VHmVeMB8DWyQ1qSExilaEhCPB1hRowa/hXBG5KmrtkQo2kvngWxb3AwcyGn1P JU6Ur8IS5/KgJoORWW6Fd0lY/Lrd+1IV0KLzh4eHMZHcqO9/K5E8/1YS6n8oGHsznnvRZ5uozwSP C8MtqcP8okYuKrqer9u7OM/a1Fvd+7BGssy+2SBvhDqP7znm3B26CFE50E3JLJ4J28JUR7ox6xRi fhCHYs0Bhp/9n/Rcno45qXmmID1F57H67C9Q9v1toSCxpBjWzwKm2mIhf0YpAlRL2GkIC2/kAfeO SQjY99jfAAL+5L9v4rdasHI/taDh6dfPJuVhDLzzWYTYe2vw4jWDZfMH8xUlc97hIGu8MLUnndsl Ige0x7Y5kPDciZ/vsTNSKtj3FvnlduJPTmKciArxbEQ7WaIvPwscsVVDMvB/F+hjDAfS2aq+I/SI 8u19sD29eb5tfFZs89h5htIfXKDER8ZaTOylMaZHk2unzc5kigE7w4M3+9R4VpMkkgPN17jLwb/9 CZ6emk0eltTj8tr7VxYXsSifN59MJgCAQDYZmn4I8m0L5LvMDA3OFjc9XblgBhwITZZFMutiGcaU 4j4Sqrd20n7fZ/LQ5y+zavJAs5TJvvGjXjKGTOQSZvXoeYpz86JgpbkgUveQQ54w3fZC7SX8ofvV pAHddnXk4qEPItq52izvQnz81rifr1afKH9A3cGrzw/N31eRnriXniAnTwPu4lvqmMePA3230A/P N5zrF1fP38Jy3ljD+YQirtPslx8gYsrDdiEMvh2joMvSdvcVI/xcpP7Y2/4oTnhxktH+DAU/D60+ Lq8+Unb4750TfQeyny6ePjrDHz5eOzz3gP2fb/yfiNq1V26bKZ9ivKm+xlpFkoefh76dBhRM4vxO QUXef88/Bcnqws/LPstB+ZDZxvvs8BzT89AMAWWIPEJWfW57iEx8TteJnh/Wxf1v1x38LlKtJpeh E0lt4W7tKPxY/ijHPnvKWOIPpx9W72Nmn7dvfCHgY8ebYyHa5UZUwgHePmp599tqZ6tBdJF0gZ3b dKdMkZ8SGF31sHSCBB8/Cnhfxsm3RXmcL676PUEdVneuV1r9o3btT0Tnng+wMJfbnnH86puhTBVu 9f4LrZ5X04vu48bu9fdfXG6njz+Y+F5NA0x8QQBQCNxyM/jpcB4OM7r9TnNtF5zxSHI6D/a7ntcb pxA5AsSI3c0DxlcAlKIeWwCQLz7fG5HT+WPfN26UCE3qEjdj0jF+/XqYdSael+P+bqesjqfSfke0 zScXcd6Uwk/U4o9Ex/6Hp+r+d5PAo87R+/t60NkkqO1Z42bu5bV1PIeTh0ui06cPL59p354Ve9Ch 9Da+2ZV/Ho157BG/vz47Az30Uj6tP9+HUSKRN40geYOgf8EdTwCxi7ATT78LcdG7Tv/RTv/Jo+cy IMaDifj9+ebNYVwzJgDe5jLbGQeD6JMwMScp8m+W28hz53qxVIe40XPttbKC9utu2vqQJ4jI8xNW //Kj19OK94kvRRtmsPyN/b3vydcxvBPf59OLTxDTi4cwytCY04e+42W/glXZUMqWfaB5/x1wJMzB 6fRg5fm2pV20AXqLtD8NPNFz8LcUuxa8P024emoFiN82iHif+nbcU/4AmDyujQGaQX+AfWvjING7 eaB6NwAr4676GABnL34uKShw+TRyv7hImQY0vITu+ZHZ+1utrVT4brPWU3o9/w2h8L3MoaxZVH/s lz8CblL6tDU1Uz7e+h5eeJ3aPkMN/Ry3gCY3fZTPHv7b1zvuMU9vqo7Iv78IbMfVzYY+jDDMo+Vv u5g35Pb8TXDy6eL6aSZGac9ds+0+d+mrD/MvD1GdMuiJ1kQ29Tjd/47kwcG/+aSTl3EKUDVOpTnq uFq5KbMZt7RvCKMjceX5tRC9NiWFS7HvBWXRoZSUN1CfnDNNkHowZY2/N7fX5a5mDd41ORliE//u 7937MJ1VcZcYX+SlqJ7x6+uYG8qx1I7ok12mJYqQo05E8uO26+usxW6zU+caLtKL0Siv1pVjLBGy 1FRBIX4hdxeO0BXaGd/x8RsTPrgONHNu9Q7VG3YzZ+fKxjn0FtgMbr1ASGSa10Z4HKNautD0JPd5 d38/nnyM2Fk33u7PyhxapJOgY3f+U+f9bXljCsGr/iHOdp/ZT38EXcnsT7yg5ce+c+3tzff9QzEi QXx/sHreiLrdDH06bjqANq9DweJY4u5Z6Q6rVz43TE3Os8vqYtAtxoyW+7VvLicrwichIwnu4uHX 653Nq56QAeETH9yjTnBr+z3dknRfM5ab/3HLBf86ivuKJwTURfvG7kTGe1levHf55TMre6OrYh7M LdhnBe5PO6Cua/5n/Dr3FejsrujxoZgX5J7TG8nv6tMu1u7TvjeW3/OQe/vFufDJ0uPRMd7KM3DM 5ILuzguSnkGRNDTtypRWm6102UYr33vXpaw3k1Q6xJjXmZAgH93iuD3483408uoqXZDLrdfV63GY RO/h9mwzpuUBpm91deXqXLPhsVe4z9tn8/D82D5Xc45K8kvB/Rg5VS33hkZBvva0D2mZAwJ0no0O Lvq8EqH63cNnV+JMJlRYty42t7DH1A/ab3KRjkYo1TR3t5Q7eFQLdwKLgqC/GrEzx/ZIXHpxeNnG tZWtXFw/RxSj4utI3cRknU2fFP/RWdVZDQEUUa/r7hIuLQVJWzG5ufsx1NElPvj5h1soC5VkW9Ms HslIIacNlUgxTaXzamHQJ6RHL4QiNQ21FZ60eZ8tu+v/GjFq8Xivvb/0AtC1BhMmwqniBRTNiIUD 9SYDs+eK7WNqdXgDLPS7d3m4yn9KTQIAMza8amBHz8xykwn96E2X9CGcYLk/sENOzFKTlzCiSRtc b7IOSILWPsB3qGeAWkTeC0p+Qc5g1CpCF1JQOcUrQslI8qRJ2Nh+y6VasPabTR2bi10ZnXbAEfl4 MrTmCwmhObOjjCmbubW1rzXzYKl8su6PytI/rCKEorjkhlh/qW3t7HxFydzCzYzwe/50vaOhDf27 fvVniP46PZQz6eBybzIMqw+LUuzIyZW/fLL8vV4DmNdtqz+Z9jvgWNgZvkXIiUFkht9ta3hu7mOD Q+kJckvDSc3BnwMVUAnWSvc0UvvacPL721Bxah8hzBP8UEjX47FhyPhFdCSg+jT906eRoFjz0xn5 0UhxOMNbBEB02t7BAbAeCOkETbtvDZPctjKKgskaT0L6QHtP7EBGUKPP+cPAAGsCxMRj/QGa8PLC SVseqzK45az3bUwMVgaooYrnG/R8YIixwkhQUBBlYZKRsp3NpBH2WVQ+O6Jl14gVf+iHmjYIS9J7 rLJuJ78J7g7k9tCAzkCosUC1yjUSIuX6uzgowHHMyIqB0AttCI3KqRM9URONayx9580euvqe6LfD binT9blK8/DglN1oIZ31HsvseTuOjs0dbdgHWXnYcFsFcV6qFyATyWdpkVBFPXVpDyCTdQhHlPkJ z3Pzm6VDs64ZnRsB6/7C7jvBuWdr7/SYlFFptAvRZyLs4FjsJg9l8G5mqjELtFP10pRpDwBewZ0q gNHpB1koOxoRLZzuK+v4hxJQsFkonS5e4uqwVHrygbNMUsP4x65wJwj30gKFM5mzzuBvfYDmnJ2d MI8TebizOr+TkDhBIp64bh4N/O8lT9fYYq6b2gDfUTz50tX+ArmQMWMUub7qczWgV6lP8OCmGmvh A/PZ3yVS1PyiU/6CLwuzR//DlNgWxS3nT8HH3UIz/YiPOKy7HLQsuvjHN4GuVKqU2vyzJDWbsL4d SpqRmEGC41bEYoSZOawUlNL3mYVDSCD4WOjaW3yYaKrpvhgySQceik8hcKf7TN8jjCfdO5KP+2CV jpLvjw/8JLLHARkk/jv9OLfqAlj5YhddaDfLN12+8i/JhihKUgewV8YY/CucrT7FfXq5i8MEj3e6 Ojh5Dn2Oaa2HiclWmgwFjw0wpOd9eIsD4x064aKepsXYqsj4Un0BNa3LblTIvxkYQjRJ37nwo5D6 Uymp1xT8RaYhgLOX2uqTCWbIpTbjEU+IzBYIwMmxxI+K+PEX/emwWLhajjzt8RiijXT1uNLqdr04 b3u/WczoOwsu+jCdXny/dJXmnCGkAyPEb8HHGzj3p25/383gaCRXm+4kR/Xjwmx3WTapuItaadYo gtbb/gLT64+lnY6VYcapVTlWa7nphbaqvHPQd0+m9MT4Col72/bvPtjYUGEXbWhjakcly//xKmWC /+NIHKyr0OT5naLbMATZq4uKFiOAylubIJGVhI1ZkI4IpWpemmEeX7YLXR8+3FhNefloziTknTTv iGUc4tcgMmW+dmmXmvIkmfZuT5VUWQ3DmlPeaiYhITl535AxbRyfa+hDCBM2bgNaI8XR6YUom18q cp0hXaVW4vCc5WU4prwpdbyVOBnKaiiXeTVUyvL91DZQIiF8R4OIK2gysziPlrXk3Y/Jn/3GVnQo HJxhPlbW+j7piQJoUiq22yv0+sbs/oR69qekdIjptWDcQ4VcBgMIYGt7WzB9NMKyoLo+CDkGbksv VuCn3o1ubDwvxNTYeL07Ak9KJyEJKUj9Dbdg6qTy2cAoh3OdoKIe71PiryAnjeklsvI/CFcfAzvU QRncX0mLvJljEwzHEENHYFHCu2QkxkStvdTsRy+tByYLGCWTlTv7tdSshFAra9p4Urd8BxO3hxJq nOKi/ybmb2IGLgb3+o1aqyjUAATPyLX5qhYXUgy+l7QSJGcyA1iDm4paiorqs4mkorpgJHfYkFJv NCn+CCZ8aEsq9KWqlnLp2Sc9xLay8a9bZA6A8ypWOE+uST1UovuMQbzL/FfbxyjuO6tZhMz+bsjH uPRACSqCadnCRi0EL+AQDh1OXAls2qCsjDVHRe4ybHKBiSasTqxHD5ySsqUYl5S/+M+3IQfv6Awq lWoKaYD6GxGqQqq00kGaS3Rhuybtxh/UUr/6WoR3J5D7xWIE7yz1Bnsj9XYpnU6YMhtpMetKfZYm /AGuassxFx1bdyiz24KikrcpIZGRZrcl3e6ys3X3bVzdVVZQCpKuq33PrJDFj5JD6ifDDYwFw/bU frxrkQvjTMCbBFziBkYl93Y9FPAqjg4PUtUlTSrJhY4305lf5VyctxJAWwl6VZRk3cLeZ9CidaX/ DAFvv75D1s/YWE4yAy+xrH9IuuhNluKEptHg0JA39w/uzi3jWMGKzDc++Z5ReIPG3LRJu4h8eZB4 450uOKY3I9/dfkN+ORHGxc4QWUUM+iLfMtV+vrrMJRtLvXhfZLzJXWTjq1+Pd29GlAgki6Uw7r+l c6Lmoa1H5EDmY0cCVe913P46rPuVf62f1k16Fj6hrbSQSrVwNGYBeBvuzEdH/CyZMKl/RPeJ0eFv cmDw8Hm+0yiE4bQx5SLtwoNyt9SUUkMzclvOXRo4oDYyuiU+GQRjXKlzHQBG3GAqRP+KmZs/Yciv Ws7yR6gDI02nf2gtBuhMX0BO4BS+/omInEVLIG8P+qv4zYOjLG4QxS3lltdHC7vT/uI1HIXEH6Pa OgiVMjboJsk+6CEyRgnfkj9izupqKYZJ6g04BDLC/JKMXF8oD/uSQJXA2kWyarMeWYdvGe+sYT1e yKJEOA4IrLCtdNHujbKa/dgIj//UcfBpg9cgUsYyrEdLfzePRmMOiat+4xrJSZ9Nw7TiBcQ37Hen tac/IiPNfZzTs6JbHnX5Qtq8BpB2+2bW0ysnDpYWYfTcgU2Pqwx2JjyGhydMlCHFScRrToNUdM9u porvHgxBouVXWjw9eUdO2dakpr5IlF1oUq2AT1yvd6YvhWxR00ZGd1JIp0ott3iJBLzTPUcIWkcI VFtJlZOA8RbNbgSJnU1obj9dk37i5inirCsGLOR2/+4MfFNf7bxODkgAcZG3hBIC52pl9Gio868s LLpFMLFVaAUBzMRgUWuyhKmVed2d0mP7zWhF3p9vOfqqLWtdhdO/UvHPqRiFri7N6C6rytvR9lrW C56dXMZXLOd74mzHAsYaW0LIiDh6qARulxL1s96nTnD1KXwysnNr3t9lvwz91ox0mP+DpGeWOegL u5KwdYC45JkSz5ZgfreFlyBCKwj2snyDLrSgc/Gy64uRhXXkO/WO/fW/Qr22QB2ciG+4xaMBRSxk NghtytgcyK3kad1zf6cNsaepjtFrkhXUK32r+v6aYFJlTzCW9GBONWZGxFoRBLu6dCJ0kFLO8Acz G+Gbtdbj/pR3nN2AU28Z29BUZEXRov9tjcOuYQ1CLuMNUpPT+tCAtkLvknTzy7s6kia8Ke/Pnz9V uC21pylGIXFtwqzVQwrJvOoCIO/m39sWHdJyFGmz5eUqmy0+p7NmNZGhZC7yPDtJAD6c1OoAkfOk 2mLqPG0B23OvahZfY1DMENsnCrTHGEz8CiVzP1Nz07z3B04g8IGvi5Sss6qxu/v8Ode5BBdLSipg 6nJH9fc6fAFgawRIl+P3uw2kR6gITPr7Y4dg4NFzeU3C093Vk4KnzVJcn1siGmYaPFGLunHOLPjB KeG64CQsiEGzB2dhiN3a53xia+FsQN5msvHJDMmDufFqy1saUjSGH9Bh9FdSH9nJzb12Un9FlVTk R3BSv0o5F4kS4gz0rIhP36TDAdcxrKlZE987vYYLrecNRWOCsoursODqh0akFbGSotam7BRv0iPV VeLcuw6xEczD1EnHlFD5BQxfS+tIuVo8pVLUxa/fJ1KZaAILmXGj4bs+l5eg1rY4BlwISlWhyfbK XLzrghmFUH1XZCfWiTXFPWQhjUGM/v4zQ64GVSST1GmYtiSr5fId+gBnK+4ozWCVAqdd4PBFvVH/ loatWOiIAxD4I7VN5pCeMSU35YJkNChpCdmJzafwXD8WrQjThFBgL6TCDqgLsNDXSK/24OQsZQvW g7G39DTNJJweallip7+QcoISapBNYBp4NXaR+goI/f4YGMmEAtUvrMUpktxFb3MQJDM6hutozryO iPSpSGpu8uT1JJiGQufi9TPEscrl5cS+JQtjyBUXANINzgOJnoDVvYocXJ5zcia6T7gODIKrU4RS PqO2oRpZZidstsDZoHsHhNy5cODNdZf1jhhvMbR1JM/gE2Y03DSOoKdmst1oWKgw6yDrhuJ9AkPL bzhGL0KHYSq5pKCRRkHOtgaAOvtUo1tp3a/RVL61+2hKUKQ6F8Om7bplQhAwZmosHmMbsq/SQ9Uq Vk/FHL6fMuRsvao/HWtsJlgM/Ox+5yFE9miaRWiiWI9Y6MwfmWRJ8650RFGVvMbBkO8jOoftKB/T svGy2qgrr1OdtvR0aoOD1vLQgHp/mnkAG1YuereKtTUbhgjeAwXJk1y3fbYQ5cd0m6qCFNgWht8R Xp8FfBh+eg/r6IqRFqGvSlP71ilVZXtSZXLUTmSxyHMZ03t879EB4Js1d6UK1BTTMB3EjcCGswoS BZE57AS0S2aE9tmE1KTQY9UOBrbg1jrffl+big9sInf/uS7/ke30K/kptYTtUkXr1Jgcv739KUWL jA5ol5UuLCd+ikjNhrJfNQpff8kcoSwLbJyIzrl8wZ6I8/ZiQLnfoIqOtiT2o8Pl+QIlu5ZvlB6Y i6vhec3l/O4tr+7wUKqeRJuk8YqIQB3C2OSDc3xGZ4kfz0A2YoHxSFlHFB9Wm4OxXEYdeTRiMKhu eyRzc/i35lrpm/WhqqH9AWZ6RqDAp/EfDnKmkiSdWP1Wm1FoMnFc2hhoLF6ayaWO8ZQbpcmBLBbc LfgPZMPcKc3N65lmtvqSneckU4kwFXlvKH3CuY114IoK98z8caH0W6YFHxQlRbmsUclwaVy07Dud iAXf57VkyLOHWyikxg8ZitYQxtvZgHN6sTBXOgL1vTjCuaGyp5npWzw5abr1sXCSbPR85vHLkVJY N0r3n/OSiJYstzIRE1EFKJgGU/6qmn2yd3F+FuxRM480Vsl5f+d+SNxg/b19bvFLfUH+wkDHF1QT JQykn9ymNhmbKj+Dv7MZKILCM8d0BRhapmnXnHBMLDYqswUpThMUv4dP6swpHPPVscpYTrODaiea rehLNZyrZNjH+VLZfstWJ8egCAoJoSrF3GUmKrz/+yEEMcdghkCKfRTtLmhuTsFVSEtfobi+4gTu XCapo7M24PspTRVq0S+rgexfq05q1xyU/W/4/26I6qwEbQ9rfI9AhE9O2aoRIhk4EIlfdrrFcnx/ bkNVM62tI/1YmsaEHHEphKbhWlIEE8LN1aFGY0XxfYOtP10TjnqaVJilqnAgyCqmeCXyEUGGcsPJ mfusPJPE1XPFIzCXufAvzmy+yu93pr1NvLZOlhKSBVsqlCapGYnC5nKj8GOUVdGc5VRl/JaC3OdN i/ueB7KGhpx+MEaqNoBAvQ+aK9qBoLm02QMZnL0e0ezwe+iWt1ZccLV23LjKNpJQRpx6T35maTM/ WN/4E6If0VqvRuxsZHbAqoHGrxFfOyfh70tDZyWOH5j6VbNZKHnlgRNDRRtzn5Z7S+K+jlY5QMmu DHKUtYpmfFR9dmR6l8tSSIsXWRrwxruKPi0fl/aXrolxaUgeO/P2oyvV15r3GX8l4a/Yr+SLyz92 0hvu0NIqNOyJJQwe+pzwY06VGW7JathPZWL3E34kBkmohi0ZKSnXfNgGW8z46ZMCZRXtdLCqtAIx KRfxrdtkff6cWkhQO1ZABBI/3jK81oec9T+iPgxppJgF+U4OIi3cLbD+LblpKLaqDIBbKY+e5NNk aWy3kMy0SsIBenpZWac4ee7ktyPuh7HbNPN1wIqkzHOPw9/+f/v7EZ/7+v5oadE5zH3OCcF97u// ThkfuQ9q734+63srtvLH/G9ozKyhmHUNT7SPWeVnyspcgrfyGhi1NYTnuFIzd9amJZW1p5NdPvuI TIcH0nHMLSIrAUjMnHTPWUELiUVNs/0OCL1sZcnlsfWjOtrYjWdFawt/oSrLHCSeFhYl6Raeo/bf /RE4GbFPSRpjZQupBrUQUfy5oRPd0n45/Yw9rlpvv71d1QiUUtg3Xgv2Xzkadt/R5P6sC41/cHLw Q3D3bOA3gbEBZCN2vG3fu9Z441/XnBLdn4rPrbksW1nRD/FO1JNm0awGZgudqarZE3z24RvkOdZa 1i6Q+OaaMSius3wk4lr8oC2GX9f6VZwlbM5V16GaG2RA3VyUTGE1YGdtzQwh+HH8cGxzp3rmZWy5 k/ppxzf5046Zc2XEfkZjHL+l1SFf9PuPJbiERBcYOxzV2JF5R2rvu60eIJ//FO+XTtu0Q/JPFtp7 JKsTGKEPdPo+pPUnpaApXHvSofyvd71uBbm5n391QWp4AlB8tRBrEvHFcgikBjsGHOKLCsd52m6j xoWjCvHze2Y/bBTBtYhMsPIiflzy2MmiNlZ5zx/p+2cYLyzUg5osgkjuSK6WO61pEp/zh7B7+Vxy E/d0cMiUmjugoAoPjfXOnUJoqt0MwVSWWPAU6eDEZHxyclKdYM3xOevpSToM8R4J64pMaCvuwU9A u5D1t46riTlteRKJ2Oz3Hj3BBc25ubmIH4XZXQHtcsTHwqdFkSBScethHoAlbwShksNXnh+OPUpK w8XzKnq1aPg8QsNm5jm7f4I1PK81OfNpJ8MM4yv+6qGAWlpaUNyp7Kp8bGoCGNf6xC6+02VtTaij uDV9Y3MeyMTVEAEC6bUKf6RskffEF0dEFWNnK3m8Z+jPif6M1LmJo72/e+6BqGj1J+LejilYRuD7 J+omXqSiwJmj4xNI6voHloYCNBad+zPZDD91xXD5QOm36C7XGl9L5cNlKoNQiRlEH9M1xR7ESqur w9QqFpc3j/uSTw63jh0/MyL8SFEZL1yfwDem/FKMjZIWUnrUPQ1MzMfMy8c8K1GCtQuoSnFszfqT 3yD39jAO+WtBpZUA0ZxGJI1kwxmOjdn1HHbUYafZ7+6GxL7QW92/H0epv1p+Z3xbg24tI+6lihPN 3V1jKEOqrk7bld+j1xilPKllbU6qoOLCYIzlOFrQ4z4WPzH6/jG1K8DpPWbCN21dtxOGtO4wIgoW e3O+WK40LpG0rgKeWRXW2KXQM9m/+FrcIvZkYB7dSy3EUKTea+Kd9vSk8vV1mCcHTA2YqSdTPz2y sSdNdqJJNXixKVjZkvd+lsl1cn8NKnn8WKBCo1y8nVr5v1H4l4k/BRHTbzT1MHWqoWCIWB/SjBcS MOCZzETnbv+Yt/7a38GZQ00ojn6lnWk3aRYJeG/lPU4nR8R9tBRCshn0qdnR+gytry15g5JiBzax ixM3iTat8hvzAj2ZgrD79TdTN7gHFz/zTcTe8hF7+wcv9MP8AE2f+kx4Gt3tyOfT9bY21bBV4YeV u5uVk5ztm9W+y8eb+xXxBwq+tVGD+Zsnhlw7LwDe4aPqyaZaSuWXgXx6HwJhKnZa85XJklVPSHoM Rfo7c+Pelk+v/8OLjLRwOS5PWdZL8dGgtcnuKj8m1oLoWKIk7mlUuGR1/mo3p3nnaPDeCo9LLP09 Vt/H1oPx6d+loyZRLqVbZWI+t+eqtyRh/J8yfo63tAs6GKuubCc53BX4L7jcvnu8/AsivP4q1bUd xv/Vhn2pZu+8gPPk4L7mz+lkqTqn/50jPUtwSJK/QeOTo4nFdkGNGXNNTVe4/VdZXo1LvfKbxS3y eMih/qL+4vd5ESn25WzVS8OHKMwf43Hzu1b4cfYrSJVcaPbUxBJHa5Gu0Zkp5A1nBETSTdqdR7rB AWg/d7inKHK1ZY2mqm0iTuuyFch3OLQVYU0V0HawY9L/x9VXBcXVNV0Dg3vw4AQJDgGCu7tDcA/u 7i7Bgwd3d3cYQgjOBIINOri7Df6T53uv/qpT1efi1N67u1evXvvmdMnDO1wKU2Ec4MfNQxT4IiHs KucWTvl86/JRzagxHy5iZPH0Q+gy/n6a3+I6NnXvJ7VI/heCPiK5ZIaxqPv59I49qyK2X/K5lWLj TjGSAkfOLdZcP3E/0AXq1MKVBqAvoe65hCeIS+6qcLkYDXvDKbXO/GLJm8og8V5rNLM2cbltdhua d1Yu2KTNqZjY5CiZ/H36l/IRyBs/uFWBHadAEhUe0tJBPB2HF5IIwgoCvE5mTq/HLdkXk7U1F5MV tzUnczGONk3elQ1elAHaazBjPzX/WZRqLUsnOKvEYkRjEpBmkT780qapzc+hMjBetMvY8S1C2jVf ey+fv3U7tf1pNjkOi8vvNSzd9YzBKXZBP4H4+bBn7l7h8kt/0OHzXPXVZQal8Yvt5lWZl7b5mUa1 2rqxUv7TXAEXt2m6Vl+WgQQjdQWXIRdsGn5JRiHNRPYn87U6FEKlH7Czijrtlj/DYxtCs/yMYG21 cecNw69jWcd0eUx/ZgkYT1DpN58Wdc9vr/gsVHsVrbWe1nWfGoSBuz57nd5Tv/w+A3OSv2fV89rL 9ToFN2NzXw0gURhIoaGd+Vpu/JsL+3TlVSeXJ/Cy/wWrLscdfBYUBE5Joas1uIfMRFST67YeDiDl +zvvLKGx9Tjv2NWbtsulfN/iYDbyfC+ckbvoF3p81zBupC/gcxlB+HLttujQfiLksvy1nmrPoT2X 14XkeBDL6fG8LT8QuqHi9EiKInjQhnUGPVARoRh3JmHJgbwXkZHOyu84vls8aHPTZ1DSn/VMdIKy O4oMXkyRoelfNN+ePj9/7U8kWQ81HuuP4LbVZ/XDYWi5+HXmNBjklp3+DfT1rZ01C97/TMnIhTR/ ZPO79OHIiSFs2OA4Vh4W4z9uXdif7bkduUpUHAc3c/kstUSgfRG6//mzO71O72aEGovVwO1dHY1W gp0tZSKns5SRQQsrkta2EJpxL5OP4ZS7QSnhwg7lcCwuXY1bfhlOMl2H6F5Rs5ZWk8x5qndoWBPq Qp3kparkkLBbRpjAV0tOAyFepV3pqMU5a9ZP2UhIzy/vorkmVAK+ngNI4uOpNVeLMDli85dmRG/7 xDVLUBe8as4qJj68TrE9kAnGFTb9USktakhcWvE3EEVT+zp22QueviSZXleLfhwoEx5T1138oqPr U9Wzo9mO61GmQdGTGKOhbfqVYEzRx0fXyytQV1c3MLP5EY9RQ9OcQUKvPcV3pCuDEG9bGdxqN+Zq SymF4YfaKk47pwzK5IhoF03bVR7N5HDwZZU6oNnZVXV1nIFuC/Ug8fRytXs+XR/w8VXMq+Rzk3E7 PLRs24xWk2e2WT/kadWfgjn9bqs6m63YlJSNshQvUP8mE7L6e211nzka8fvRJvNMGXXdV9dzO60p KjQvOBoJ+G0tydkxXF5U1ydM0Qr4up+ueEturxRnW9XnCumiTfaYLKfp0e9pEU7kCx78zBbpDy7i ag1W01vh9rncdvhidH+Z9kVdcG97lGeQted+d9KYajCNMNmUzMea+2B/t5UwMHAjIt/YeWCPcGUi 3vND92GVg/HFuQZLybU8+XvfjZLJ7D3HtbeV0e5P2f1vtJYd++7dju/v93jMHdBOap6xyYH899Vy KWy/rvfVUKNzezx3Zi4UeKZy/V9/L12QfGHded1Z6WzmqV/twAsiySAHe1s8QUsVeFTyuHxmjjtH R6u1aSneB1mcqtseCXN4Obqq+6pfJlG7Jc7S7ai7+QR4egbMuNviG8f8zZno9q6othLE6peXJw6S PELuagyBFyGKG6qC02IlbGW70hFgcjJLOegVdT5oReQp1FGNrQRPMFfM/pLO/Th0/hw7953aAjNk e0i8MdFXEJ5qG1eiCKxIlT979xXTZpVy1l0Rn8KNrjWe73vhOLMeKRXSEDyfNMPpsOwccWwYD5e5 48RlTA8o3BGAl6YLHUCKoCeLMLJlP2cdBS2YeVdIMeffuVlYz/nExFVAWJB6d3aUO+iuLrNy8RFw 6e0xtK7QrbhHjCD2xb8bV3YQOClhEL4i6Oj1+fucphrE1IERLK9Yw0mzlGFPCJXy26ynuwjd5muL ZfMsPnid4OE80hzaF0AmSZV9PgjjY9jLwJ29V1AZyyzCj7T4hs32Xkcpjy+ArlaxmIb0kw8VN5tQ kYdFnIh4ZFPIkYgfN35CGj0+Ew9ozf/1OZsHhEhCb+970p3N0/94OpamYAOyqEUKH9O+HAP/cFrp SEJdVj8WtNmxr6FNXJeNUDmi0+3SHE8oNmojeJ8yzJbb7bJD81Sbo2QcDSimN/vK4uJ8a3DMlyfz Pp6i34XhdqnDRdCDi47NMLYptvceS/ZD749PxQWdJiJOOsV9OXCsVOz8bJ2yP87N+L2zFAI4egiR GPhwgQtLeg8uWym/NV7RWKaVR93r9iHQS4ulUP+ejW4uHiEvOLLAINg+m/lZ3RslxE03suLhPiUu lA7vCjX2CnjD2cbac+R9E2zcNPHCVbH2344hvvCrjnPxDkOWcqiZ0bfqslpa5PQf5YZw5IPlaYPL qFAPxCKEZj9VEZwVp6k2imZLyiGr+SC7HB0eclwhIEk96HiTcHrkq357d7PEV7CNOS2eOzMLHn5k aqnIe6pBVd5CJ6cQM3yPr7ymvTyrOSnwNwdhcvLz5/eTymvCKs8aX3/thTIgIHylFFAfQx1baqok S9epRbig2VEHfXH0Pbg07HYVW2AY/7gNuZUutJ8lyNYPXhlXUMjQKLa1EVxJ/ulfEc8SJVMyBKCS 91HHkUdOw1yK5Fvwc+QTJP+GKurA4kJjI3jmJxwKTqJW6AzJlVwoLXFu5gmNIR63QbjUVIjv1Vvh 3JHbJbHCzU1CsACU2qh8+IQ6of7dfWsmrcVm5itNFpNVfQ6Xze1vi/jaVr0SNRaXQ+SYIfUS1WEq KUkNdy6sV8WY1z/X6jFXwJL0DMyXdeB0dcVp7dQ2y/Bkr4ODQw9bjpnUEdpt2D5uutVVXt+pI+pp vRf31uasXTkq0tZA3YEeUEOd32Nfo0QrwFMgcWnXZfkGfDM367ioOLxnGKGUqdTsu3o+aNiIHA6e M9mcfkpCrGqBD6vrkjVM+0xUcmofPyhp2z6OgKhRJL4ijaO9Ahe+XNMlZoLjKJcmjiPZMx6nh3NN SvKJOoF/gkrVWDyXkcYzosTMDVlXa7aCXj7zb2ZWXpd4DmQWQ1yMCNJUOvMhktRQ2nxBmN4rI7Ot MNnSnah1V7O4UdBxNiIpTSWAfEd3brZU9FPa7LlRHligGBG+/s+Scq7D6qrD6s6qs+xYV64DPl6k 3AvK+p/VSISTkiFqFgW5Kar9zq8OPfr1mfzHFfnVWWNSJGeU1sVADuG5D3ioh/cRBcJc37DfZY1g gkE7pVRRaO8NA7ocU9XHGXLDmKBmDjmZxL2y9cNuLptC06N4mmKGzIKABb3D5hHlxDv1sO5RPRTR d5Tqgze6Xa4n9s7eX3N2UluSUrPccoNw8UO3S2aul5bUDxcUFh767fqpXG2eX9ynrHCGj2/pDu+3 QqY7H9Ga/KobJR3FGF4XKjIqGKp7iniKg5GjrmZmhat7A2w/e7yqRcm6NacM//gzVFjwZzemjA4V ebTuNP7O/MuXL3e272Z4G3CZlD/i5C5m6+UnVfvmz9NNmqdbJxHl8kWVDo2MO0t8Z7BGbkJ32XV5 jyf+Mcec86BFl9Fz+CbTsoCp9TPB3y69Y8+QH5pXX7ZOo0VpPmbQSKbSiQ+aijXNzg09PnJJlUnP srp9ySAwMIschiWU5CK2obiUoyfWTB4JOdgML0vXhrLNasmSkWZmYr40Wlx6BgmP7n1Kx2MrGQrQ 4BT0cEnVKNGWQiTcd4TO835dnTptI+hYmhWaWHVIdjj1v6ogJg/TFp1RnVeyP2Mdr2MtFxd7rsOL +itd+XVWbP43inJnc3QXWC91N1W9NqiGqzubMKnpVKM7PeOrxp2MvqeQRW9eaOKWtryfBc+Z0xpI IvKvC0kZcpsvy/alQTCWFOXCMOFMp8XlR9URLjGFqp2l9Dq+TD1Sjjvev3ZbTSQy6iyJU7JZofpK K0xZffQMhkfgrcZxzVnn6rHTKaOpTLBiaWtqanpoTnM2J31HSpchR87OHJ7pLxDjl2RUaq8H56Ys F8bo4+YmhooEs4xK3JKO6nHT0yIma+bEqMnPF9hsBoN01Ge6DKCVhVKEiyvyNNYaNQr5C1Kvi766 AH0fEbRat0O8bpsl/J5FLZmLyTrRkubmqR1XhA23jm/g8wpDLTwl+DJAyeC2XwdXPSDW+YcEZUPM TUERSit2SZ1jXsYtpZmC5Pn3kioqKuRhkiBVqxr5kp/XJt9+fcy52lUtK2bikldXpo1sU3WPQs2Q dLXI6qbP6WZqjuVHk031cafjuezekibhcJGm5+qp7OkhHOoKLYrKnVRegavu3tC62w0DgXkf51ZL x9G6lqsYklMcjed2Vh2ca+WAfImW05MNwWZjkFjmKKCy7pQ5alWzTznLkOmlya3BJQ99aqTI0K/B AAZm8nb5TXN+zJn53ZISe0bWuWt7RBCGwqbYeKlgT8gmuS+aazaatyL2inz8xC+mU7VQwye5CppT PRraXDfYb42aKkWMydL+m24nUG8g6XR7OtL7C2x+1zy7z9ML8MSnAj79ChmXSAyfk+qVNjWjQAo8 ON6GN5N4FDO/KZqLVF+P20LVfZ+qO7t6iK06i1BsxYVJkZVWaup2eRTxXi9RyUflXymGvs3c15/W sp8CdCeHPhB1sTWHshK86+ixMy6eXkyN+Al8ROvm2DqsHrrEtVt9jNG6y9kMOMwx46Hv9biYr43d Y87jtJoSa+0gOvAoVzH2Hz2I/IuBUU7IzKs07/xwHRpFrvdH1Mai8a/H9YrDKpw9EI6byxoFi2p5 IAyLzB95fMXAjfhwrWprOQkQ5NS52zNEaOjhgXRU0THhM77je1TL57bixuU2HT6bX++Qy2nl8olg Y8F58BnOp33tG/rQEM/UQD/Ec11H0QuRMWNI1Y8H1e5ifpNkdYhnTUdRgb42tdN7venrhb2ezkYI QCNkopFXgl+EJRNJTw/TgrxgByDYVMjUXBodNXx+fhEwXqZcatjA1UrmpWgQf3hbeXKihMTR+edP mFjL2Bam3j62kkY2PT+6zYmSxrKVzYVpKkcaaDlbr4pTv0x5R+6iRXevxijb8gomD6qhtM58ZaYu Um1Y/JuZ/Kd2PnnizXQLryGTHB52al0nSusFRJXFnZXhpQF5yJnOJjHOOUMrlop2ZsE2Jn/qjjJ6 fgwjsY/E71f48OPCsERhkrQIMqskglQUNtJFPc/0X3VeXZbMHaVfX/LGXl/Lbr07yuk6H/cPrcVo 8SYmAFkRmx0QAju0IdKhce+xeT79dgI2Js/EJARNsPyXgAvShQG+06EhpFuH3u3rAwXWaBXW+8Eh QmPXRssMA8G2p6i/hBr8tU9iy3gqHweXEht9H64TD2DoiQWxCCqdBcM/NEG4TiIVR343F8CweO9z EUCNFvsglPK/4fAwJ410C8jojfoa0nCMC4uaKY3WKs6Fwk/cmUkLYIcLbsKQjox8rAfEan8U5mzA ZEBGsNQy9YMlIJTXLLyoHKT+O2lDbkaF/UM/zF3P0/igzEZPY3APc6lY98a6T6hkTMKXKF/ChvQJ qUm4meftj+Jj91ZGsG7GmATjpRU3Ottt/X4RWg/zuTnGlf/yKoPVNEHCzMn+29cSPATIMsVfVw5r jHPI7rLX9Y+q9P8yFrP5KY1QdMmFMc2IJu49N1kBnDvMe3qQ5hIe25a/HJPTieZ8mW1m1lK5bbUG 1nln23v9zXWpeUlrEefgvNO/yD86sX5JYDKClZC45ApTvyL9DuR4PYtOPOVD+jTE8CPMTYYiNBu0 AmPIk2zY5Y50ALfF2Bdq58eujN61Wc5n13LSsYS2z3ucE29+pfOdxXyhcZm91jQI9Primj3xOyCR PzgZlvjnLhs4am3jctuaw9gT8hgLvpkYLUfLzAC/Vq+D+oTCp4ybsJ7X0F7R1i/ywUE3j69Lt+v3 L34uHKeAn0BQCLIqVg0gEHYFqwaJGwYLhiQEKUQpGJULBgs2HmhpgnbOfp4oivsH3R5BL1gm2AHo aYLUgOuNZ42wFDwcbAjcAjqaYGEj3MKdAIULJI42rR5DAKIfz+Gdv/MiuMOqwKoAVkWx/qBdw/bD P4TAQr4AOYHNQCoIH8QHwn4Od24HQXbG40XsQUaHY4MdDsnA0IMZZgJWA+2A7OckEA8IBgT+nO6c gB2uB6MH0IOWA78GeEHhRejBeiLgxXjChAo5I0JhoNhQZCgR1ApiHKwSrBICCg5CeIF5egflgbiZ 4EHhoDhQVCiuMwGUGMp5fqaJnEz0SM6OyQ4jJ8pxziOK+h2VKIQL4hRyEYwiiwQPOQtGh8CZwDlT sb/rQP4Br4hYBkMIsIQ8ArGCK4ORDeAMUC3gCICoT9gjcKyAQHhZ4A4QH5gGTAyxByI+CX0HbMN5 UmKNINXBoQbbAN1NECkBIrCoIflwnCG6wDmgPRDWAMAbEgRjEEzSQXAOIwUkNWFVRZ8A1AF2AWjB EcAbURQIAgFsKRBD9L0qJj3QDCJdANeB0vFeBw4aXArkMOFzRlNFqYF5EoVBhmMKYSwg1kFYQV1B nIVpB3jBeMF5wVaHfBZlceZxxmogQIYVARwG+4U8BrOfu1HCzQKOgo1h7gBHIRhAAFAaImaCWwCH AZQQpW54vwgniP5E/QeeC6AfQgB5Z0LSQLYIewxPjqAXwg35ZEJ4zttAsgiQDOkVFWjA2ocxAwZC YP6gCMKSwufBdwWXB5eHOBYg7SM8BBvDPQNhzpkg7yG6EOxz0nNBZyJvWOhnZ3heVFKAETxiSEbw FnAciH2Oes54TsyO/oToTeYN4IXtQelBiINxApzBnMF9DLkLDoJThj0D9CMoA/oBgVg5sMIwwvDC cMKIL++hhBBciAaEE2IcIgITBP+CASUlQuiD6YPvg3uBz0HoQ3xBfxIQ5Tk5g92CAXyHpwEEAUpg KoPfyQJeCIiwfgS7i8K8YI7AsMLQwRDC4YbEBssBLUxQnT+ZIPZhPcH8QP0GpAWWitKZwNYAsUKY IRwQmWB4A0wDWAOUJ6IRRHvgOoBPlNUE6TLYH8JYAPMDURHJEobjHLcAG8rAjvsDwQBjApEU+DkY F4oEROgIsYPFUoWfgN2FGwIKQvhNhBtgdJANsFJhjEzeqaKuwKTC7gTDMSM6wjMGZwdnh9AGY+mg MgPSAe0waUBUIBZ8MGUDTgVcVYgWsBboIIrhLOCM5PzRmbCBWAcwC+cFuIOxC8E+5yzA7CDswEIG iCB9EBVqwIQiOIs0kC/CCMLYw5PDc8My/oERhOeCyw5hAQ4CReCURDkb8K1hyWHbYJdDyIDKELUC fGsAOcATNhHQHSIkireI1gJ4DMakRDxGwoTJBeICxSByBWjeqN7E+4i+wUYFWFDaP1joMP1webB5 CJiwIFgQICqEMNgYIBNcDPwEkTLB9kbhxexBR4eth6mHq4cdBDoFL4TwBOMCs4H6QORz7nPMc1Zn HG8s6EcI3rnwuT6E61wAcgd8DwFAJCDUEHNIfkgQrDCsMIIw4AUfCjiXgawHg2Bd6/v/vywDXxB3 KIiQiIJpKN9Dr4KCwhVXX4IsXL58D2AzyiAirCeBCkG8Ya8RLB7IOUNphIKIo0of+0pIdax0g6gb NLUvsNwIDfwCIiISONMW4F/TKULTfydyJvr5GHDMy1Ru3vT+1q8zKU8Qngo0CqT14/0+jkhea8om aQcWiNLXtZjGm/ddQL/9FcbTgJRu8Fsa08E8yrPWdNnWsqHvpL1p+Kw7HRx4LTF/dY7DvdKeKdRN DTQ6WQLectWZgFoRwRcfPxxDBzB4d+U9X2cOanoDhfUDb7AWz6TzzPzIdX7zn+aDuNc4sudYv+vY S7w/WtEJNecH57oFjnSR600YCRGZliIQNvbeuOmC0oeYoVgZTQsP3E2I/bFCcy1wj6Cvxi8XXsfg ea2aoGH5+SbG/BtuNnMVp87o3rX1Cd/2OpMor/WQdX8BksW20JN4g3FSEa6mukiSxeznbPBGr1dD mL52g5eRfxzZUQdh/4bvbdR6romKUE/cZEbQr7bazMmleaNxR8acn0V3neC1xzrT5VNWM7bj7gwh 8jzQQzurudOLLZNfpR3asv/R52PrR+LbARK2BqLAMzH/4ULD9qY1ByZwbmxZc/lFd561zoRnRI79 shAa+Nb508twNni1TvP2UAMDOsnT9ExSbyVzG6mj3xF3s3H3sts5eVxw+HXaz7J5CuNK9yhLt+aG /KMfA4FlrV29pYrJqzmZHfio3zc1/smV+shJd2AtqBWwcGDquX2xDG7cJ+Ol4GkmPBfIs+lNwRBu TF89zPqVcFZv5RfkQuZ3ds7ddpOge7z65bZJg01oyHOVM/am9TnHof/oY43fkbxnR21Wr9u13O3m yw0E6D/v80rqebko7Ol+1gvFoJpfqGkQupv8qu/4jLKsvmWZe1RvNWx2cxwvMWlf+TGqN8AbS+Dc BAGqNuoZKa8TpZew3h3Zu9Kb1FqDtSloOE5uzJnybLvMMX9TQLhg9t7vaJE7p3nnuPGRsOnPE9ri 9PCXZpmzH6NGJ5VWSMTpYWixznm7zSxzPryvTODTR/wcwo8CLtaEdn1berdjL+zLfq83Ez6lwIeL foqVpvCTqt5Ij8+hhNlOJqB2EWARFY8f5HflcaRuRnPGbZ0paLitAdNgfavX1JO0v97r6gM3XnfU 5GQmEFPIaDjBPRKsAZ0arG1vTjgnvX24+kTwPKxlD81E0lXQ4rbTEyIc7ozC2Hh6qfk5thT4KUOo 2w7A1GcmKDDdGyLF46v7d3WhAXBUZ+705MtEshjIKTBjBDqs42x09KDy8zyKP46e5An9i+p392tc sTZrSNvIC99vq9K3rfu0/NhkC+O414q7ee2Ep/Ejz4T5lcN7+5PNzBo0/xNtBXDUx8dFhZO7RueI iYSTKvOQ6teE3H013cfIo8VoQoqvEqssUIpTq34yYmCnS6N+fTf8gdoMQR2nz1YL9w//OmyGnudv XENUBj8RG5+eXSQMRH7visBZHzxuyRard3ILhWVDrg7iwtAIj2P0icFbMiqNTONBU64ArOYsGSQd h2uEeV8oGfdXtfDJjuq01XMI7nETLVaDQ5T0YpZh1GJclsPx/EnA8dIjuZXIU1I8i09HlMMpiWUI GagJw7C+CT/eT6fhho/AZ5N32fmcVz/aXNnYVyTbeH0q0PnG9XZ25GyxCem24f7OqwHcbm8xE6qn 3Ub1W57bk+MjmdtUrv2FhCGz67mWp5oYQ7Z+fwbL2swg63MU5fLiHbHbPcliTFn5osHxa7dI4Kh2 q/C49um+1X213mLTrpHn3/RyXbfXI/uheSPP4dPBY8+nXfxlxMXWpN4JqARSd2FhrMNpUMpq4x27 fuMOpd/xkNdiL9nw4g0U42PgHVLb8Ub5YuL2vf3tm4NLrQ728htKEwHGqYZu60ba7nfcnmd9hItP 51v24PnAtpsvTk0shmyNdo6rE/MtFF/Zei5gA53Q112+r8acGXbWZigZu38MXPhr7zKIO/F+aYhg rTkeP6q9OftCpKzr1BJDpXfM8ZdTX+BWIMGSX3haxPK53+Pi7l7gYM+hGPdjHn12f2HKpN7fsZy7 libnY1rPmyXt41d4/dj15/16IyuSIL6f2i3XzQlf1q2wtvhXX6DvPGWuibrf723NG7I1COjnm9rl E1mkGLQ3PTwPgz36F8fbyAITJ7vMmZYfx7qPKzOUG3Xvjs1EnI7MRTrtBPQ7W7O12sksVcgDomrX Xz9kY2FOdPannAh4Jq9239GjbfDQTwbYnwb4Lao4rv5c+ay/eHMkoBtwTGQnfI04fsH81Q+zf5KR XBDIOJCY/EdZu86z4TO0l6Tb2HLghuVYL6c8086ZvP05xofi2GzcmaWNzC+WZZhP3/vV/Dj0nqrt 4aLYfpcssekh7wv4MhJg/66DnWKPod4XLdBcRON0fTKHl60bM9dkYW164uejsenCen8Gyhf+i/67 Zlre3c+t3YtNv1k9B3fLwYATEKcX/VjZGhSm238ew35yLWMxnWjm9MhkY20LGjAMLprsPc5bxM7+ zpkxJxT4LUIgESKQb9beTm7p9pOM+fbpyH5ORBocBkJvPq4i4PbywO1GGtZ9/IXdrP0UN/ksRbLc cKTL/RJj1lb4CH/lCO916mi2UCsAbHt5wPC8uoXVXg8Mz6yrNkebc/TcmrcCx2fnm6DyPl9Ge4Fr GNMMPVbltV9nSY7LPbrBGPFI4F2rNXMeh7OvV9yCoxz2V+CJIbuBBVbtmOdH5cCRU7ug6FF8U+32 I6LH7mqA4gnfQN3ynynygAt4uwNys7utICKiBxa3jRUD19Va5hj3GYLeDOmzUr58X5trI/dewmf/ Q6mF4pxr+vIrhjG5RPG5YlVQNb3mMwPsM0PI1f4/w/rMUHd18M/oPzMsv73pB+DBB+CFX9m9mVTi gNSsK+s3g/cpAK/xyvrNpMq8PYElVxZvL3hGAXhrVzZvJtU9IPX6yibV/ZmF4EGfeaq8XWff6f3M Ooe7cO9X2SC0nBeCjqtDFucHff6bdvc8GaeD2fWimn6pe3/f2KaXdL9nlru9v/qnQiUJAjGIykud h2XEx7DepJWmUGRx7Int1p/IyMoeUmvJsBnmE4Khc+Y7Ndq8la3yFFU+s+KF6ei+gqbJpqw9VYxy bckDyckSru9GxrOXaEjCSTnVreRoPqRo+sF/lmT+nD254tE2MNomlktWe0Q7DepF6csUl5FEM6Z+ 7TJ3n/0i69ia+LDxHIHHp+QxggmdDeyLGnLCZRHOl8JhkurYE45KMitERQvQzNyG1aC55/YvxCpl mN2hJouMtlTN2iztOXdmIdO92OXDWRRnxLrPce7V0yMw3rtEH86aH+t1Brc+6Q3mqlVT7A6LKPz+ UOn9zJGo15bjDNowuPKld9oK68n4cqduYifFOYKprcHMbGAzy3BlqfhjIOwleaa1DN4XbgC8W3I+ eT0T6j1rJ8Zw6MHXEw2LzqJUVFF1wPe3TA2Zu9JT2RFWamBqBqqImg1PSDKWm80ZoMeRSFBTjqTP K1K5j4dtfqRwT40BuXI1Ihc1Ji3jMoztTmh3yvHriPjCf7/6gZAYA6HOcey4FlLLmtM+55yaleXL 5MuXz5DaIl59c7Jc3rp78hdOctRvSvC7LlWXmQfGLeLmlSjx2c0nZMEyRySB91QqYmpTPxStgFPB 8oX3WXbvTu/CNQACG+zUYZ/NdkroLlP8QpgrmWK0C3aR4yNxN6jK4ZUjGenzXl5e2J1WYCrlwvCr 9/5AKGtld70HET2/KwCt5ib0+TqAg+sFnhjn2Tmoah8o4DG/2ZexWqPQOLZwyVty7nmMwLaHoadm 2JMVUzIQoX3l1ietYE526iInb+0B0CmcaxeMCUdxfevt1mxWSY2REPYV//0OB5Jt5wW77aba4zmy R01Y9mcf7eK3oPeH34oyO0gEjWjRmQl1rJrSATnA2Qa9ydKMhUdRQ6WazurNsIm6Ml9674lndFuc ysrRvUm6HpQfWYoFTVccHLZvCfu+USIKzEHhtJz48T0KdReel2JSh7miUAdRvrTLeKorx6OFH/bz AFxN+RX3501ldRyszpKRqaWlkpwcuI9O3pBE9FT1bS0bWKzISdqftjQlKoKQtFCO8f1PJPtuA6y2 y7uO8C4NXC+ysE6jI6x/stigZmL6+rokn0WASsHibmcZech/OwxArXrVLpeXaUqg/e9ZX4BDBQTl cU9lqCyHzXJ+XGibq8rVvYJNfCl5qrNLuXefh/L/ArFyce0q3D4H/8JgdiD1SOEmYk2vrrLQBQ94 ZuORTxubfU0qasBxJqwWfMg0QPceoZnT1ryDr66OkdTxifVH/dBSJNlhzWSV2vDZiBo+f4P7KhLL taEaHj+UrOjmg/PthK5Znb+2MJNqdTOXLcmQPZ7cCJBKrYFBaE48HP/re9R4V0hSDcnTbLIMxrws M8P790lIlcHBN5b3x+CEZisGI+K+CBauy9GREVlz8+hOl96gMAN3ZLoMf/+J9X22TwphHR6pQDkZ Wk4a4lESmanfv6Vtb8MST50ijGt82NPlP3C1EuoB98S9J89HAyTdowAWCwZHzAbpp64G7z/wfDv7 m8cxwninLoPi1DzyCpNTqn3+9ORqizWaDVOl3i4r3Hr7eWGiOlOVE8DASTc7sTXXFYryiEbXA/2w Ym20AyhVfV02VtXQ6woSCfoQbKbpNvCSg1LS8DjqVWCl+nuzoPxK1FK48NAYJwfBVnLr2m4r6df1 sSZDS04LN2FTthIW6rx6OKfTdoWS/DChaDQDF+52fW5eyWdK81wKxozLrxksxgmgS8Pu9LCTAiFZ zPLskh95HDR7NMo7NC8t5rc1h9EO58X6S1AnF+12D41hPPcf5GzhzKCsuZXlFc/D2cp0DisNHyc3 Hy8vD55WtGmWKp7irlKBfOICF3HL7bCxEJOSkJW4llQugJROyaiVKIXKu26G3ZjgKvE0MzNTdtBX R4Zsjq9jRQexZYqjsNZ8wrpcbruKeiO5RbSD0LgZ1zL/FrsxGcETksHDlgOu+K2ixH1KnR8cbu92 OT/N0aVO3MV/HHJY4jLZ7ZL6y6rXvF8Uy7oJ3LWxO83qtJzOyrQrm/5UdpFrmXDiSYguoNx99G4C SlVWq8vpMNnS3YB0WaMbJYj2Rehy5KcM1NwNjUK34zwpk5PCZ/vdktvSRMSSmnWuSrCWzJlwl/Pc qkwieS4XSoqW26d8d3cc4+FL+z7vu+nuszKU9LO+R74lbl005FwuGzYEjdNVNNX9y7U9upOdyhaO 6A9sbCvcusvKdl+MgNTSHzUU6aTclF8OmVgMUpFsjHzGuWsu6EFMw84DCF/UsPcQ8CZ9aNH/olnb ZBOgP7BkKzaW8wL9Hb7EkEQ4dEKqWH4YtSL8RWP1zkxwgV33HVh0xNPnjw6EeT1kaj0T4b+vLjYO +HzPl2d6jDRdXwiddzAOSMuJMwPypXaTtup84+9JWtlde578vDrnM3UYc3zsie1BIEQf3WUToH4S uGJaBsoVuDst3rM/XXSfmc788XYXdbxM5XDZ+/NdiHifS00G9R4UyRWWq+YWgS6c31IcKePgcs6L rrrCKcAt5MrDOvo6eZtgera2B103erryu7jLSf/WmmEcmEntmHox1rjd+2UGL6U3dWPn9e9toBVL YIm+Ud9Oun5L71Qp1Q2Bw+WkWEv937ZpbYeqScf7tt7nttuQ6aXObSfuoJRvrcPkfgKOiTYUk33Q zdjq+r6H2GobO8ED26yeWofBebbT3gdbfxiWI8Iv62iDT0YsmfU2KdUglquDE/8DT4fAxxP4H9yl rRTnmen+Z70XihfHdwm01su/bx/otk5Egof+WtvY+zCPd+YIXr36jLgx7PWd9vmdPSuXQbfTM52S 2US5BZWbW2LBQzay8u/JMzhYHUgjaC40Bw8QiblNBiR45gM95giD+u5A60S5I+02P7+8PCFM3bod DH0a/B4Sha3Opb3UAUtOmYao1HZKGZCgQ61FLoeTyqmdUjlGjFmf//6NsT8c8LHaKXzJo17mk89T eAjSuE7/FLp6abhm7+MXp7f+9R2o5lMCDhdB/MXBJ5rzueG+bxrWcVbrHJu4Vni8AE9TWHAfjBp5 cWn1GRn1Zq9kI5v14Jx/LmeiW4xVQatbi4BXRL9Hb38aFMOGV66vlddyXe9R+YHnFhzU9JK7DRJ+ VMy2RTMfvyDND+Buiy4PuAXzvN9Cy39G4k7fQVp/SKfwv9JaHx3W6H8W6L+K7fd2dAQfUKy5gfpX rwyLSzpy9bs285ga/Ifw7/yFLqqQToW8XKfSBIW3cHOOhhPaDATtic3wuCxs2bkWN5x+efdQzZ3S dNJjPBxvPkyQpNJumKy+nnoHdOUS3u45tCK1sRa3bX59tJYlJVaJpPMXIym1AmtPpF9ceFp7557U P0GhQYEr9eQUGemoAQnSJMeRiBpxah30f5eOapqGBz2XqxVnF+l0qqfwdKU2ZiheQK/NXbl3t8ts /U87R/X9L26LbJ1CCmVKplcX98noCld7Io87te2B98ezQeCXfIq7m/YXZxeYJVKURQaLWVGxDUHU nKwRwTHKu3xDsXhQjFaW21D9696r7uqU3+NJBlvSKqof3NVHo4chhfVFtpZWY//hvpWX7v5g0PAr ewICPT81XNDgmugJqGTqk3S8U/Ie9rJDRRUqPEKiSStO/lHd8+jrk0j1so9Tf8BB39Hr9ccHgyAh Sy7abmHHFqll9ymjLN8DY+DeSUZggEv478VviyTojfwAqD1ExVtNkvSe5OOAVYy0do2UFSQ0Z/6+ Ztl4IPBx5mbB33Py84JB0OTral2iSj84cN1428n+9UFdAohXYEVy0MgBILG8Zi5eFSWjJB/ibBHQ xi8k4mkg8SdwFz66XWhYfzkQobwMsl5YeI3wT6gtkMn/BvKAXMF48cjmV9dwXLx/4UxU1xbEG6m5 0m3vjxTzfs1b/mzu5pD5augWz925m80CzBB5GYeumOyoDC2Azem6Q0pLLvZqM5nUaUeq7DtGWeHh YobNtQSrIASs/3fs39ZPxg12Ca8RD8cxs52plFVhjYibzQPKOEqnkcfvLXiGauTDCRhIR1hyXpKm rFZfHm+NLTmPS/tfQYndz0cbkVXfFNTC6CRqBqa2eL6BFOvUa8hVojcsFFXhYJkOOKWojx7edhl8 6T+/ZyvghAqesgxJDaZmW9O8I2eXf2ZQRNFkCC0PX7XI8CkpV/+KT6N1l++hYB0mvKAltV+K7YEY Njq1yA6fJf2p6KGAchH9oxIXQf+mWuqHaqXkt5Clj7Q9z2xEBq/OmsRIq1GED34SfUAP2d14aprs E/gAjyCWRi/cKTtzo9se3nZiXD43/SNQSEiNl/SThr1JsPQvauEU0YxFrwWUgQJ7AgdIs1ayx781 EYOoCaIl/R78FNVwBTFxtZD/itq8ANtMSJYc4PLxxc5Vg9oFqxaQPBQslgMPeH1dBZb+/hWlVlpi MEkdjlX3r6BcRu8+YTyMPS84iBa1k12wWsUBdwgjHauVRkljcA+h2wCWgJX+ikSlvxoE6ORjquib tApCTP/nzlEsCfGhmdBzLgZiWG8hFeJ6JpJoNxzXhy3ER8cUXfWVJVlAk8G/9Eu2RRtjLXQeQoEn n4RDH0SJ40MnjsJitJaww14Vzb1GyX2xvpfcle+n/+F28V7cOS1BTKAP6oZtdTi/uL//VphM4a+t lRn5XhU+saRd5Ch9ETFIAjs0B/Sk9Z6rrUJIaatZJv1JgoGOOEY2XVAbzBglmQvqom1yoOhbrA0F CfnDBKWs5nGz41EHeE5/k9x8WDz9Bh/CrQCHsYfjuu8/z5LksLlg4zY7JWqlUsCJ6uPYoPGIGBGH k19rVg37ghgfKutPJ370v+8Iu8PqpqbypmCC8lFaFy7acRi0YKst9CkEwJTIyRLbbPTvLP5t3uJA IezgkVmU+/y87cS1iMFwbca12axOu2gfuNYnRj3tS++v+S/Yy3SBZLhwdBpWQSqp/T7T3znYfxm/ +0iv1WRs4LS+SqkqUhjffy82cxT2tqQSaQICYGmc5phOAwDNsdw78WjC9y+75e+u8bbwzY2uyZLq Fa7QF1922XSjwUZG2q8V8SDOrxSRwqkSLLLnXMF7h5eZKHF08WPo+1p+kf4HEig6PxPsSyCFRoup dbBLAPeIeNrnUxHcfCHyAcbqUHK2Kn3x7DKQKc5+MIM24WcMIoN35IkWWkDz/oD23Cer6DVCWTaN v/c1+h+WLzYQp/ZmZXnNmnhmwcON1sFw0vhMPbs4r38ccXtlpYq82qp8H5sdURxxo462TQrKyz+i ZoTpFQzsfYMNL7PmDxodhnDG333VoEVxf6t0fbPlXxvtMWG504GfUcWL5a1VQoSXW+/IureTVGTz azmC3kUXHL6lYwDjJRKCKo0fYfTRmgdBcYs3/yTOaFmDw3WiYdki4kisPr4Iyv9fMt7lh4nRAgU0 FCFuWVTEsPnm5HVjw/vP2loxzPIxBaFzvgGq7eHc57rqh76+cELXdFuyv/IsnaUUEbvF8OGrHWZ/ KmdZgCWcFtOrfwrYz9Dyv9W9iYCwQfktPH9anmgB0oO9TAD2ByV/7a9S5IZOi2SNiBa+UtVzepol ia9v7pBABZGF767vcEsHtvGk1Z5vfyikIZyD+5ZpmOCuwdT/oLWB8YJ4rQub78cPmBad/W4JAbgQ HeINmJPUcoWAnoZ+WjnMc0YJ/tvYuviBElpzfU0vlMu1/4X4s6uqYL/+u1+YToeO3XO2KRb6UbWM BtvT+VFzLIVvAeoUIT5BQXx8BGCo7V+pMj7FE7l1r1YBHvxnWM+RUJ65qUjb9P5jkt9HYdNTJuyL YNwILqzSEqmfnt25mQhStqStJT/XYXIVaLIn3ehq9h9q3hD2yzRjVmOhsksgTbkDpPYIEwsP3Pth XFYRnzAil0Izmqx0vVzzx0qoT/mNy6Jn+95FOG1geiKa/NpDvtBNroVcWR/K4abqEjwHVjLWeNv/ 88oi29smbOkvA3zYqYmKlYqKiXVwZkXQd+lP7Q8IQd5ev+h8apKtm7WlgM7/lbZY/pwoJT1yaPff Hc9u9F9WtkFld1gPOzempyJoHNt6jYyhL08FjigOFVgJ1z8M8NZI3QvVrc0irWHCub0FY+bo2ouE 6X0qBrPzOtThn+/FVnGWErB44q7DQKFwIafuSCc2iLhQUs4R17Q5ul5C5ehFUQuwUwpCB0lXf+E/ 9+sNqYXeZRTAh4l9Ka9a+kvUO7k8dc/sAxHJpveUuFymhygj5768aLwui+jyrL5IbL1IU1aE/sll HeG65iPmBpt/kqvDoRlI71rGlJFIt/9j1c/MS2BQ/UaUv1qjBzFon2FDfntjdh2uxFBN9hWtW3wD T56nS9kE8A5JuqdLC9hLHvyx+ReGBjIKz7TwDTt4/Ifvws2ylLYcQxO22P63b27MmV8lLknL0PqS a9/xuCuYAPJ3gouQiUsHrBCF/6YwwgnNsMRWMsBm0+hUxqo26X39r0wGgm7h8cR2Lo9R1R+l08za Zbb8jShko3W+iiXRJluJqbJNP2Os4iwmYMlYQEngek9knDtD6Yh1Zx1jfmvKqSGAImfxuilHybNr t2rmzEvv9A/egO2CcSOm0kHhny4kJc+OrfgV0Xd+GQ9XUyxZ/qmSgW6UbrwNo43MNUlreivJXcE6 m5eU4eAsir9anpd0H70EEx0BP2XVArXKFtl/Te6EJPSYUEouOY3x+fn/+NDzXojclecnxK2A0wNo or6v5uSF/MCcGL7hNKJdHQ/tGZS/KPqXss2lN0KRxxtCMObzpyNFof+zJ8uOE/1j9jtleAmGFMBT 6q1jM8cKWPhoOq3/YUmK37zHV/m+5mCAl3B9nY0YiVcHOq+gVWvCL12sbSpatCefRal1jZr61yut BaVVgqyw50RKGfe1NTR+4HBl/hSTSvsG2lh9p1vAUzlCM920UvCWWXjuc3Cx9wM+VfhSXvYVnxHF tjm7XipeSvgDZbyOCUtyra9f7htgz3kgyu6+8HJv+q8qVCgCIfzbqmPRAglPFsmjxnEBJ8YdrU9M KmP1f3vz5g9OB4qpwtUVdK8LA+HkKc04UBy1uLgDN+VcokOP75ZpoDPaGQpO9X9ZkjD8b8MHYQdY kH9ZfU6DkiYsmruFbypGLRKvkVmnwo9OU40WN7WOdYnuvbG0fQnIlFaQPkJ8gNI/bjakUBQfgaYT YY4qJj9c45BGN+2Xmhxx65hvULtjtINBfppz9L4qQOyLKnsIKEQzhaEK+bLC+paJIek7c+w5j71/ nFpvgES7JPdmc1GJeH5awXgpvec5Hw6yjJK2WAOYplGkVEz9QAn3cp/+Qvc/+QG0ypZBCQZdh8dg 77lRYuPDgwmSpd8iRS9fJfngL01wfSHl8Q8pBp83L8K/VirghIaiC5OEam3IcjGOFMk+h3UfSboW LHgtFkxZ0Rr+xy28NXHADWz4K5Og/pnEhwKqJVxkd2laXQ6Fnv7sBaSFxCXgfrPVfyzI7aJzTsig pWreanxwfPcDuCdaUD5sQQAvd10vkmKGGrKEWSxxnSbL/T9uG3QajZG5qLBUCVIp6BfJ4i4Dfbfv 38cql6TXxPM/PUyWMm4kTyx567VCWPrbjb4ryUvF19feb6sGURJXpOBJ4ewk4ZeAigbNWngnyLNB hf+nlQbrcBJltFYttVyQ8LFusGaqNQ8hgrG0l5FFqcHUeMniRYN79EkSBKv/sHrCOyRSbdnqnV+F 6jhA9jWScd+9fJRZj9ksup+edtP5WygxanRaIHT6P5ItvlNCDtWriaFsZaoIBsH6uulrpk4U6XDA CYeNFWLLntSmfg3wp3ljw/0AUcaJlQr5qvFVLGGZh0cBgKMaowtURjZ/w4HXPyJCWKFUeC3jraFD mmfPuLO1mnVdkbTmuICKzgWA3CIiHJYXcyk8EJawvj+meaHqSul/CrR4D6nWtbhKPpSGvkr0OQxP 1DY0hSqGOwnKzBcnPb3Brqd54PI/dkeohudQCD1Wgx/iMnHGYtwQpZGEY0nuF/OfwuuWNC8tPuL5 zx8BYXscPCzb8OQqVLFZpL/oueJBvNgwuRLpY3dvKIJ38fxGZV4IutuF+48tlcKFmUIL6Ll84wRk H1ZQfDDhSamoNG10jVNxKo6xJRLEiwfNkkhZuv7hQPoERJ6ILq1giVLTVh4M4nqJJFKXMDLeSUgd qZik8/BmKVrAQfU4OCF5O65a0F2MWJT84DCyuPUfYfYSebEvf/Bdv5kVtjvJxFQOci+poewNMsX0 8fxfn73plCzZcN0Qy9b6G2z4GS2mWiwCcKJv3GFKOUM1yo1mgFnwX8kWnkCd02q8ZbNtwmls65sz fhwYfhGnp+Hjnz8j+hY3NmNNO2J/Mbj+Zx3pDV/Zt30ockVR8Aw1+UecF7r4Esn1TerK0e7h4lRR oD127pgKrH+KKQTDn/z4PZ7WLKKW1HeI048HWjGULppNN7udBFiWvilrdygpZv4/blmiwwR98sJU 92rPzKNI9QwFzWLXXoDhgorlw4VjpSkOozD/SU0zkmvwCkBYwZLzWjcNDlAZxtgbw76NLJc+dqMn iPPD/pMvCVlx4n/KOX7z6AFpwHJUsb5e3QvzmOvvuJkhZsf7tIhawUCJFqhkVPsf69n/pJ/kZrMt waSlmrpQKLZSbBVOL4v21pWfwKZ/pKQA8++69f8EO4Y/63vmTzwxlsSWEuc/ENVlJrKEByfP29NL folDmiOIef37zO5o/9Oc9uc8FuDIrrwhKvlQ27XM9EO1x7Q85UMKPLKX5FREtBZddx1/y3wJjqNn hrdcvsuvTaZPGhULWeIJdSwt74+6As/wJ6t/OaBshtLkD66UDi8cvKHjLEoLaKWlRctAX0HHjXd+ fXd3Bwzy1AHuhfAX+ZqWquDJsJg1/kfSdJjd4YyjbK4S8W/QsIjonz77XQUya0tFl6wQGDLj0iOl iv2/suf2DWRnViiyTrfAkuRPW8pflQ/6s9GswyilICdPxkfyWzF22qrS3ufq+i7ouf85xePviUjL 1mBd0gsO61QyuvCZRaVlcwG941u6mVpaAgWx0aL75OsBR7UESE9W/+BfR9Y/q6XOJe5/uww/wIw4 oxhmKYa9oo48J9a/kwKLC1XctJfMU12Q+E/cbm0FjCYPssk3wbRTj6mvMqYuYfALFIBoAay2E9Vc xAGGgflbSob/V4KkqQ9CPa1TW2q0zdGZiFKugpJR1p09Ta7DwdEL6PFG+1e++Sr1WIfpI57+vLOo r2DmGOr4sBj+Jk4W2zbZ0JpIZgLjdaQAEsTDLqAV9TXY9Cq26H/3E3s14J708MiIiSoLSoEwfRbt HMs9c7qw005kCDJGqqYOctCgZYq472OkY7T9cNRcMv6LdDOvGfmxV3XYeT7SZBMjPC0S1ABFODsG gcpi9JKYrOh/N3FPfx1Ghkt9yWlFNtX3pGCUV3ANaihOqHCQqi7UJUsuOUZC+hy8HyV8dPMmDcEJ WIkPj0idrwabapO7mvvNEgTwPPv290D9TmEW7sNxew4Cy3tS4eWKf6cWX74wzS8dASTqhnvV/Jij 5/SxhjFsb/xzdGJXaU/W4MXbFdfTvbw+XThMfZD+x1Nw0vQCPSYZTCUX2j1N+lUtTfpw7+H4xmed xHqfMiCS71fC9Pr+Fv7+G+ReIsslUyVj6VHEOKE5VT9PVOe+7zf4Q6r9nSi5bT+lk7AQmMuSks0t v6k9a4E8OlfhbJZkRf81vpaUSO4MTfYeVzmFncYQIsYw/J21n+L5/eaaZxSzbyzjvZRNjbpglfih Q+oqphA/bCWIdWqCIz3DL7ERMSqRR8Qvvgj0T5qGt23ZUPUP737/JS/3jqbxE/Dn0If4l7k0m4nw bJe4IXFM8u8WE8n+5Xr/i/Ai81iRcROevLbYZx7EGXUJ4Q7y0wDD35dP/lt+AEXXb5j5hB/IXIn+ ceLbrZ/ogZlv05+A7B0BZoSmLk5M92Xz2FXvMCI6VT5Wq1hUvcKlx8FL5H+KXs8CzKyBnTy8skhk yiS++xrVe5fosNVzJRI/p1ioFnmdENVPxziivZKgraj9O87yZ6bLRw5Z65QqtTJdcRqFTgJJJV09 VHOCMNUP3dcIzsx5ySmH4Yd5cx2VNBKReOWWzR59l4lV1fVsLmmqsmRDcu3vbGkw+04QZO0GMNoW Yfw6QBK0NjOOd31BK4VuwKuZ+ndy4/KXPwXO9jKt8kI2XZzwlhA/sz9BVaaEKUjLKkxMoLIynkT/ JkvXG6DBP047csz1PpNB3NzGDbh8e4q31qxVyysUwNkiNjHq05RSar6C30sDQxauzI/jHvUou5xM TWmIVpY6ei68+7c+uunPicoMu9j+2IvaArcHXsJLSTGQ3aPzPeP9m4BQIOJ1jTh9s/pMkvFIsW67 5lHxOYYgTjrKRygr3onHX/qetBy4998sPhfjo/1FMuS4OPiHRzbj07P85c/t07z5MzG20g/LTq/b zPiJ3LeEZJiWW4B/n9tAV4h1viE++PWvLK+v99idgrXd2X5SwwoRQ0pVx8GmL/d7lftJpozYcVv3 /P/mRdydkIPBdQXt1Owc7UeqrR7Fd9DDpFWZBNJCX0TgHjZ/sytNFRbW1j1GXK/PzlJSQC+1392H wsQzNHvDRQ9ru+og8y1vSFK6X2QleVWpzd27qlqWhPS4zf9GpqXZhQD7gGu9qgWmeItLvvuHl9L4 4cLkq88jvbCH/v5fvsgE2xZv+gsSo2OK3GAZ/xQ2P44l8T/FgL8N7AhbnY+odqvVxwZVT4tyE8Vj 7XeTihR4+pdFNrsI/hu9cGo3SG19h5EKCrH9zO6F//D7t/TZYZK1AaiPxLdxx16Q6Ju6puCUVbPL v+lYdsA9YBJ1d6HT8Wp7O3FFKGjuUPp1Z82anYQiIaptYO/YWTURAKb8NxlshaWf4pS3yelsLSEh gGzO9m3l+fkMP6p8wODABqT0xNBq68JaU+XqoiNh74idezjg5G6wHykfQE39TFYbcng5J1H73Nub 4SeQAE9ZeEPolVsaGiKaIze8ldHkLSTye62jXipssP9sUSA5oMbcqaD1LSwrv7WDzqSd2PlzAu4M zzsZiNEP43KUrzLcV/4NREyzc3m+m+71u0uA/1O2qx9FmV9N3duLRN/y+rv74k9ds6pggeO54DVG z7//+YsKH8Ge+2w31sa/bJFouQc2dLVO+xUkgXigaYaG8SdH3rrllCP5wwte/0C7lGRid7QGNAfX xsfP1Z7sGFq/+BxBGfHj1c/6UiL9T5HRrTy+WQWaEiUiffp3DjXbj/lOjg6kZ/18qAGAiTUdjKId 9zMOJpbvIOv+FW/BXIxfoK2XuEbO03TT53sTk+3GY7iWuLVaiW5MBy0ebZ7TeOnmp+6zhKjAmQhH SV5FsZApxEgniP/vxfd3raaH99YyMiYlqPxOmmzGQu7+duatd0buEWn+EoGNQ++Q4cM0c/b++mIb r8c38tQbkMyHTQf4Ufiht8bVHq4bPLvaOd+dbt0VPXpc7e0Q/j+arjosiv/rqnRJI90N0h1LSDcI SEkqSwoSUgtICy4tKbA00tLdqcQSAiItsZTUUku+u3x/7/8z88xn7r3nnBvzXB/JJ/rfoO+zda1+ PrVDbV9McT4m8n5zuNyNbcbWaiTrfjaimt/m47O/FaYa6uF0M1DMMXGDKSWd/jQE2iz3ENAy2j2+ 3+0Y+j2D72dDqg5V0a7PQ6DHjGxRRU3V9Hi7prJjL9Yn6o5p5JBu6zLK8/ww7uXQRazM+W/sn7DK qKogSWqJqfc3ljHxquuf4W5W3uihk4zQl18qUJv3AuA/G2h4rhIDWUK61wVwF8vEqg6Xd+WCHiGy bs+ZA2YmqcF3jICJwRFQgtTNBh1qZdr7gjut2P0l6ZPLNEKXU7exf1dyXXIny+u3HZVk0KhlBNvC BjZ67eFgqZjKLBcu6iOJrgoz4APuTD4crsfLLbfVPEbIhGaqupXzwfPc+MfFRV/1wGhcoXD8akg3 ajnx9R/5TzEftvM6VoJv3m9Dx557srCkBfBfGLSPR/HFQsXpyp+qrh82NhAIyMgJHKHWLdkxQmCb DkPDdizxwfcecpftzu+c0TO9+KFD62CXUStvF4y/h4NRBSAzGHTF96Qu+DrtLkUwXe7z9R/37anE uG61o60AmvJbBzl4YAK0A+vvjpf7Uf7pCJ/qHrEsfUnOHELTESGAQktGyMrYHaNAbUKlsTify6LM REOrzxu79ZMQGw1CIXD9lLcLD5GS+Nfcy1NpGPLrmq93sscDg/ViVaLKzWnKzcUZnFrbfQ43l2Nn GtfWmsXaLkeq7IzqZYNlpCq6vh5I3j8cZjGYjer4UavE5tbYXexXvGeZYkECHqsOh05Z+X8zi25P dj3IK/fjVQsMzQ4kb1j2hQcHm6vHqGXIwSph4k1i3bCCV030NDsRoNR1/8wGVt25GliBnuilNaME APA7co7FZh//NFZPjB4fs46Frk06solWOy1Alc/t9EKofdxcZXCdki6yLPHpWzTTyLX/zjBYGFV3 hW2IBKGQxKdHLfeyIve8xzJuJpkliERO8pK/eb7ywaqDCHCN+J0zJik+HyNE2qycJaSlKnZIRcw/ ICDDK1O8fpT/a7yCp/1U3qX7FZ0KIARKaIt07kz77cnu0E4ifHQVitCo1qdnFy+WJLjhQhuel2lx dr8EUmYRLgLZqYWP2zuf2gEX58Ap1iLpr7FV0FjmIxLxXhH+o9vpaD/ORUfISPCMiceHQsPQHMtc PwIL+yRQ24MDn5OHTq6qOROdSErROnT6O7yxsbNb//hly+3oWZHfUFgflBA/ZxXrz7eez1MIjq5w JI6eY4DsKRizpClC6YZhLcUvDpeUAMKOd6+/QEeGQn91DyhY0udiYhXB7z/CUPvKA13fW8wxZdWF rD++rF302t6MhO54yYyPRsLo4tZCej6H1Y7CRwd6SH2D0FDvz4r5V5LSRL6piBCTts2YYWV35U+z QDf8UKhutn3d5EsS0C8cdHwER0U+/i50Up7sypPsSkVk1eHP9sqfP39838nbv/HLsaMjfFt3ss8I JRy+WV0Ta6fHQe1nLBBtJrIw+dhJXHng/K51Mf4DnwSjoAwb9HPmeh7jwIjMjIogaqev5+Jcs9/2 GF6Py95BnPyHje2ZlllupdMyGTUCMH8MPG7SJYtBpmdEqG9YluO/TZbxWF5foJOBlZUzcVvlUY3v FNclAN2EeutJw3QBnFVhC+Ae+ZADP1zUsqwDZ1vOsrAJBa+f0n8WZupbjZTNY/PpxH0j4SJyhVGU 9vKp6RKsp48s+WNqhB2CWNJnvL3E2CgJTvPvFq2WpIL4pySf4+yfTP4jj5ZcQQN0oRFQo55655zh 9ejE7zGCdvsRJED6SSUd3VAU12t73kl3kT0eA6jNhmcW7NiXyM45BxNifuYi8JWOynTi7K64eHm9 MsRh9RL+ZXQ40l6yVUVRpRlIAaJPzRADBRGhDGKwYy3SLJAVAU2jBrihP6m8PgjMsX1jWVYz9vrx hudvRcAIapuVXytbSmSitfvalKK1EvSdl6irS2z9wYKPTBm8HVBFNRZnw561O8lrz0hJR9kd+GDp fnKRW1r8/E7BxQDvV273SPURt4TEuAIroYqWKF+uLA0cY5O/Ba66a8eMg+PN5vV6MniK8bzdsF2A 6ks370O7gAtZX7lTmJ6aLaEsZdrL0i8UT82ZcGFIZr00590y+FBIPNHj8r2rxbmglWh/+3egDDXs BU/kB68vfwOEbMZqKxL4IKhNoKPTcyYsdEqxLEQmE6V39qrBDdTb3xobMbkAZBqOnqp+7Fn4znV1 Aswbx0FCD3hV0b/uoBws0JYQq7jy+1vo6Mz6Yw1d4dF8WPfj+Y+1TEjUxZf7NOdm7RLbFqF87QZG j9LfxD4vuMV9MjO7e1upcIfJ8tzf+PBfjchIQk7JBlEfaoHWYGBblMLCD15esBd66K9Zj+nNEfMQ +bP52dxxzbUBBN6qMBiDwOkRKPXBiItz3AnQ1hw6nDgweqmx6vTuoJqInusC7q6j9rpM+QVtY2/q 2yOhPmH8ZSsypMnfrV1am83xR9SGEGsQSmQ+PeuixTfgKCOTq4po6Q8J4MMN7aauHd1eN8ZFqocP mGcwX6lw0LJ0PtxI9dmGZ8LfBU7L1KL3eY9u5wVEtPclV1hojDnGkQr2eCVHoHY+t2pPBiPWz6Zq T0/uUkv2Mx+lCH5V8xWjAz6g5OmFAH5O8OBvmntRPhGST7s7mtsf4IZnenOby3Hb7gt1Qq2gidVw vAt8kwQoxYsfo7mL8N0HDj1eGY+gyPfnzMbIWAus2vO4P8yTa/qRAP3T/gmU+uaH2svK9/ZHN1yL SAzDHAxjkiXqIIsBlmJYVvOJj/277nFPkAs5j5/ckrRB0NNruxz5OyckYhGu33YKfMA88ctiwDlh cpggA2OpVvNd3AHkCT5CwYWmTxa8oY9aa81TOZ0iGLrh3khrv9vREcoT4d8ja7VNoHaV8gpeIM6I bzwGjzrlY23WvVEHs71kKobdxLsjz0h5/29Jx95cN14YTUauu0nWx7shllpnbxiYM8OrK/wTGG3D 6/jICQu1NPym7Vdhe3akyuOd0ZFf2zPLjY8lnGhWNx+PlNUMA31DbdIfZzNIhMDEH942dGVrWoq8 qPtPCKyVT05Tv1VL0DGjyUTBk3Y6T7bgnzLWFJk3JdLtkTEy/EfeOK1nRsHU/tJSNVig6gUgiq8o ERrZR6w1cpg7RuUnySd86c+DTFVWll8XeMn24+MLhd3kLi80HJukpmHpvlmXcaPM33A39EPQOUwI QejTjlBOD/f6bJZcpyBCseEdg0u//UcRIMwRWXfziCVaJa3gJ1hz/Zt7dy7x4auPSKm/QCrK/jUi j74hF850u+1xT0hNE/MUOI1Wy2r2FIvcVh5ISVw8fYKThVoFGAnaqktjhEyefff/UL93YjlBdRYr IupgYlBXQJ3k9nEsafCoFsRAT2jrgv8TRgfh8uqYGQ7ZvBvy+gXx04iPEkkNOV7FnSYVY1UR9kXI 5FT3IcWp6Z8f6GG/nhS97OFuaNg38T0W1GCgBcOPfR0iRDO/PjPe+GIvKFTXe3G62hmCROOFH1cu qVE9uU/7FHa3Fk8+Vb0wazr2zwIai/S9d7GxSBV5kbRBxF8UdDrPf1sU/BZ/C/oXoJn6hs7FUl4H jhcVJ1tVMHDLke4rMzZsU1COsP+U2JtUqK5lBgDPfUbRd/DEeI8miCWXCRIWlalq2Y4OaBJMgOYl FIrGvxNOgKayqvPcoHIZ50UgeSgO02WEtWizO/YV5tS1UlZaxjFRwdjzlzyjl8wjRycaZrt+JBcE 4Nj3kH/sFa70+RI0+HHbeM9Sw34V1QMmMP9RycAIKBmFPP58bLShcty6SfZBIss5BoJ2efZMj1OC BH934ZlKOWfupC8RqxUVMDWNi/326SVvTSTf+u2eQONgR/lXawpreTXRd4rNArvf+PZPCbwCypsm b4Tfgl8AhIVIp6ja7zEHZ+UBHBmusoausXzy69iAuYYGItsJBFl2Gr/gn5sslk4hwDvwiKNX8O/x V+9RYXHBJ5rxl6ujgak+yHP8+NKOB791rqZi6BX+rMOH/rcZiW9M6YGFXy5FH3TaV5Lx0cvGZQ0M ldrWTvft38tDlDkl+aMSylSYI2LSvmitkTIAAJ+6zZqRDH0/8tnz4dyRue/0QnKrrMyaZf7cm6jp 7rk6FidCB148DQqK0A0bF5om1XmwdfW+xhcDGQYZSwLwNsOWJ+fYket2zBeEX6PHMDEwVzo+XthR hYR8HxVIPsTjNFJdE9QVxqUYgTbjNWeU0MPL0Y/QnBa+GPWiQSqV1MIcMGo3KNVFFfqFzvc/v/c/ 51/+K4i7W/Pxsz/qfwRV4+XJBaUOrjzOm4ZHspY9lAea3C2cQqb0ZdyCp4Be3rwjtTkFQ5cpPu9y 688dkBeM+RW9Fcz4ybdt2NA69uoMKZNEPIlBKojR2qi44ylp8eWQcxm3U5RJt1Jef/4bqynT1aFX dOnknbdWxyvI4Zsh/jtGD1H7QnyDZj1VhNE0adgGhY6bde2VcBnyb4pRls2rv02wi2huM5JEUr+5 8O6dXEqvV/SYm5mwHt0gj73vZooPF+fKnjNHI4Ckib+LZKzugT0enKr4eUHoAp+SuOR1zBxYQxCA K983faJFA+z1GA/DrI9aNr/O6GUy0LpYTI7FRIw8Xf4ISqX8MSXyFLVmnDpYE/OMAPc1fvkLQLxU 2cKE+AYpmFWQ97J9d+LV4PT6NjX5EVX8w84+ydEuyj8ZK9gGC+VxdxNN0zs9pNs3uYNmAzN2eDeX zW/UIsUgPUjpgEz7QznDoHiGCYQYZ/9mVK9o9iALvp/efIFG0eLxbGPWpDLF0vB+rj5Emif4M+fg StgVvhuoQUOy9d07/qOdEGCe53CF6nNaqcYO5rNT+UD72Pd2FCgRBeyGrV2E4k26pOQ35j9WfeVt Hr8HMpeig4nqdhy9VT0ima6bFseP7kGtDw94xmHgtjM/m2j9/Y8ZAZ90Y+OkjpAr6Apz3SZCsYuF Uqg3k11wqr1wDel5ogevlSKDNeekVXJd9G7OIzYr/2nexHgrpk6ftHM8BuypNJdwNKQn8n4+W91D 8u/gEnNxqNvzRZnOhoaxbYeu0F22o3nKjekdkUuLRXc9FYmGZk53GFtk4hFqW2WzuURi8Pu21tbH axYzTJDyqyKvTCra1Wkhc2Jc83g9LW5eD1v2iHO13gfR9Rx9yM1tRaazpvulwt0LiB89aIsJ0gPE YlPPtrAVHHBMLUb5zOBS0upfN9eV/X9WCS+QcXCUAdsk3Tl9JDfuweEm9Vfl0pA90ZTMBO2Eqlq1 FxXgKWGdIVd1469Kv46M4OUl8GmGfRkdqWVrP5+tGTIe3DSMXBey4G74dI10stxb8b/8kRRSTxSy S07L7Lwe/ztJ2VXwmRORcdqXHRpuInB8P5lsskHxkushEs3JQoIFvbhoKgza6anf076emAyCyqLV jppUfAR1ilRFc+mYWmg9/wsa/E3tg/e8cCWH8PVU+RedY3EaANyj+GUqa+QPbA4rAJJpDHLC0zXe Kv33VMPEYOlCK9zjhTyiukeB61NNXIBp9TzZTl6m88saFweQYPJa/wA+CGVq/FMCrivXHNgLKQZb akCfuKwxDL6d9C6WMmCRGGiQMfr3r62KRT/KL2+ea97crntkMph8DFn9qQjHoPNK7X2GRXmUQf5l iM4U04OqtS69B05D+XW9q6ObgUp3xJETin/ZLtMa20hKAFE4dsGOrrlQWdEuYczRVwqDXtig8qcl 27yl9woOgPpeOF5Bgf+nxESoEL9pKO56D+8KJ/TRQ77SJPynfbTEz5KwctvQ/YCTIQmr6A9VBoO1 iELg2tshQl8+Jr5iVgJt99VblHVvXxkMUJZ4WUauMSobwZ4etct0/+KzbP3SKcLPiszftYHNX4rV U1N71hXAHe+btIhgL2Tq8SixThZmJvHw5hMAEgGUrggZKC6H1Yc30y7MfbWRj7PRVhgokCT2nPb9 XwOppeZso09dLfiAF9fbkrwFmhUm7/GvhNEKejQGEoRDsaBydi5jd6/DM0MbQwbD8Pt4P0LTVhlB 6TX2VCpoEDpTFm/APpcTGLNP8UElvNMfBtMDwcden0wFG9MIeUEBEZMVL/XSgTby2IEsEnwlIrMF jvt/bXFRrwC8ee4nRP6Xyk5ZR3gnIWjtkVxnba9ZlOhIrUi8x8kxMm9iH3VKLazBdH6oZd3/Yw2k T8oIeZK95bfb2yHTN+q8Rlq3fTIXQxKwWPNRrNaOUv1J1/OH91hRnpL198+J3pOSG/8I9fdfTEjv mZ//PuD/q+YiDuOFFjcYlGoSH4JihS9QWVMnGToYQuQEoSCbnbrZQ2r8eyo8vyy3k+ns4ximE60Q qlhyo82fOCE+SAUYE6itqF7+7IQlLI39T7HsI7QjTrMiddJkTIDyB2X3LRUqchPV7DG05waoVHSB r3xKNhWKxQIEXdTr6LdprD5YZFqNfnIIYx2s9UX596Ub9CKahzPTz9Qe/657pXAy0Nr52XNnoqXq SneEC4gtBZcG39phNB5wPd91Wg3uuTG9aXOgBunAc8vbbbdVGTYI1m1j02fqc0wpCSmuofYEXGzq QmFi+8CcfoCdC/j+A5DLM3rOm3NMiBSXnm5TtDTq+b85auFxnE1Z1Q/KZqNI5mPV7kWgsl2Kkjph 9BfygBx6YPrqJJoj5cWMUwKUaAje+3tkDI/JqxxnG7p+mAsPexD9YdBvtDQqUh21veiqAdOrgmCs PJthuAvzcbOdUlqfzUhCoY+B7eUPaWTWff236wN3hgWVOPhYxGn4avvxNp2x6znYRh28tVMFuv+t A9DEF+7ktLccQL6HIPADWzQrFCzMM/jzsplYyl8emD7v7tqFDoAGtNIE9lmbEmCGf/6c/xGFUM1f HYR+jNTi4xAA4JyQ59vQZ1TRiQRI7xnQ36izFwQj4ddrHR6G8sydPc0q+RlKYK77sOkvCMHnyuw1 gkgIMKWmKe55hdoaPs+PyFSN/iP/IBT7JxQ7yEuNtFdFUd72vmevqFH89/djDz4lASSMid2lJpI3 Wh0D1dC4o5gme/VmTN6c1VWY6cjUNkKqxir1MsRPTB+E2GbD5HqnbmACfqAVB9muYTUKlij5bRUA 1OlMSvBzY/VXiK7vMs2SCiDAZCyhP/2EdRlKa2d30wTbeaMm/Ia9323vpjfEmGW0tuFPBS8VmDU6 JY0m8AXc14SHhTv61TFSBgzKr+T24TurfXNXQvzbtPzxTW3tj3KGAqzNaHNz8hKE5BKeR22kvqjd 8DfPA51Kik0dgky32Dr2nkC/U/AcwKh+WH+u+RlA2CFd/VYos0cgo5DT9oFTplQ/RzIJoiVAI8nQ Ia9MCED0SmmFvmqblQXSiAqqwfGgrQcfgARGs+IPJvi2xAqxLk3iAepcTvBZBMEupRxN8Z3S0LdK swUhUOYolKUuIc3JFKKxM6ylsUmbp4ub/xLeflcqeXtc21Nm50anFqB0RGX5uE+R4KFCotrZpGPI Tf8ilUsjNR2PRkaEQDtrgjdjknvj9/nj5WQFQB2JHeVgYDMycQffR6ddfcIdEZLpIzw6OV/kRmPp coeF5/1IGkjiWPH/NKVUKMzazKSOUnUhd+059SaxVNaXCi+KUyELYvgju+GgLbYxA1v+eBUC4vDI 1pAPDv0ozXC/j+UVe/ZdiO2ljPPOCFQ/cgCXeUPYzrGCJGAvz+aFlr2MAP0X1pFeJENIr8sFACGk BFhv7T4CRYMQisO2QNOeH05C68dePsHX8oY/Wfvo49+qlw4ogzrIkV8CGlRd3e9E1DnLiCbq72Wn N7Ulq0iQTVRB1vaZH3Aqc5kVcldRRNEyKmeN4pT7/osrbIfRow+2E7gvXw9RjfUZh1O30s+uq3Py AyhTqG9N7Z69R4b6U2pCklR7E7jBQq53ohlg3IQ+9q0ziTDjM9novyNYuXKfE6AVQMEU1P71WOQ3 cyiJwB1yWbD+x9wFWrSWhVcY21FaRoIOgvYUnIAyw/71A6N/448QZODYY4h3pTQT6PmLfMxK0+X3 8rYNfo1iPIJCJ4iNzwVSmdWkzeDhtwbZqG3l45dfLVixMPqE6h9npHgNhdSvcZGFU7MoBNuTOvPH DRaBu9/nDD4X7UMZ4xhyNqU+Jn+hSpUgGi334aN4TEqMibBI3yOIXZ5+zA/sJ4YO7/XJkn3vUOAL 9PSKbOgGfgaKoIF06pSNibC9BhjN9+kXAMU0md3RGWAs7v+SdSCLSA8zvhdAwMvFRw3+/Ym5nchI JuQVI0Q/eNyd/im3Fzviv+QF6q8+OfGBuj5yvKSQqtGgYmzcKZUVm/syK3tOyCJ0xD3Xm7J6pfs3 1S+IMxxTAybAEoHFVy9krPwNu4Geh7aqzumiiDAw8hxMQo1M87IV4NAKUSg15sgsr7blknU9rnkp 6bMeGK55zGupVOUBKoBQFqM76tQKc+Y1cN5y00zMWNNlCb4XgGd7/RUUOW9NRc//2ZmK1XGykthi PjHrRomZE1MTQZOxiXDccsHySiFzJYQMHoL3u1MQxpUKNz4AjzZt4zuqoq263uM30lebinF4EvJ8 GGjMOZOUMKSs+3fjxsP6vSDLNxwFsl6qx1A3631w1w9yYpho49/EXl4eoXJzCnPi3TOzJLyoHthv flVVimcNrU+Os4iUn6Iuxt+o46I0tsPMnEEvaCozinli7sMMYfrWdTaylTgANtbHUDCSJD7sQmLb XZ2fmbVshU3uWu4grTzC4lk3TGWFyAou0Ugh2TgJwdDBXz/zRoUJDROOJtwhkni2XsDbesQ6wrbD UPOtkG0R8+AW7IlF6Fujx9l6P94c+bMivUNcmfr6x3dq8+nfpk4NTkYx5CGVRQalyuN9A8s5eKFD vKdA4l3MqCEUtMtdk2j7xgwDP1c6h5WLN2gUmZA5ZWhxD+D8TWmCldmyV3Dh6BOhs4U8XOx2khSK BFV1UWM8eAeeWcRbnn3lyb7nHsp/NxY8K0vDrRUAeDgRhp2R15hIL/HZVLNVds5iIOPmnTZv2B2I ifr2tl/r50uywW7Ye4VfJLQc2DhGAyjA6NphM0gHynImz/tnt3x/68sde9fe7Gv5jYi/PZC3u1a0 pFdhZVXprA3pBLHHh6GdaxnirMbydGb0S7afybXLx+yb+5kvs4Cw0Ao9ZkaIkc6qISppRqoT9L1E f+t6DgdpGNZn8kYddwv7RNJfPG7x76jMsomUdNaaw0OhJSjbcgFxK1ST0R1oGjInzUX1EEROOHwp thjema4HVjWfskFbJDXVgedx/1MR47l3o9SRRmS73r2SbTVvFRIpwjMT1IqUFFqEgitWrPfYyK+E Odg7I1ASKfildIZSYBibxlmrZ2OXEw6jiHnYpJUKD/e0Wzwmgb4eBnFlkPFV52fUJ8s9g6pX5kc0 SHUYVkPPjZ/XN3cZr0sIpnAlTEBK/fTV3KmIK4yHq9dBqCKcqRvkE7u4iALT3lkPmrgoxbKTaOJ6 kpnCj64OWlERfaJuoE7ezuEySqc9O0KwzVhjFNYZVBOcL9ejNz65leRiR098/vqYFo8yg7UkdCUr /0tnJPLS9Eiowz9PG6niWeebTYyCuPGSX9KTxWqZAv8kKbJVjcJISUIVSVEdFcwrT4aoKjUuTra8 7hOahW0Pnsqt0TdCWfbYX+FDZhnfOeUV8bhLPVYGkKrOTi9YpxZDgZO3JjRXsEOh0eBNhBQY65ny iNqW7DOpN/Vt38qwNbSIj0B0KK47Oid2eT2xazeRZ3rXi2l+/J18oy49EbzhnKIaNwrUC8TMhguS X6DwAIGPJj9bVkE+r/i6050WdI7NJtLFpJHqO+6576dNRqZDNAwCG6JKlhklUMD0kN9uppEJ968e 2AzBi2/ywVVvhZixbHVfqRRkfpyNwcU9QeyhHAxxNS99nZTSWmS0q1jEONzhIGugb5edz4ktIOTC LyMyKiVZ/xWZKxkMPNTUgfeER1SV5BjRaehb3amRYrzfSENzcam/plfR7iWEKz0ZA4SNo/oGSLqP ZDdRsMbD0KYsFy43InDl7JtNohIs9fslE+DiE8/pOzEQJqg8gMyvnG90m7thzOWVzx17zSabLWZM 6rMRLsBIUtNtaEUBC69HNDoYy67sTyzKve5Joac4OU9G4hQA1eT421DGevIccgxl10tQhXci6a7D WWRZAvuDBtcFlZt/7NQ3fQGIdxziGiFB1y7veZRw5PvLrWbk8ZHpcLiCe1JW73+HstrV+Z7i/9ZV /Vs8eeH6F/ZenxSzJFKJ2YLGVyrltEO4DuKeynnqDxIcqgiYwxv4a6LAWUGebhSz+du/xvKF5/gw 7K/Dx7BHz2gWyD9CrS57ra5eDVrf8d6p5uxQ4Mr3wdgKUuaEMvWe2c+AGcMToSOVzGD85G170g2v g6j/lfNGn8/gaTo7YwzDjt7HaGOf5RNRDKCnnXyzPKI6g71RIYv+NHL2YlFcQAwTocXpZMPV2GhI yaO48q1/MMb7aD55VSTerEpG9bk9LoY+WYtB/0Lcw/f6ykeibZFQaMBV1eP7PfY5BXeFGA8u/Tv9 ggWeESM+FrLJ5Xz0jOAd03Y5ksFBmdthYcEUVrua9F5cTQxHH5rMdtLf8+AEkzcmf8ypCGKodOQR WXpkGKjetvAdw1LGs20TACGClyzXrX8v1IgfOyyXn8MxpryW1mTUxFgIDUMqj/UoyAoJpcGkZ0AS ED2PYczZ/BLa9gGXZsq8jv4EfphDtcxUzMFKtgJar6HKf3KqE2gYCs4b1H+GGwoCfa2s4/30z5A8 9eyb33rixy9rzQLNo89zdG+xkepP8O76gNVIiHC9R/CoZZyW4c1kLeyKN49dJFYZoFokwBEeIEQ0 9Xmx/GGuRbMPduMFNhzcdcljrFQE9LnrpbNhh8zw/jWH6yrB+vITcIBKCqO8gGg4MoK7gcpjMDvB IsbvmrHwpYqtUmxRDqZc7eQ/sLZ86m9ZIcfWtoLeaA8CVPwQzCUocmuhCvc+6VitYzPc3fY3YXpp WPX9VVOvzqzdY9timMzyPdInu2HY8x2NhibchtzK29BaRjPyRuN19Lh1E2//ztJgsR+1NiNTue6F B33XSLGKfymj7BM2rqkZoVjDRwfD6AkbL2El5S5x3K1sqhYD5RA4hzK+0VlDZbsbdX+GYUU1Rf7K f7Rn7OwcOr4Nc+UPctcgqu6+/z7KIG/W2jJCpro068Hwdy9jFcT4Z/AwFL6bIWLMFK5ZcGztbuFT C6/NbZMqP9mmv2gqHLr+geSI+9Ul9uyoxhpja6RHPsd0tezGFSV2teX7YtjoxyOzxsWerF7PwBJy YYdknl/iw8lfnTWdNSv0iMB3XspE3A5BaCemFRN2OVuV84VDwsQUOEdUK9UEds65bkrDv9nRTw3o list6U7mWX5lq9dzJOVy5r029y4ZiEHfqCvjfhDgIEsOu4Rxvby5wRiVasuKXDqJ3ez8j42CzywX Z6yeJUIToKjiaghIBVCwI2XjWDl+Gon7pNwxAZqfToxh4He9qyLB5ZFBZvYoe/UBabt93WMOxMg9 WhnJLDnVjEzVfH/na4T3ZQyGDy68vi0tXMWBQN+gKw88iN7ONqBWvaVItTzgWQV3/LsNAgBHHzMH K/aRH1JXFU80OT05hMbXCE+I2zMvIdJJeGbnBnHNeNiwUzeJs7Kp9A0HtxUHaojZ0b2EFZ96DT48 crVvbswEbHiiUfTdUCDupfLAOleCV0k6DgeZwbHIxQURTjxRZGsiETpqWAp4cyErQ/rjxUo63/ez or8uPISAulU4+rOnr3BxTR2XcTlk6RXISMsYUYXFRswrFUnFpJqbU5MOCWNrswz/x1eeecsZo+4R gkfzNeQ530XiSDFSumEvBc4H76+g9lpesi5B+P8SWRt+hppxUaRmkTIP+eFym4Z3EqsExHmEcqPw CHnlkrA9L+FjWaTDmguL+So8j4t9PpOlpPiGxymows9ZzMXR4YWnF2CzzVeOCqlTuu5iM0pN1v1N Nuq8sqp5IhTzLFn60V9RveyGlZHbmzIxuTvQsLVD8JEYSgjY/2pgK6jM9YvHztmY56V+TIrGkvoX QyaFpIjemthxnFCjPBfOGEXUyFu2AkB1cOIqlrnfg3gwrEKPE1tTqVTJ3akPFseqDzRS+MTFHY0E Our7nrYR4vogO0/H0o8npiThthgg9m7ggMgQd1ygen4hV8zHA0joBWwIdaWs8Eu/est6vYr4jtwG avK80KrDyM6Q83UrGulG/n3emhhFIhwk2G/JA6Dpds4OCM8iSxNhs1j/3gKjcGoFnuhwjXdVsmTY 0jOt3KzKCgMXTb2/aX5BtDHI42w7BBr766mVMUJbLXlS0PkmKxf913K+MeWN4cnDSPzoUIBBAIFP FyryGe3aKdv3cZJF9BqwWeRrrgpnBKzlPCLdQo/YIEuJ861BDSDczj9jsrMH85LhOWM4hpXyDGjU PAWUSwPkKK2FBETAOMPAZw9c57a887m/2I61lCx1EFeFhwVMHu5foxIG/alOullHvCVhRIyekoMq 3IjqhkFf1uzIqM9Ovl4oNI6kM7fdw5jFwTCTTINYtok75TpXkumEfzzoewDisbbXNckcP0zwnTxr 3p1W++a6kqV1A9nyFmOyac1j4wo6Rsn5kvVQvDjLCGnTHRxOrgnXQ4cEvMhRKrLkD4W+UTSJGcAl pLfpZR7iCv2ENBPdfQ8EMXyQzAGvadXj/1W07PW2gtMwZl8Jhxpuf8d6yVsyMdaGoU/8yfuBbK2C f3+Vk6R7qUPx+8ok8PyS0bz61W4K9S7N2djvJj1ASe/fKEAaalRjXe421qMzINOwxI6XVfiSl+RM sWatroyXazoCC20UQdZqRFNCooSDKmtT3e+0edYcjAm+9QdXVs9kGBdYVhecQUlDuTnr/YvcoZhy lFuGbEyszawP7buSPDcttyrXd7PzT07mbTVd8iyr2Sb9pTJ989yh7wMFWFjJUkhJ1DlQZli8i1oo Kal2sZzn7fX93kvb1N+qx+jUoBNqiGPULnS+OovLEl2WH5ncq3TijFJe7yH+lxkgF/jPlrGifGtH g3Kjkkop8zLtT9z49/2ezhcuArKy39zfuCNtMZ7xkrApuWbM81Vqagy5dn1Og5h245PAdUMDRvQi r4MIrAA/lZ/YMcyshk+sIKE1otVZrQs0LOLVFqbcuTQ+5lDzr8SZxZrZ2eHMHnYab1zrxfsLJcgZ lTgskSAmeq0ru8/2Y6yhgc332e8cMWM27SQ+7Y/Q8O/FG7hxy+QtWLuRzO62SYMorcQDpD/njr1F DM3O4u4PGH8W0U5mz4riUDOgZPEBpUqmoHfgoEZDxa91A/s0373jq8wrt8Hz3rrr2cHWZoZIMyXi eVV9X6RJeqtAjI0StUvvIV1tdGNu8orxseQ8Bl8pWDRfsr/259aKUQwBg59Xa5TSM8Wf8+htk/zX Bt5xk0mO+rgs4/O2To/TBM/FRiviE182Lg/thmfh93anN0JPuDiHgVmoXDfoFgjtt5Zprm8RiwRV jT8b/GKSw8smrBh6RrT1e7Gs/tuMOucEzlQWgulh9qzk0AUKm5t4JzTQa6BfRh0haMA0ZmCgxWqS 96bze7tUDgkegrKUu6aTSqYL1WCelgtg74qWR+ttpRXArRGMyOKOsMHmJPu1iDcSVYhfkiRI4moV BYMg0Rn0IeObnO4zXKS0K57hzA3s0PIP1dPoTf/bUQtSIJmMFVUv+kaEKl04L1av/BvxGbKdRvRO /Z5K/+VERoojkigYooMTN4l4tsUnQJWHdOovD5m8XOBF4bz2YHHJ0KC1PKeRqc0+a+kX9