In order to do global survelinace of this new virus I figure we're going
to need billions of tests. The biggest barriers I believe are
logistical. Shipping back and forth to a central labs isn't going to
cut it, and neither are test kits that cost $800 each.
I think I may have a plausible way forward to a low-cost and easily
mass-produced test for the SARS-CoV-2 virus using mostly items people
already have, such as smartphones. The most expensive reagent required
will be labeled oligos, but those scale very well.
The key observation is that smartphones can detect as few as 1e6
particles/mL if they do long exposures (180s). This was using
bioluminescence. Reported here:
https://www.nature.com/articles/srep40203.pdf
The other side of that coin is the expected titer of the virus in
sputum. I don't know of any reports for SARS-CoV-2 itself, but for four
other respiratory viruses, including one coronavirus, it ranges from 1e6
to 1e8 particles/mL :
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4187748/
This is encouraging! The challenge will be to detect viral genomes in
"the field" without sophisticated lab equipment like a PCR machine,
lasers, 3D printers, etc. The concentration will be 1e-15 M, a
challenge, but then again we can detect single molecules using
fluorescence. The questions are:
1) can we get the background low enough so that the dark current of the
camera dominates
2) can we make the signal high enough to overcome the dark current.
1) will depend on the availability of mass-produced filter technology.
However, the best filter may simply be time. Provided the fluorophore
lifetime is long enough and the camera synchronization tight enough one
could simply measure the "afterglow" after the camera flash has turned
off. An interesting candidate is europium. Most fluorophores decay in
nanoseconds, but lanthanides can be microseconds to milliseconds. In
fact, "glow-in-the-dark" toys usually use europium-doped ZnS or SrAl04.
Those decay over minutes to hours. What I'm not sure about is using
them for FRET. I would appreciate input on experience with this.
2) I believe signal could be enhanced by using very luminous tags (such
as quantum dots), and/or by using multiple tags per genome. This virus
has the largest RNA genome known to date at 30 kbases. That means there
is room for up to 2000 15-mer tags, each with its own label. The set-up
cost for doing ~2000 oligo synthesis reactions will be high, but it can
be done at scale. You only need ~2 fmol of each oligo, 10 umol
synthesis is about $1k, so I estimate about $1 per test using 1000
different oligos. This price point will be important if we want to make
billions of tests to be used all over the world. In some countries $1
is a lot.
The detection strategy I am focusing on is FRET. That is, oligos would
be made in pairs, recognizing abutting sections of the viral genome.
Like this:
5' atttcgctgattttggggtc-ATTO465 ATTO550-cattatcagacattttagt 3'
which would anneal to one of the current CDC test primer sites:
3' taaagcgactaaaaccccaggtaatagtctgtaaaatca 5'
The result in this case would be maximum FRET efficiency only when both
oligos are bound. From what I can tell, the ATTO465 dye is one that is
most sensitive to the blue peak in the iPhone "flash" LED spectrum, and
ATTO550 should give maximum contrast between the green and red channels
of the iPhone camera. That way you would discriminate presence/absence
by color. Red=virus, Green=clear. That is just an example. Other tags
might work better. Maybe quantum dots.
Additional aparatus would be required, of course, and at least a few
reagents to crack open the capsids (DTT and guanidine). These could be
shipped dry in foil packs. The end user would simply tear it open and
spit into it. If the intersted party is performing the test on
themselves, then there is no biohazard. Heating to 70C (cup of coffee?)
should kill the virus, and these reagents will make it even more dead.
I'm not sure how much purification would be required. The assay volume
in the Nature paper above was 1 mL. I expect signal would be improved
by concentrating the RNA as close to the camera as possible. It may
even be possible to absorb the nucleic acid directly onto the cover
glass of the smartphone camera. RNA sticks to glass at pH < 7.5, and
not much else does. Quiagen EZ1 nucleic acid purificaiton columns are
nothing but silica glass beads after all.
There are still details to work out, but I am intruiged by the fact that
this seems physically possible and the potential of being very cheap,
rugged, portable and scaled up rapidly. It would be nice to be able to
leverage a device that is in already in the hand of half the people on
the planet.
Comments? Insights?
-James Holton
MAD Scientist
########################################################################
To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
|
